Application of detection reagent of InDel molecular marker for tracing origin of a trapa sinensis population

Abstract

The application belongs to the technical field of species identification and molecular marker, and particularly relates to application of an InDel molecular marker detection reagent for population tracing of Trapa acutangula. Five specific Indel molecular markers FJ, JS, JX, MS and TJ for population tracing of Trapa acutangula are disclosed for the first time, and the nucleotide sequences of the five specific Indel molecular markers are shown in SEQ ID NO. 1 to SEQ ID NO. 5. The above molecular markers can realize accurate population tracing and identification of Trapa acutangula populations from Fujian, Jiangsu, Jiangxi, Heilongjiang Mishan and Heilongjiang Tongjiang. The application further constructs primer reagents for amplifying the above Indel molecular markers, and establishes a high-efficiency population tracing method for Trapa acutangula in the five regions. The method has the advantages of high accuracy, good stability and simple operation, and can provide reliable technical support for species identification and core germplasm resource preservation in the ex-situ conservation of Trapa acutangula.

Description

Technical Field

[0001] This invention belongs to the field of species identification and molecular marker technology, specifically relating to the application of an InDel molecular marker detection reagent for tracing the population origin of *Trapa natans*. Background Technology

[0002] Water chestnut (Aqua caltrop) Trapa incisa It belongs to the Lythraceae family and the Trapa genus. Trapa This species is distributed in Heilongjiang, Jiangsu, Zhejiang, Anhui, Jiangxi, Hunan, and Fujian provinces of my country. It mainly grows in still or slow-flowing aquatic environments such as lakes, ponds, or wetlands, and is highly sensitive to changes in aquatic ecological conditions, forming an important component of freshwater wetland ecosystems. This species is a Class II protected wild plant in China and has high ecological and research value.

[0003] In recent years, with the development of wetlands, water pollution, shrinking water areas, and intensified human interference, the natural habitat of *Trapa natans* has continued to degrade, and the wild population in some areas has declined significantly, putting considerable pressure on the conservation of its genetic resources. Due to long-term geographical isolation and differences in ecological environment, populations from different geographical origins have developed a certain degree of genetic differentiation under the combined effects of local adaptation and genetic drift. However, there is currently a lack of research on the systematic identification of the geographical origin of *Trapa natans* germplasm resources based on genetic variation, making it difficult to support the scientific conservation and precise management of germplasm resources. Therefore, conducting geographical origin identification of *Trapa natans* germplasm resources has significant scientific and applied value.

[0004] Molecular marker technology possesses advantages such as high specificity, high stability, and insensitivity to environmental conditions. It can directly reflect the genetic differences of species at the DNA level, providing objective, reliable, and reproducible evidence for population identification and tracing. Utilizing molecular markers to achieve rapid and accurate identification of *Trapa natans* populations from different geographical origins can provide key technical support for genetic diversity assessment and germplasm resource conservation, effectively improving the scientific rigor and accuracy of related research.

[0005] Currently, the differentiation of the geographical origin of Trapa natans germplasm resources mainly relies on morphological traits and traditional taxonomic methods. These methods have the disadvantages of being highly subjective, having low resolution, and being difficult to meet the requirements of accurate traceability.

[0006] Therefore, developing convenient, efficient, and applicable InDel molecular markers and their detection reagents for tracing the population of *Trapa natans* is of great practical significance for deepening the research and protection of its genetic resources. Summary of the Invention

[0007] To address the aforementioned problems, this invention provides an application of an InDel molecular marker detection reagent for tracing the population origin of *Trapa natans*. This invention screened and obtained five specific InDel molecular markers, named FJ, JS, JX, MS, and TJ, and designed a primer set for detecting these markers. Based on this, this invention further establishes a method for tracing the population origin of *Trapa natans*, capable of accurately distinguishing *Trapa natans* populations in Fujian, Jiangsu, Jiangxi, Mishan in Heilongjiang, and Tongjiang in Heilongjiang, thus providing an efficient and reliable technical means for assessing the genetic diversity of *Trapa natans*, identifying the geographical origin of populations, and protecting germplasm resources.

[0008] To achieve the above objectives, the specific technical solution of the present invention is as follows: The first aspect of this invention provides an application of an InDel molecular marker detection reagent for tracing the population origin of *Trapa natans*, wherein the molecular markers are FJ, JS, JX, MS and TJ, and their nucleotide sequences are shown in SEQ ID NO.1 to SEQ ID NO.5, respectively.

[0009] The *Trapa natans* populations include those from Fujian, Jiangsu, Jiangxi, Mishan (Heilongjiang), and Tongjiang (Heilongjiang). The Fujian population has a deletion at positions 201-248 of the sequence shown in SEQ ID NO.1; the Jiangsu population has a deletion at positions 201-253 of the sequence shown in SEQ ID NO.2; the Jiangxi population has a deletion at positions 201-240 of the sequence shown in SEQ ID NO.3; the Mishan (Heilongjiang) population has a deletion at positions 201-250 of the sequence shown in SEQ ID NO.4; and the Tongjiang (Heilongjiang) population has a deletion at positions 201-252 of the sequence shown in SEQ ID NO.5. The application is to use the molecular marker detection reagent to identify and trace the population origin of *Trapa natans*.

[0010] Furthermore, the detection reagent is a primer set for amplifying the FJ, JS, JX, MS, or TJ.

[0011] The primer set for amplifying FJ consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.6 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.7.

[0012] The primer set for amplifying JS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.8 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.9.

[0013] The primer set for amplifying JX consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.10 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.11.

[0014] The primer set for amplifying MS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.12 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.13.

[0015] The primer set for amplifying TJ consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.14 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.15.

[0016] The population tracing and identification of *Trapa natans* includes the following steps: DNA was extracted from the sample of *Trapa natans* to be tested.

[0017] Using the DNA of the tested *Trapa natans* sample as a template, PCR amplification was performed using the primers for amplifying FJ, JS, JX, MS, and TJ to obtain PCR products.

[0018] The PCR products were analyzed by agarose gel electrophoresis. The population to which the sample belonged was determined according to the following rules: Using primers to amplify FJ: If a 207 bp band is displayed on the agarose gel, the sample to be tested is from the Fujian population.

[0019] Using primers to amplify JS: If a 230 bp band is displayed on the agarose gel, the sample to be tested is from the Jiangsu population.

[0020] Using the primer set for amplifying JX: If a 269 bp band is displayed on the agarose gel, the sample to be tested is from the Jiangxi population.

[0021] Primer set for MS amplification: If a 300 bp band is displayed on the agarose gel, the sample to be tested is from the Mishan population in Heilongjiang.

[0022] Using primers to amplify TJ: If a 153 bp band is displayed on the agarose gel, the sample to be tested is from the Tongjiang population in Heilongjiang.

[0023] Furthermore, each 20 μL PCR amplification reaction system includes: 1 μL DNA template, 0.5 μL each of upstream and downstream primers, 10 μL 2× Rapid Taq Plus Master Mix, and Nuclease-free Water to make up the difference.

[0024] Further, the PCR amplification reaction procedure is as follows: (1) pre-denaturation, 95℃, 6min; (2) denaturation at 95℃ for 15s, annealing at 55℃ for 15s, extension at 72℃ for 7s; 35 cycles; (3) extension at 72℃ for 5min.

[0025] Furthermore, the agarose gel has a mass-volume concentration of 1%.

[0026] A third aspect of the present invention provides a kit comprising the primer set for amplifying FJ, JS, JX, MS and TJ.

[0027] Furthermore, the kit also includes a high-fidelity DNA polymerase premix and nuclease-free water.

[0028] Compared with the prior art, the beneficial effects of the present invention are as follows: Based on high-quality reference genome data of *Trapa natans* and resequencing data from *Trapa natans* of different geographical origins, this invention provides an InDel molecular marker detection reagent for tracing the origin of *Trapa natans* populations and its application. Five InDel molecular markers, FJ, JS, JX, MS, and TJ, for identifying *Trapa natans* populations are disclosed for the first time. The nucleotide sequences of molecular markers FJ, JS, JX, MS, and TJ are shown in SEQ ID NO. 1–5, respectively. These molecular markers can be used to distinguish and trace the origin of *Trapa natans* populations in Fujian, Jiangsu, Jiangxi, Mishan (Heilongjiang), and Tongjiang (Heilongjiang). This invention further constructs a detection reagent for detecting the above molecular markers and establishes a method for tracing the origin of *Trapa natans* populations. This method can accurately, effectively, and conveniently identify *Trapa natans* populations in Fujian, Jiangsu, Jiangxi, Mishan (Heilongjiang), and Tongjiang (Heilongjiang), providing an efficient and reliable technical means for assessing the genetic diversity, identifying the geographical origin of populations, and protecting germplasm resources of *Trapa natans*.

[0029] (1) Simplicity and practicality of operation: The method for tracing the population of *Trapa natans* constructed in this invention is simple to operate and highly practical. By using a primer combination to amplify the InDel molecular marker for PCR amplification, the amplification products are subjected to agarose gel electrophoresis, and the population affiliation of *Trapa natans* can be accurately determined based on the size or specificity of the bands. The overall process of this method is clear, easy to master and implement, does not rely on complex instruments and equipment, and does not require cumbersome operating steps. It is suitable for promotion and application in practical work and can provide a simple, efficient and reliable technical means for the conservation and related research of *Trapa natans* resources.

[0030] (2) Positive significance for species conservation: The molecular marker detection reagents and population tracing methods provided by this invention can accurately distinguish the *Trapa natans* populations in Fujian, Jiangsu, Jiangxi, Mishan in Heilongjiang, and Tongjiang in Heilongjiang, providing reliable technical support for their genetic background analysis, population difference research, and genetic diversity assessment, and providing an effective tool for germplasm resource identification and resource management. Based on population genetic information, it can effectively guide the site selection for ex-situ conservation, avoid the blind mixing of populations with different genetic backgrounds, improve the scientificity and accuracy of ex-situ conservation strategies, and is of great significance for promoting the protection and rational utilization of *Trapa natans* germplasm resources. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0032] Figure 1 Agarose gel electrophoresis image of PCR amplification using FJ, JS, JX, MS, and TJ primer sets; Figure 1 In the diagram, A represents an agarose gel electrophoresis image of PCR performed using the FJ primer set; lane M represents the DNA marker; lanes 1, 2, 3, 4, and 5 represent samples from the Fujian region of *Trapa natans*; lanes 6, 7, and 8 represent samples from the Jiangsu region; lanes 9, 10, and 11 represent samples from the Jiangxi region; lanes 12, 13, and 14 represent samples from the Mishan region of Heilongjiang; and lanes 15, 16, and 17 represent samples from the Tongjiang region of Heilongjiang. This image is merely an example of electrophoresis pattern display, used to visually show the banding characteristics of different *Trapa natans* lineages at this marker site. For details on the actual sample size and statistical results used for validity verification, please refer to the specific implementation section of the instruction manual.

[0033] B is an agarose gel electrophoresis image of PCR performed using the JS primer set; lane M is the DNA marker. Lanes 1, 2, and 3 represent samples from the Fujian region of *Trapa natans*; lanes 4, 5, 6, 7, and 8 represent samples from the Jiangsu region; lanes 9, 10, and 11 represent samples from the Jiangxi region; lanes 12, 13, and 14 represent samples from the Mishan region of Heilongjiang; and lanes 15, 16, and 17 represent samples from the Tongjiang region of Heilongjiang. This image is only an example of the electrophoresis pattern, used to visually display the banding characteristics of different *Trapa natans* lineages at this marker site. For the actual sample size and statistical results used for validity verification, please refer to the detailed implementation section of the instruction manual.

[0034] C is an agarose gel electrophoresis image of PCR performed using the JX primer set; lane M is the DNA marker. Lanes 1, 2, and 3 represent samples from the Fujian region of *Trapa natans*; lanes 4, 5, and 6 represent samples from the Jiangsu region; lanes 7, 8, 9, 10, and 11 represent samples from the Jiangxi region; lanes 12, 13, and 14 represent samples from the Mishan region of Heilongjiang; and lanes 15, 16, and 17 represent samples from the Tongjiang region of Heilongjiang. This image is only an example of the electrophoresis pattern, used to visually display the banding characteristics of different *Trapa natans* lineages at this marker site. For the actual sample size and statistical results used for validity verification, please refer to the detailed implementation section of the instruction manual.

[0035] D is an agarose gel electrophoresis image of PCR performed using MS primers; lane M represents the DNA marker. Lanes 1, 2, and 3 represent samples from the Fujian region of *Trapa natans*; lanes 4, 5, and 6 represent samples from the Jiangsu region; lanes 7, 8, and 9 represent samples from the Jiangxi region; lanes 10, 11, 12, 13, and 14 represent samples from the Mishan region of Heilongjiang; and lanes 15, 16, and 17 represent samples from the Tongjiang region of Heilongjiang. This image is only an example of the electrophoresis pattern, used to visually display the banding characteristics of different *Trapa natans* lineages at this marker site. For the actual sample size and statistical results used for validity verification, please refer to the detailed implementation section of the instruction manual.

[0036] E is an agarose gel electrophoresis image of PCR performed using the TJ primer set; lane M represents the DNA marker. Lanes 1, 2, and 3 represent samples from the Fujian region of *Trapa natans*; lanes 4, 5, and 6 represent samples from the Jiangsu region; lanes 7, 8, and 9 represent samples from the Jiangxi region; lanes 10, 11, and 12 represent samples from the Mishan region of Heilongjiang; and lanes 13, 14, 15, 16, and 17 represent samples from the Tongjiang region of Heilongjiang. This image is only an example of the electrophoresis pattern, used to visually display the banding characteristics of different *Trapa natans* lineages at this marker site. For the actual sample size and statistical results used for validity verification, please refer to the detailed implementation section of the instruction manual. Detailed Implementation

[0037] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0038] Example 1: Development of InDel molecular markers for population tracing of *Trapa natans* The nucleotide sequences of molecular markers FJ, JS, JX, MS and TJ are shown in SEQ ID NO.1 to SEQ ID NO.5, respectively.

[0039] SEQ ID NO.1: GAGGGAAAATGTAAGTTAATTCGGCTCCCTTCATCAGAGTAGTTCAGTTCTAGAGAGAGAAAGTGTCGAATATCTCTAACCAAATTCCCACTAATCTTGACATGAATTGTAGCAATTCTTGATCCTAGAAGGACCCTGAGAACGATAGCTACCTTCCCAGATTAAGAGCTCAGACTATTGCACCTCAGATGGTAAGTTT TCGAAGCTCTCTATCTCTCT CTACATTCAGTTTTCTGGTGAAGCTCCG The Fujian population exhibits a unique deletion in the underlined nucleotide sequence (positions 201-248) of the sequence shown in SEQ ID NO.1.

[0040] SEQ ID NO.2: CTTTGATTCATGATAAAAATTAGTACGCAACAAGTGTGTTCAAAACTTAATCATGAAGAGCTTAGTACTAAATCTGGCCAACTTCATATCATAAAATTAATCCCGGGCACACAAACCCTATTCACATAGTTCTAGCCCAATGGCCCCGAGCTGGGATTTCACAGCATAAACTCGACCTAATCACTATCACACTAAAGCAA TGCACATATATTAAGAGTCT GACTTTCAGCTGCCCTCTCCTCAATTCACGCAC The Jiangsu population exhibits a unique deletion in the underlined nucleotide sequence (positions 201-253) of the sequence shown in SEQ ID NO.2.

[0041] SEQ ID NO.3: AAACAATTCTGAATGATATCATGCTAAAGTACCATACTGTGTTGGGGACACGTAAATCCGAATGGCTAAAAGGGTATGACTCATGGAAGGAAAAGATATTTATCAAAACATGATAATATCAAATGGAAGTCCTGGGTAGACCTAAATTATAAGAATGAAAAGATGCCTTTAAGCTAGGAAGTTATAAATGGGAAAAATTG TAAATTTCGGGTCCCCAAAT GAAGGCTTTTAGATGAAAAA The Jiangxi population exhibits a unique deletion in the underlined nucleotide sequence (positions 201-240) of the sequence shown in SEQ ID NO.3.

[0042] SEQ ID NO.4: ATTCATTATTCATTGGGTATAGGCTACCTCTTATGCTAACATTCCACACTCCTCCCATCACGGTGATGTCTGTTGTACGACTTTAACCCTTATTAATATACCGACCCTTAAGTCGATTATATGAATGATCCTTCATTATATTGGGGTTTGTACCATGCATGTCTTCCTTCCAAAGGCTTACCCAATGAACTTGACTTATT TTATATTTGTGTTTCCTGGT TTCATAACAATATCTGAGACTCGTTTCTAT The nucleotide sequence (positions 201-250) underlined in SEQ ID NO.4 of the Mishan population in Heilongjiang Province has a unique deletion.

[0043] SEQ ID NO.5: ATTTAATTTAGTTGTTTTAAATTTTTTTTATAAACTACTATTTAAATTTCCTATATAATTTTTTATTTTTGGATGAGTAAGAATAACGTTACAATTTGCGTATTTTTTATTTAATTCTAAACAAACAAATGATCTAAAAAATAAAGTCAAGTAAAAAATAATGTCCACAAACAAGACGGATGGATAGTCATGTAGAGAT ATTTGGCATAATGAATGAGA ATAGATAATTAGTGAAAGAACAAGCTCTTTGG The nucleotide sequence (positions 201-252) underlined in SEQ ID NO. 5 of the Tongjiang population in Heilongjiang Province has a unique deletion.

[0044] Example 2: Primer design for InDel molecular markers for population tracing of *Trapa natans* This invention further designs a primer set for amplifying InDel molecular markers to distinguish different geographical populations of *Trapa natans*, the primer set consisting of one forward primer and one reverse primer: The primer set for amplifying FJ consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.6 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.7; SEQ ID NO.6: 5'-CCTAGAAGGACCCTGAGAACGA-3'; SEQ ID NO.7: 5'-TCATGGTGCTGATCGACTTCCT-3'.

[0045] The primer set for amplifying JS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.8 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.9; SEQ ID NO.8: 5'-CGGGCACACAAACCCTATTCAC-3'; SEQ ID NO.9: 5'-AACCAGTCTGAGAACCGAGAGG-3'.

[0046] The primer set for amplifying JX consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.10 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.11; SEQ ID NO. 10: 5'-AATGGAAGTCCTGGGTAGACCT-3'; SEQ ID NO. 11: 5'-TGGTGTGGTCCTTAACAACTGT-3'.

[0047] The primer set for amplifying MS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.12 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.13; SEQ ID NO. 12: 5'-ACGGTGATGTCTGTTGTACGAC-3'; SEQ ID NO. 13: 5'-TCAAGTCAATGCTCGCTTCACA-3'.

[0048] The primer set for amplifying TJ consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.14 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.15; SEQ ID NO. 14: 5'-TGTCCACAAACAAGACGGATGG-3'; SEQ ID NO. 15: 5'-CCCTCCTCAGCCAAAGAATTGG-3'.

[0049] Example 3: Validation and Application of Molecular Markers Genomic DNA was extracted from the leaves of *Trapa natans* samples. The extracted DNA was amplified by PCR using the primer set described in Example 2 to obtain PCR products. The size of the PCR products was determined by 1 w / v% agarose gel electrophoresis, and the population to which the *Trapa natans* samples belonged was determined based on the size of the PCR products. The specific steps are as follows:

[0050] (1) Selection of test samples: Tender, insect-free leaves of *Trapa natans* germplasm resources from different geographical origins were collected, including 10 samples from the Fujian population, 19 samples from the Jiangsu population, 13 samples from the Jiangxi population, 19 samples from the Mishan population in Heilongjiang, and 24 samples from the Tongjiang population in Heilongjiang. The samples cover different latitude regions and take into account different aquatic ecological environments and geographical gradients. The test samples are broadly representative in terms of genetic background, geographical origin and ecological environment, which can ensure the stable applicability of molecular markers in different populations and improve the reliability and universality of marker screening.

[0051] (2) Genomic DNA extraction: Total DNA was extracted from the sample to be tested using a plant DNA extraction kit.

[0052] (3) PCR amplification: The extracted DNA was amplified by PCR using the primer sets for amplifying FJ, JS, JX, MS and TJ in Example 2, respectively, to obtain PCR amplification products.

[0053] Each 20 μL PCR amplification reaction system includes: 1 μL DNA template, 0.5 μL each of forward and reverse primers, 10 μL 2×Rapid Taq Plus Master Mix, and nuclease-free water to make up the difference.

[0054] The PCR reaction conditions were as follows: 95℃ pre-denaturation for 6 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 7 s; 35 cycles; 72℃ extension for 5 min; the system temperature was lowered to 4℃ to end PCR amplification.

[0055] (4) Detection of amplification products: The amplification products were detected by 1w / v% agarose gel electrophoresis. The population to which the sample belongs was determined according to the following judgment rules.

[0056] The criteria for judgment are: Using primers to amplify FJ: If a 207 bp band is displayed on the agarose gel, the sample to be tested is from the Fujian population; Using primers to amplify JS: If a 230 bp band is displayed on the agarose gel, the sample to be tested is from the Jiangsu population; Using the primer set for amplifying JX: If a 269 bp band is displayed on the agarose gel, the sample to be tested is from the Jiangxi population; Primer set for MS amplification: If a 300 bp band is displayed on the agarose gel, the sample to be tested is from the Mishan population in Heilongjiang. Using primers to amplify TJ: If a 153 bp band is displayed on the agarose gel, the sample to be tested is from the Tongjiang population in Heilongjiang.

[0057] (5) The test results are shown in Table 1. Figure 1 As shown.

[0058] Table 1 Test Results From Table 1 and Figure 1 It can be seen that samples from different geographical origins of *Trapa natans* exhibited stable and distinguishable specific band types after amplification with the corresponding molecular markers, and the identification accuracy of the developed molecular marker primer sets reached 100%, proving that the molecular markers provided by this invention have high effectiveness and reliability. The aforementioned molecular markers exhibited stable population specificity in the tested samples and can be used for rapid identification and source tracing analysis of *Trapa natans* populations from different geographical origins.

[0059] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described here to avoid redundancy. Although preferred embodiments of the invention have been described, those skilled in the art, once they understand the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0060] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of an InDel molecular marker detection reagent for tracing the population origin of *Trapa natans*, characterized in that... The InDel molecular markers are molecular markers FJ, JS, JX, MS, and TJ; the nucleotide sequences of molecular markers FJ, JS, JX, MS, and TJ are shown in SEQ ID NO.1 to SEQ ID NO.5, respectively. The *Trapa natans* populations include those from Fujian, Jiangsu, Jiangxi, Mishan in Heilongjiang, and Tongjiang in Heilongjiang. The Fujian population has a deletion at positions 201-248 of the sequence shown in SEQ ID NO.1; the Jiangsu population has a deletion at positions 201-253 of the sequence shown in SEQ ID NO.2; the Jiangxi population has a deletion at positions 201-240 of the sequence shown in SEQ ID NO.3; the Mishan population in Heilongjiang has a deletion at positions 201-250 of the sequence shown in SEQ ID NO.4; and the Tongjiang population in Heilongjiang has a deletion at positions 201-252 of the sequence shown in SEQ ID NO.

5. The application involves using the detection reagents of the molecular markers to identify and trace the population origin of *Trapa natans*.

2. The application according to claim 1, characterized in that, The detection reagent is a primer set for amplifying the FJ, JS, JX, MS or TJ; The primer set for amplifying FJ consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO. 6 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO. 7; The primer set for amplifying JS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.8 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.9; The primer set for amplifying JX consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.10 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.11; The primer set for amplifying MS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.12 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.13; The primer set for amplifying TJ consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.14 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

15.

3. The application according to claim 3, characterized in that, The population tracing and identification of *Trapa natans* includes the following steps: DNA was extracted from the sample of *Trapa natans* to be tested; Using the DNA of the sample of *Trapa natans* to be tested as a template, PCR amplification was performed using the primers for amplifying FJ, JS, JX, MS and TJ to obtain PCR products; The PCR products were analyzed by agarose gel electrophoresis. The population to which the sample belonged was determined according to the following rules: Using primers to amplify FJ: If a 207 bp band is displayed on the agarose gel, the sample to be tested is from the Fujian population; Using primers to amplify JS: If a 230 bp band is displayed on the agarose gel, the sample to be tested is from the Jiangsu population; Using the primer set for amplifying JX: If a 269 bp band is displayed on the agarose gel, the sample to be tested is from the Jiangxi population; Primer set for MS amplification: If a 300 bp band is displayed on the agarose gel, the sample to be tested is from the Mishan population in Heilongjiang. Using primers to amplify TJ: If a 153 bp band is displayed on the agarose gel, the sample to be tested is from the Tongjiang population in Heilongjiang.

4. The application according to claim 3, characterized in that, The PCR amplification reaction system was 20 μL, and its composition was as follows: 1 μL DNA template, 0.5 μL each of upstream and downstream primers, 10 μL 2× Rapid Taq Plus Master Mix, and Nuclease-free Water to make up the difference.

5. The application according to claim 3, characterized in that, The PCR amplification reaction procedure is as follows: (1) pre-denaturation, 95℃, 6min; (2) denaturation at 95℃ for 15s, annealing at 55℃ for 15s, extension at 72℃ for 7s; 35 cycles; (3) extension at 72℃ for 5min.

6. The application according to claim 3, characterized in that, The agarose gel has a mass-volume concentration of 1%.

7. A kit for population tracing of *Trapa natans*, characterized in that, The kit contains the primer set for amplifying FJ, JS, JX, MS and TJ as described in claim 1.

8. The reagent kit according to claim 7, characterized in that, The kit also includes a high-fidelity DNA polymerase premix and nuclease-free water.

Images