Molecular marker primer for detecting wheat stripe rust resistance gene qyrpi660072.072.swust-4bl and application thereof

Abstract

The application discloses molecular marker primers for detecting a wheat stripe rust resistance gene QYrPI660072.swust-4BL and application thereof, and relates to the field of wheat breeding; in view of the problem of a too large primary positioning interval (67.20 Mb, 1.5 cM) of the gene, 7 groups of KASP markers and 3 groups of InDel markers are developed based on exon capture sequencing data; through detection, the most closely linked markers KASP-580618 and InDel-396663 shorten the genetic distance to 1.42 cM and 1.00 cM respectively, the physical distance is reduced to 7.76 Mb, and the positioning accuracy is increased by about 8.7 times; the primers provided by the application are suitable for high-throughput automatic screening or conventional PCR electrophoresis detection, and can accurately identify the target gene; the breeding application in the embodiments shows that introduction of the gene has no significant negative impact (p>0.05) on main agronomic traits of wheat, and provides an efficient and accurate auxiliary selection tool for wheat stripe rust resistance molecular breeding.

Description

Technical Field

[0001] This application relates to the field of wheat breeding, and in particular to molecular marker primers for detecting the wheat stripe rust resistance gene QYrPI660072.swust-4BL and their application in wheat stripe rust resistance-assisted selection breeding. Background Technology

[0002] Wheat stripe rust is caused by the wheat-specific strain of *Striga styracifolium* (Striga styracifolium). Puccinia striiformis f. sp. tritici , Pst This is a global wheat disease caused by fungi, and it is also the most widespread, risky, and damaging major epidemic fungal disease affecting wheat crops. Chemical control is an effective means of controlling the disease, but long-term continuous use of fungicides with a single mechanism of action can easily lead to drug resistance in pathogens, resulting in a gradual decline in control effectiveness. Over-reliance on chemical control not only increases production inputs but may also bring risks to agricultural product quality and safety and the ecological environment.

[0003] Breeding and promoting disease-resistant varieties is the most economical and efficient way to control wheat stripe rust. However, varieties with a single genetic background of resistance are prone to homogenization of resistance genes in the field, which accelerates the variation of pathogen population structure and the succession of dominant pathogenic races, resulting in a weakening genetic basis for wheat resistance to stripe rust. Some disease-resistant varieties lose their resistance within 3-5 years. At the same time, some disease-resistant materials, due to carrying disease-resistant genes, are often accompanied by poor agronomic traits, resulting in a shortage of wheat varieties with both long-lasting disease resistance and high yield and quality. Therefore, improving the overall disease resistance of wheat through multi-gene aggregation, exploring and innovatively utilizing disease-resistant genes, and breeding new wheat varieties with wide adaptability and long-lasting resistance remain urgent technical problems to be solved in this field.

[0004] Zhou et al. constructed a population of 211 recombinant inbred lines using spring wheat varieties PI660072 and AvocetS as parents, which served as the mapping population. A major stripe rust resistance gene, QYrPI660072.swust-4B, was mapped onto PI660072; this gene was identified using SNP markers. AX-108847266 and AX-109412222The physical distance between the two genes is approximately 67.20 Mb (362.14–429.34 Mb), and the genetic distance is 1.5 cM (“Genome-wide Mapping of Quantitative Trait Loci: Conferring Resistance to Stripe Rust in Spring Wheat Line PI 660072” Zhou Xinli et al., *Theoretical and Applied Genetics*, 2024). However, this large interval does not meet the requirements for marker tightness in marker-assisted selection breeding: in practice, the genetic distance between markers linked to the target gene is usually required to be ≤5 cM, and ideally ≤2 cM, to ensure an accuracy rate of over 90%. Although the initial location of this gene is 1.5 cM, the physical interval of 67.20 Mb is still too large, which is not conducive to gene mapping cloning and candidate gene screening.

[0005] Therefore, there is an urgent need to develop molecular markers that are more closely linked to this gene in order to shorten the physical and genetic distances of the target region and improve the accuracy of marker-assisted selection. Summary of the Invention

[0006] Targeting existing technologies for wheat stripe rust resistance genes QYrPI660072.swust-4BL The lack of tightly linked molecular markers and the large initial mapping interval (67.20 Mb, 1.5 cM) make it difficult to meet the needs of high-precision molecular marker-assisted selection breeding. This application provides a KASP molecular marker and an InDel molecular marker that are more tightly linked to this gene, further reducing the genetic distance of this gene to within 1.42 cM and the physical distance to within 7.76 Mb. This provides an efficient and accurate auxiliary selection tool for molecular breeding of wheat resistant to stripe rust, and accelerates the breeding process of disease-resistant varieties.

[0007] Specifically, this application is implemented through the following technical solution: First, this application provides molecular marker primers for detecting the wheat stripe rust resistance gene QYrPI660072.swust-4BL, wherein the primers include any one of the following (1)-(10): 1) Primer set KASP-615501, including primers KASP-615501-F1, KASP-615501-F2, and KASP-615501-R with nucleotide sequences as shown in SEQ ID NO: 3-SEQ ID NO: 5; 2) Primer set KASP-411083, including primers KASP-411083-F1, KASP-411083-F2, and KASP-411083-R with nucleotide sequences as shown in SEQ ID NO: 6-SEQ ID NO: 8; 3) Primer set KASP-580618, including primers KASP-580618-F1, KASP-580618-F2, and KASP-580618-R with nucleotide sequences as shown in SEQ ID NO: 9-SEQ ID NO: 11; 4) Primer set KASP-302911, including primers KASP-302911-F1, KASP-302911-F2, and KASP-302911-R with nucleotide sequences as shown in SEQ ID NO: 12-SEQ ID NO: 14 in sequence; 5) Primer set KASP-355850, including primers KASP-355850-F1, KASP-355850-F2, and KASP-355850-R with nucleotide sequences as shown in SEQ ID NO: 15-SEQ ID NO: 17 in sequence; 6) Primer set KASP-488572, including primers KASP-488572-F1, KASP-488572-F2, and KASP-488572-R with nucleotide sequences as shown in SEQ ID NO: 18-SEQ ID NO: 20 in sequence; 7) Primer set KASP-668340, including primers KASP-668340-F1, KASP-668340-F2, and KASP-668340-R with nucleotide sequences as shown in SEQ ID NO: 21-SEQ ID NO: 23 in sequence; 8) Primer set InDel-396663, including primers InDel-396663-F and InDel-396663-R with nucleotide sequences as shown in SEQ ID NO: 24 and SEQ ID NO: 25, respectively; 9) Primer set InDel-252720, including primers InDel-252720-F and InDel-252720-R with nucleotide sequences as shown in SEQ ID NO: 26 and SEQ ID NO: 27, respectively; 10) Primer set InDel-098927, including primers InDel-098927-F and InDel-098927-R with nucleotide sequences as shown in SEQ ID NO: 28 and SEQ ID NO: 29 respectively.

[0008] Secondly, this application provides the application of the above primers in detecting the wheat stripe rust resistance gene QYrPI660072.swust-4BL; when using them, any one of the above primers (1)-(7) has a FAM fluorescent tag sequence (SEQ ID NO: 1: GAAGGTGACCAAGTTCATGCT) at the 5' end of the F1 primer and a HEX fluorescent tag sequence (SEQ ID NO: 2: GAAGGTCGGAGTCAACGGATT) at the 5' end of the F2 primer. Specifically, the application steps are as follows: 1) Detect wheat stripe rust resistance gene using any one of the primer sets (1)-(7) with added fluorescent tags. QYrPI660072.swust-4BL : Using the wheat genomic DNA to be tested as a template, and any one of the primer sets (1)-(7) with added fluorescent tags as primers, PCR amplification was performed. PCR amplification system: 10×Buffer 1 μL, MgCl2 (25 mM) 0.5 μL, dNTP (2.5 mM) 0.5 μL, F1 primer (10 μM) 0.1 μL, F2 primer (10 μM) 0.1 μL, universal reverse primer R (10 μM) 0.2 μL, Taq polymerase (5 U / μL) 0.2 μL, template DNA 50 ng, ddH2O to 10 μL; PCR reaction procedure: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 s, 55–58℃ annealing for 30 s, 72℃ extension for 40 s, for a total of 30 cycles; final extension at 72℃ for 5 min.

[0009] After the reaction, the fluorescence signal was detected by an ELISA reader, and genotyping analysis was performed using Kluster Caller software. If the amplified product was found to have the same genotype as the disease-resistant parent PI 660072, the wheat plant was determined to contain the QYrPI660072.swust-4BL disease resistance gene. 2) Detect the wheat stripe rust resistance gene QYrPI660072.swust-4BL using any one of the primer sets (8)-(10) InDel markers: Using the wheat genomic DNA to be tested as a template, and any one of the primer sets (8)-(10) as primers, PCR amplification was performed. The PCR amplification system (10 μL) consisted of: 10×Taq Buffer 1 μL, dNTP (2.5 mM) 0.8 μL, Taq polymerase (5 U / μL) 0.2 μL, forward primer F (10 μM) 1 μL, reverse primer R (10 μM) 1 μL, template DNA 2 μL (50 ng / μL), and ddH2O to a final volume of 10 μL. PCR reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 35 s, annealing at 58℃ for 35 s, extension at 72℃ for 35 s, for a total of 29 cycles; final extension at 72℃ for 10 min.

[0010] The amplified products were separated by electrophoresis on a 3% agarose gel. If the target band was detected at 220 bp, the wheat plant was determined to contain the QYrPI660072.swust-4BL disease resistance gene.

[0011] Based on preliminary localization results and combined with exon capture sequencing data from the resistant parent PI 660072 and the susceptible parent AvS, this application developed a more compact and precise KASP molecular marker within the preliminary localization region of QYrPI660072.swust-4BL than traditional SNP chips. Simultaneously, InDel variants in the wheat exon capture sequencing data were mined to develop InDel markers. Using these newly developed InDel markers, combined with marker-assisted selection breeding strategies, the effective genetic transfer of the stripe rust resistance gene QYrPI660072.swust-4BL was achieved. Furthermore, a comprehensive analysis of field phenotypic data from the examples was conducted to screen and cultivate wheat lines with high resistance to stripe rust and excellent overall agronomic traits.

[0012] Compared with the prior art, the present invention has the following beneficial effects.

[0013] 1. Significantly shortened the localization range of the target gene.

[0014] This invention will QYrPI660072 . swust - 4BL The genetic distance was reduced from 1.5 cM at the initial location to 1.42 cM (distance to the flank marker KASP-580618), and the physical distance was reduced from 67.20 Mb to 7.76 Mb, improving the location accuracy by approximately 8.7 times. Figure 1 The most closely linked InDel marker. InDel-396663The genetic distance to the target gene is only 1.00 cM. ​​Compared with the flanking markers *AX-108847266* and *AX-109412222* disclosed in the background literature (Zhou Xinli et al., Theoretical and Applied Genetics, 2024), the present invention develops... KASP-580618 The right boundary was pushed inward by approximately 7.76 Mb. InDel-396663 Reducing the genetic distance from 1.5 cM to 1.00 cM significantly improves the linkage tightness between the marker and the target gene, providing a more accurate starting point for map-based cloning and candidate gene screening.

[0015] 2. Various types of molecular markers have been developed to meet the needs of different breeding scenarios.

[0016] In breeding, SNP chips or simplified genome sequencing are commonly used for QTL mapping. However, the marker density is limited by chip design, making it difficult to obtain a sufficient number of polymorphic markers within the target region. This application employs exon capture sequencing technology for deep sequencing of both parents (average depth >60×). Based on this, a rigorous bioinformatics screening process was used to identify candidate SNP sites from 1202 differentially expressed SNP sites between parents. These sites were filtered based on multiple criteria, including sequencing depth (≥10×), allele frequency (0.36-0.64), and parental homozygosity. Finally, KASP / InDel markers applicable to breeding populations were successfully developed. KASP-580618 and InDel-396663 Both are most closely linked to the target gene; suitable for high-throughput, automated breeding screening. Figure 2 The detection efficiency is about 45 times that of traditional gel electrophoresis labeling; InDel labeling can be detected by conventional PCR and agarose gel electrophoresis without special instruments or equipment, and is low in cost, making it suitable for promotion and application in grassroots breeding units. These two types of labels are diverse and can meet the breeding needs of different levels.

[0017] 3. The validation results of its application in molecular marker-assisted selection breeding are good.

[0018] In this example, marker-assisted selection was performed on the F2-F3 generations of the transgenic population Mianmai 902 / PI 660072 / / Chuanmai 104 using three InDel markers. Combined with field screening of agronomic traits (plant height ≤90 cm, spike length ≥12.5 cm, tiller number ≥3, grain number per spike ≥42, spikelet number ≥14, and infection type IT ≤3), materials with outstanding disease resistance and excellent overall agronomic traits were successfully screened from the population. Statistical analysis showed that the introduction of the target gene had no significant negative impact on major agronomic traits such as plant height, spike length, spikelet number, grain number per spike, and tiller number (p>0.05), demonstrating that... QYrPI660072 . swust -4BL While enhancing resistance to stripe rust, it has no significant adverse effects on the main agronomic traits of wheat, demonstrating outstanding application value.

[0019] 4. The significant reduction in physical distance enhances the feasibility of gene cloning and breeding applications.

[0020] The two loci developed in this application are significantly different from the previously reported 4B chromosome stripe rust resistance loci. QYrPI660072 . swust - 4BL Located in the 421.58–429.34 Mb region of chromosome 4BL, it is related to the previously reported 4BL chromosome stripe rust resistance gene. Yr50 (105–645 Mb) Yr62 (~568 Mb) and QTL QYrus.vt-4BL The (363–545 Mb) sites are located at different physical locations, indicating that this site is a new QTL site for resistance to stripe rust in adult plants, enriching the genetic resources for wheat resistance to stripe rust.

[0021] Simultaneously, based on the new locus, the physical distance of the target gene was reduced from 67.20 Mb to 7.76 Mb, and the number of candidate genes was reduced from hundreds to dozens, making subsequent map-based cloning and functional validation possible. Furthermore, the shortened physical distance means a higher probability of co-segregation between the marker and the target gene, significantly improving the accuracy and reliability of detection under different genetic backgrounds, laying a solid foundation for cross-variety molecular marker-assisted selection. This application's locus reduces the genetic distance to 1.42 cM and the physical distance to 7.76 Mb, which can significantly improve the accuracy and efficiency of breeding selection. Attached Figure Description

[0022] Figure 1 for QYrPI660072 . swust - 4BL Genetic and physical maps; Among them, (a) LOD value map calculated from KASP genotyping and stripe rust phenotype data; (b) genetic distance (cM) between markers calculated by QTL IciMappingV4.1; (c) physical location of some SNP markers and KASP markers between the two sides.

[0023] Figure 2 The genotyping results of the AvS, PI 660072 and AvS / PI 660072 F6 populations were labeled with KASP. Among them, (a)-(f) are respectively: KASP-615501 , KASP - 411083 , KASP-580618 , KASP-302911 , KASP-355850, KASP-488572 Genotyping results for the F6 populations of AvS, PI 660072, and AvS / PI 660072; each dot in the figure represents a sample; red dots indicate that the sample carries the HEX tag sequence (homozygous), consistent with the maternal genotype; blue dots indicate that the sample carries the FAM tag sequence (homozygous), consistent with the paternal genotype; green dots indicate that the sample carries both tag sequences (heterozygous); purple dots are blank controls (NTC).

[0024] Figure 3 KASP tag KASP-668340 Genotyping results for the F6 populations of AvS, PI 660072, and AvS / PI 660072; each dot in the figure represents a sample; red dots indicate that the sample carries the HEX tag sequence (homozygous), consistent with the maternal genotype; blue dots indicate that the sample carries the FAM tag sequence (homozygous), consistent with the paternal genotype; green dots indicate that the sample carries both tag sequences (heterozygous); purple dots are blank controls (NTC).

[0025] Figure 4 for QYrPI660072 . swust - 4BL Genetic distance and molecular marker physical map; Among them, (a) the genetic distance (cM) between InDel markers; and (b) the physical locations of some SNP markers, KASP markers, and InDel markers.

[0026] Figure 5 The results of agarose gel electrophoresis of the selected F3 disease-resistant single plants with three InDel markers.

[0027] Figure 6 The results of the detection of the impact of the introduction of disease-resistant genes on important agronomic traits; (A) through (E) represent the test results for plant height, panicle length, number of spikelets, number of grains per panicle, and tillering, respectively; "+" in the figure indicates... QYrPI660072.swust-4BL Existence; "-" indicates non-existence; t-test shows p>0.05 (ns), no significant difference. Detailed Implementation

[0028] The wheat varieties involved in the following examples are all public germplasm resources or commercially available varieties, wherein: The disease-resistant parent PI660072 is a spring wheat line preserved in the USDA National Small Grain Germplasm Bank, while the susceptible parent Avocet S (AvS) is a spring wheat line released by the International Maize and Wheat Improvement Center (CIMMYT). Both are public germplasm resources provided by the Wheat Research Institute of Southwest University of Science and Technology.

[0029] The 211 families of the AvS / PI 660072 F5-F7 generation recombinant inbred line (RIL) population are the recombinant inbred line population used in the literature “Genome-wide Mapping of Quantitative Trait Loci Conferring Resistance to Stripe Rust in Spring Wheat Line PI 660072” (Zhou Xinli et al., Theoretical and Applied Genetics, 2024).

[0030] In this example, PI 660072 was used as the breeding material and was crossbred with major cultivated varieties such as Mianmai 902 (bred by Mianyang Academy of Agricultural Sciences, a domestically approved variety, commercially available, highly resistant), Chuanmai 104 (bred by Sichuan Academy of Agricultural Sciences, a nationally approved variety (National Approval Wheat 2018001), commercially available, moderately resistant), and Yangmai 33 (bred by Jiangsu Lixiahe Agricultural Research Institute, a nationally approved variety, commercially available, highly susceptible). The resulting hybrids were Mianmai 902 / PI 660072 / / Chuanmai 104, Yangmai 33 / PI660072 / / Chuanmai 104, Mianmai 902 / PI 660072 / / Yangmai 33, Chuanmai 104 / PI 660072 / / Yangmai 33, Yangmai 33 / PI660072 / / Mianmai 902, and Chuanmai 104 / PI 660072 / / Yangmai 33, Yangmai 33 / PI660072 / / Mianmai 902, and Chuanmai 104 / PI 660072 / / Yangmai 33, and Yangmai 33 / PI660072 / / Mianmai 902 and Chuanmai 104 / PI 660072 / / Yangmai 33. The F2 generation of six hybrid combinations of 660072 / / Mianmai 902 will be sown in 2024 to obtain the F3 generation, and the F4 generation will be sown in 2025.

[0031] Example 1 Gene QYrPI660072.swust-4BL Development of specific KASP molecular markers (1) Wheat material This embodiment uses 211 families of disease-resistant parent PI 660072, disease-susceptible parent AvS, and AvS / PI 660072 F5-F7 generation recombinant inbred lines as test materials.

[0032] (2) DNA extraction Genomic DNA was extracted from wheat leaves using a modified CTAB method: A suitable amount of young (two-leaf stage) leaves were placed in a 2 mL centrifuge tube, ground into powder using liquid nitrogen, and 1 mL of 2% CTAB extraction buffer was added. The mixture was incubated at 65℃ for 60 min. 200 μL of chloroform-isoamyl alcohol (24:1) was added, and the mixture was vigorously shaken and centrifuged at 12000 rpm for 10 min at 4℃. The supernatant was collected, and an equal volume of isopropanol was added. The mixture was incubated at -20℃ for 30 min and centrifuged at 12000 rpm for 10 min. The supernatant was discarded, and the DNA precipitate was washed with 75% ethanol, dried, and dissolved in ultrapure water. DNA purity and concentration were determined using a spectrophotometer, and DNA integrity was verified by 1% agarose gel electrophoresis, yielding the DNA from the parent wheat.

[0033] (3) Exon capture sequencing DNA from both parents, AvS and PI 660072, was sent to a sequencing company for exon capture sequencing. Sequencing data underwent FAST quality control and alignment to the Chinese Spring reference genome (IWGSC RefSeq v2.1) using BWA software. SNP and InDel variant detection were performed using GATK software, and functional annotation was completed using ANNOVAR software. High-quality sequence data were obtained after filtering. The Q30 values ​​for both PI 660072 and AvS were greater than 88.8%, with alignment rates of 99.98% and 99.96%, respectively. The average sequencing depth of the exon regions reached 67.91× and 61.3×, respectively, indicating that the sequencing data quality met the requirements for subsequent analysis.

[0034] Using GATK software, SNP and InDel variant sites were identified, and a total of 1202 SNP sites that differed between parents were obtained within the target interval (362.1–429.3 Mb).

[0035] The 1202 candidate sites were screened and evaluated to obtain candidate sites that can be used for marker development: 1) Using a sequencing depth ≥10× as a threshold, low-depth coverage sites are excluded, and sites with a high probability of sequencing error are removed (about 15% of sites are screened out). 2) The filtering criteria were based on the frequency of mutant alleles between 0.36 and 0.64 and the frequency of wild-type alleles between 0.36 and 0.64, to ensure that the loci were true polymorphic loci and to exclude false positive loci caused by sequencing or alignment errors (removing about 40% of the loci). 3) Screen for loci where both parents are homozygous and have significant genotypic differences to ensure that the markers have stable genotyping ability in the breeding population (screening out about 30% of loci). 4) After the above screening, approximately 15% of the sites (about 180 sites) remain, and then undergo manual verification: this includes checking the uniqueness of the site on the reference genome, whether the flanking sequences are suitable for primer design, and whether there is any homologous sequence interference. After the above multiple rounds of screening and manual evaluation, 10 SNP sites that uniformly cover the target region are finally selected to enter the KASP primer design verification stage.

[0036] (4) KASP marker primer design Ten manually selected SNP sites were chosen within the target region. SNP sequence information was obtained using the WheatOmics database, and primers were designed using Primer3 software. The 5' ends of the forward primers carried the FAM fluorescent tag sequence (SEQ ID NO: 1: GAAGGTGACCAAGTTCATGCT) and the HEX fluorescent tag sequence (SEQ ID NO: 2: GAAGGTCGGAGTCAACGGATT), respectively.

[0037] Experimental verification and effect comparison: PCR amplification system (10 μL): 10×Buffer 1 μL, MgCl2 (25 mM) 0.5 μL, dNTP (2.5 mM) 0.5 μL, F1 primer (10 μM) 0.1 μL, F2 primer (10 μM) 0.1 μL, universal reverse primer R (10 μM) 0.2 μL, Taq polymerase (5 U / μL) 0.2 μL, template DNA 50 ng, ddH2O to 10 μL.

[0038] PCR reaction program: 94℃ for 3 min; 94℃ for 15 s, 55–58℃ for 30 s, 72℃ for 40 s, 30 cycles; 72℃ for 5 min. Fluorescence signals were detected using an ELISA reader, and genotyping was performed using Kluster Caller software.

[0039] Of the 10 candidate KASP markers, 7 markers (Table 1) were successfully genotyped in the parental AvS and PI660072 and RIL populations after PCR experiments. The physical locations in Table 1 are based on the Chinese Spring reference genome (IWGSC RefSeqv2.1). The designed KASP primers include one forward primer F1, one forward primer F2, and one universal primer R.

[0040] Table 1 KASP primer sequences 368,615,501 F1 (SEQ ID NO: 3): GAAGGTGACCAAGTTCATGCTAATAGGAGATGAAGAGCAGTTCCCC 382,411,083 F2 (SEQ ID NO: 4): GAAGGTCGGAGTCAACGGATTAATAGGAGATGAAGAGCAGTTCCCT 421,580,618 R (SEQ ID NO: 5):GTCATATTTGCAAACATCAACTGGT F1 (SEQ ID NO: 6): GAAGGTGACCAAGTTCATGCTGCGAGGCCAAGGAGATGCC F2 (SEQ ID NO: 7): GAAGGTCGGAGTCAACGGATTGCGAGGCCAAGGAGATGCT R (SEQ ID NO: 8): GGATGCACACGTCGTGGAAC F1 (SEQ ID NO: 9): GAAGGTGACCAAGTTCATGCTAAGATTATCGGTGTCAAAGGTCCTT F2 (SEQ ID NO: 10): GAAGGTCGGAGTCAACGGATTAAGATTATCGGTGTCAAAGGTCCTC R (SEQ ID NO: 11):CCTGTCGATGGAAGAGCGG 426,302,911 F1 (SEQ ID NO: 12): GAAGGTGACCAAGTTCATGCTCTGCTTTCATGCGCCTCGG 391,355,850 F2 (SEQ ID NO: 13): GAAGGTCGGAGTCAACGGATTCTGCTTTCATGCGCCTCGT 408,488,572 R (SEQ ID NO: 14): GTGGCAACATCCGGCTGG 410,668,340 F1 (SEQ ID NO: 15): GAAGGTGACCAAGTTCATGCTAAGCGCAGAAGTTTGGGCA During PCR detection, the 5' end of primer F1 is ligated with a sequence carrying a FAM fluorescent tag (SEQ ID NO: 1: GAAGGTGACCAAGTTCATGCT), and the 5' end of primer F2 is ligated with a sequence carrying a HEX fluorescent tag (SEQ ID NO: 2: GAAGGTCGGAGTCAACGGATT).

[0041] F2 (SEQ ID NO: 16): GAAGGTCGGAGTCAACGGATTAAGCGCAGAAGTTTGGGC for TR (SEQ ID NO: 17): CAGAAGGTTCACCCTCCACG . F1 (SEQ ID NO: 18): GAAGGTGACCAAGTTCATGCTGGCAGAACCTGAACTCGGTGTT - F2 (SEQ ID NO: 19): GAAGGTCGGAGTCAACGGATTGGCAGAACCTGAACTCGGTGTA Genetic and physical maps were analyzed, and genetic linkage analysis showed that there were significant differences in the genetic distance between each marker and the target gene in Table 1. The marker with the best performance was KASP-580618, which was only 1.42 cM away from the target gene and located on the right boundary of the target QTL. It was the KASP marker with the tightest linkage to the target gene among the seven successful genotyping markers and was therefore identified as the core KASP marker. The other six successful genotyping markers (KASP-615501, KASP-411083, KASP-302911, KASP-355850, KASP-488572, and KASP-668340) were selected as alternative markers and can be used as auxiliary selection tools in specific genetic backgrounds or breeding scenarios.

[0042] R (SEQ ID NO: 20): GATGCGCCTCCTCACCAGT , F1 (SEQ ID NO: 21): GAAGGTGACCAAGTTCATGCTCTAGCTCGTTGGAGGAATTGTTTTC The genotyping results of the seven KASP markers in the AvS, PI 660072, and AvS / PI 660072 F6 populations are shown. Red dots indicate those carrying the HEX tag sequence (homozygous), consistent with the maternal genotype; blue dots indicate those carrying the FAM tag sequence (homozygous), consistent with the paternal genotype; green dots indicate heterozygous genotypes. This demonstrates that all seven KASP markers can effectively distinguish between parents.

[0043] Example 2 F2 (SEQ ID NO: 22): GAAGGTCGGAGTCAACGGATTCTAGCTCGTTGGAGGAATTGTTTTG Development and application of specific InDel molecular markers In this embodiment, the F2 generation of the transgenic population Mianmai 902 / / PI 660072 / / Chuanmai 104 was used as material. Genotyping was performed using three pairs of polymorphic InDel primers obtained through screening, and genetic linkage analysis was conducted in conjunction with the disease resistance phenotype data of its F3 generation.

[0044] (1) InDel site mining and primer design Based on exon capture sequencing data, polymorphic InDel sites of 3–50 bp in length were screened between parents, with preference given to variants located within the target QTL interval. Using the Chinese spring reference genome as a template, 200 bp flanking sequences were extracted upstream and downstream of the InDel site, and primers were designed using Primer3Plus software.

[0045] (2) InDel-labeled PCR amplification and electrophoresis detection PCR amplification system (10 μL): 10×Taq Buffer 1 μL, dNTP (2.5 mM) 0.8 μL, Taq polymerase (5 U / μL) 0.2 μL, forward primer (10 μM) 1 μL, reverse primer (10 μM) 1 μL, template DNA 2 μL (50 ng / μL), ddH2O to 10 μL; PCR reaction program: 94℃ for 5 min; 94℃ for 35 s, 55–60℃ for 35 s, 72℃ for 35 s, 29 cycles; 72℃ for 10 min. Amplification products were separated by electrophoresis on a 3% agarose gel at 120 V for 30–40 min, and the results were recorded using a gel imaging system.

[0046] (3) Filtering and effect comparison of InDel markers Three InDel tags were successfully developed. R (SEQ ID NO: 23): GCTCTGAAAGAAGTATGTCCCCAGTA The markers exhibit polymorphism among the parents Mianmai 902, PI 660072, and Chuanmai 104. The primer sequences for each marker are shown in Table 2. Each primer set includes one forward primer F and one reverse primer R.

[0047] Table 2 Primer sequences for InDel molecular markers 1 Figure 1 415,396,663 QYrPI660072 220 58.0 swust 2 4BL 391,252,720 Figure 2 174 58.5 2.61 3 Figure 3 377,098,927 QYrPI660072.swust-4BL 294 58.3 3.39 The product lengths and annealing temperatures listed in Table 2 are actual values ​​verified by agarose gel electrophoresis experiments. Specific experimental conditions were: 3% agarose gel, 120 V voltage, electrophoresis for 30-40 min, using a 100 bp DNA ladder as the molecular weight standard. All primer amplification products yielded clear and single target bands, accurately distinguishing parental genotypes.

[0048] Table 3 Linkage analysis of InDel molecular markers and target disease resistance genes 122 4 3.28 3.39 118 3 2.54 2.61 100 1 1.00 1.00 InDel-098927, InDel-252720, InDel-396663 The genetic distance and molecular marker physical map of QYrPI660072.swust-4BL are shown. Genetic linkage analysis revealed recombination rates of 3.39%, 2.61%, and 1.00% between the three markers and the target resistance locus, corresponding to genetic distances of 3.39 cM, 2.61 cM, and 1.00 cM, respectively. Notably, InDel-396663 has a genetic distance of only 1.00 cM from the target gene. InDel-396663 580618Located at the same genetic locus, it is the InDel marker most closely linked to QYrPI660072.swust-4BL and is therefore identified as the core InDel marker. The other two markers (InDel-098927 and InDel-252720) are considered as alternative markers.

[0049] Example 3: Application of core molecular markers in disease-resistant material screening and assisted selection breeding (1) Construction of breeding groups Using PI 660072 as the disease-resistant parent, it was crossed with the main cultivated varieties Mianmai 902, Chuanmai 104, and Yangmai 33 to obtain F2-F3 populations of 6 hybrid combinations. This example focuses on 137 individual plants from the F2 generation of the Mianmai 902 / PI 660072 / / Chuanmai 104 combination.

[0050] (2) Using core markers for molecular marker-assisted selection Genotyping of F2 generation plants was performed using the core InDel marker InDel-396663 to screen for positive plants carrying the target gene. Simultaneously, alternative markers InDel-098927 and InDel-252720 were used for auxiliary verification to improve the reliability of the selection. Combined with field agronomic trait surveys, a comprehensive screening was conducted based on the following criteria: plant height ≤90 cm, spike length ≥12.5 cm, number of tillers ≥3, number of spikelets ≥14, number of grains per spike ≥42, and infection type IT ≤3.

[0051] (3) Field disease resistance identification Field identification of disease resistance at the mature plant stage was conducted in Mianyang, Sichuan Province. A susceptible control variety, AvS, was set up. The infection type (IT) was recorded according to the 0-9 standard published in the "Technical Specification for Identification of Wheat Rust" (NY / T 1443-2007), where 0-3 was highly resistant, 4-6 was moderately resistant, and 7-9 was susceptible. The severity (DS) was graded according to the internationally accepted visual estimation method, which recorded the percentage of diseased area to total leaf area (Chen XM, Line RF. Phytopathology 1992;82:896-902).

[0052] (4) Screening results Twenty-one plants with excellent agronomic traits were selected from the F2 population. Six additional plants with outstanding disease resistance and excellent overall agronomic traits were further selected from the F3 generation, as shown in Table 4.

[0053] Table 4. Disease resistance and agronomic traits of superior single plants of Mianmai 902 / PI 660072 / / Chuanmai 104 F3 40-5 2 10 – 60 12.5 14 42 65-1 2 5 – 65 13.0 17 51 107-1 3 10 + 72.5 13.0 18 60 104-2 3 10 – 70 13.0 16 50 116-2 3 10 + 69.5 12.5 15 47 120-3 3 10 + 78 13.0 14 48 Note: "+" indicates that the target band was amplified, carrying QYrPI660072.swust-4BL; "-" indicates that the target band was not amplified. The core marker detection results for individual plants 40-5, 65-1, and 104-2 were negative, but they still showed disease resistance in the field (IT=2-3, DS=5-10%), suggesting that the recipient parent, Mianmai 902, in this combination may also carry other stripe rust resistance genes. Therefore, among the six screened materials, 107-1, 116-2, and 120-3 are materials that clearly carry the target gene, while 40-5, 65-1, and 104-2 may exhibit resistance due to other disease resistance genes in Mianmai 902 itself. This result also suggests that when using molecular marker-assisted selection, a comprehensive judgment should be made in conjunction with field phenotypic verification.

[0054] F (SEQ ID NO: 24): CATGTTTCCTCCTTGTTTGAC The agarose gel electrophoresis results of the F3 disease-resistant single plants selected by the three InDel markers designed for Example 2 are shown in the figure. P1, P2, and P3 are the parental plants Mianmai 902, PI 660072, and Chuanmai 104, respectively; 1–6 are the F3 superior single plants 40-5, 65-1, 107-1, 104-2, 116-2, and 120-3, with arrows indicating the target band position (220bp); a, b, and c are the agarose gel electrophoresis results of the markers InDel-098927, InDel-252720, and InDel-396663, respectively.

[0055] R (SEQ ID NO: 25): CGGCAGCAGAGATCATCTG 1.00 (core) InDel-252720 F (SEQ ID NO: 26): TGGCGCAAGAACAGGGAATC R (SEQ ID NO: 27): CCTGGGATTGAGAGACGAG InDel-098927 F (SEQ ID NO: 28): CTCTGTTCATGACCGTACTC R (SEQ ID NO: 29): CCAGAATTTCGTAATGGACG Figure 4 KASP- Figure 5 Figure 6 The results of the detection of the effects of the introduction of the disease resistance gene on important agronomic traits show that the introduction of the target gene has no significant negative impact on plant height, ear length, spikelet number, grain number per ear, and effective tiller number. The above statistical analysis shows that the introduction of the target gene has no significant negative impact on major agronomic traits such as plant height, ear length, spikelet number, grain number per ear, and tiller number (p>0.05), proving that QYrPI660072.swust-4BL can be used for molecular breeding of wheat resistance to stripe rust.

[0056] The above embodiments demonstrate the effectiveness of the molecular markers developed in this application by: 1) using three InDel markers to detect the genotypes of 137 individual plants from the F2-F3 generations of the Mianmai 902 / PI 660072 / / Chuanmai 104 hybrid combination, combined with field identification of stripe rust resistance phenotypes at the mature plant stage (infection type IT was recorded according to the 0-9 standard, and severity DS was recorded as a percentage); 2) using seven KASP markers to detect the genotypes of 211 families in the AvS / PI 660072 recombinant inbred line population, and performing genetic linkage analysis using QTL IciMapping software; and 3) examining the agronomic traits (plant height, spike length, number of spikelets, number of grains per spike, number of tillers) of the selected superior lines, comparing the phenotypic differences between lines carrying the target gene and those not carrying it using t-tests, confirming that the introduction of the target gene had no significant negative impact.

Claims

1. Molecular marker primers for detecting the wheat stripe rust resistance gene QYrPI660072.swust-4BL, characterized in that, The primers include any one of the following sets 1)-10); wherein, primer sets 1)-7) consist of forward primer F1, forward primer F2, and universal primer R; primer sets 8)-10) consist of forward primer F and reverse primer R. 1) Primer set KASP-615501, including primers KASP-615501-F1, KASP-615501-F2, and KASP-615501-R with nucleotide sequences as shown in SEQ ID NO: 3-SEQ ID NO: 5; 2) Primer set KASP-411083, including forward primers KASP-411083-F1, forward primer KASP-411083-F2, and universal primer KASP-411083-R, with nucleotide sequences as shown in SEQ ID NO: 6-SEQ ID NO: 8 in sequence; 3) Primer set KASP-580618, including forward primers KASP-580618-F1, forward primer KASP-580618-F2, and universal primer KASP-580618-R, with nucleotide sequences as shown in SEQ ID NO: 9-SEQ ID NO: 11 in sequence; 4) Primer set KASP-302911, including forward primers KASP-302911-F1, forward primer KASP-302911-F2, and universal primer KASP-302911-R, whose nucleotide sequences are shown in SEQ ID NO: 12-SEQ ID NO: 14 in sequence; 5) Primer set KASP-355850, including forward primers KASP-355850-F1, forward primer KASP-355850-F2, and universal primer KASP-355850-R, with nucleotide sequences as shown in SEQ ID NO: 15-SEQ ID NO: 17 in sequence; 6) Primer set KASP-488572, including forward primers KASP-488572-F1, forward primer KASP-488572-F2, and universal primer KASP-488572-R, whose nucleotide sequences are shown in SEQ ID NO: 18-SEQ ID NO: 20 in sequence; 7) Primer set KASP-668340, including the forward primer KASP-668340-F1, the reverse primer KASP-668340-F2, and the universal primer KASP-668340-R, with nucleotide sequences as shown in SEQ ID NO: 21-SEQ ID NO: 23 in sequence; 8) Primer set InDel-396663, including primers InDel-396663-F and InDel-396663-R with nucleotide sequences as shown in SEQ ID NO: 24 and SEQ ID NO: 25, respectively; 9) Primer set InDel-252720, including primers InDel-252720-F and InDel-252720-R with nucleotide sequences as shown in SEQ ID NO: 26 and SEQ ID NO: 27, respectively; 10) Primer set InDel-098927, including primers InDel-098927-F and InDel-098927-R with nucleotide sequences as shown in SEQ ID NO: 28 and SEQ ID NO: 29 respectively.

2. The primer as described in claim 1, characterized in that, The 5' end of the forward primer F1 is tagged with a FAM fluorescent tag; the 5' end of the forward primer F2 is tagged with a HEX fluorescent tag.

3. The application of the primers as described in claim 1 in detecting the wheat stripe rust resistance gene QYrPI660072.swust-4BL.

4. The application as described in claim 3, characterized in that, The specific steps are as follows: For any primer set 1)-7), using the wheat DNA to be tested and wheat DNA of PI660072 as templates, add a FAM fluorescent tag to the 5' end of the forward primer F1 and a HEX fluorescent tag to the 5' end of the forward primer F2, and use them together with the universal primer R as primers for PCR detection to perform PCR amplification; if the fluorescence signal detected by the amplification product of the wheat to be tested is consistent with that of wheat PI660072, it is determined that the wheat to be tested contains the QYrPI660072.swust-4BL gene; For any primer set from 8) to 10), use the wheat genomic DNA to be tested as a template, and use forward primer F and reverse primer R as primers for PCR amplification. Perform electrophoresis on the amplification products. If the electrophoresis products are 220 bp in size, it is determined that the wheat to be tested contains the QYrPI660072.swust-4BL gene.

5. A PCR detection kit, characterized in that, The kit contains any one of the primer sets as described in claim 1 or 2.

Images