Wheat ear grain number related snp-c430g and applications thereof

Abstract

The application discloses a SNP-C430G related to a wheat ear grain number and an application thereof. The SNP site corresponds to the 430th base from the 5' end of a sequence shown in SEQ ID NO. 1. When the site is C / C homozygous, the corresponding genotype is A. When the site is G / G homozygous, the corresponding genotype is B. The size of the ear grain number is as follows: the wheat with the genotype A homozygous is greater than or candidate greater than the wheat with the genotype B homozygous. The SNP site of the application not only expands the wheat gene resource tool, but also has good and wide application potential verified by scientific research tests and data statistics.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to SNP-C430G related to the number of grains per ear of wheat and its applications. Background Technology

[0002] Wheat is a major food crop in arid and semi-arid regions worldwide. Ensuring safe and efficient wheat production in arid areas plays a crucial role in ensuring food security in my country and the world. Wheat yield is affected by thousand-grain weight, number of ears per unit area, and number of grains per ear. The number of grains per ear refers to the number of grains that can ultimately be produced on each ear, typically between 30 and 40. The number of grains per ear is one of the important factors in wheat yield, and it is influenced by a variety of factors. Discovering new genes related to increasing the number of grains per ear from wild wheat resources using plant genomics theories and methods has significant theoretical and practical application value.

[0003] Wang et al. bred BC5F3 using artificially synthesized double diploid wheat Am3 as the donor parent and common wheat variety Laizhou 953 as the recurrent parent, through 5 backcrosses and 2 selfcrosses. Using this introduced line, its secondary segregating population, and 96 diverse germplasm resources as materials, they conducted QTL detection for grain number per spike, spikelet number, and spike length using molecular markers. One-way ANOVA was used, with P ≤ 0.01 as the criterion for QTL presence. A total of 21, 11, and 17 QTLs related to grain number per spike, spike length, and spikelet number were detected, respectively. 37 QTLs were reproducible across multiple years and locations, with 7 QTLs controlling grain number per spike, spike length, and spikelet number located in the same region. Sakuma et al. constructed a recombinant self-crossing line (RISL) population using durum wheat carrying chromosome 2A of wild emmer wheat. Using this population, they located and cloned the GNI1 gene, which increases spikelet and grain number per spike, on chromosome 2A. Liu et al. used the high spikelet grain number wheat material H461 and the published reference genome material *Chinese Spring* as parents to construct a high-generation RIL population using the single-grain genetic method. Genotyping was performed using a wheat 55K SNP chip, resulting in a high-density genetic map containing 3087 bin markers (21,197 SNPs). The total genetic distance of this map was 3792.71 cM, and the marker order was highly consistent with the order on the *Chinese Spring* reference physical map.

[0004] In general, the number of grains per ear is one of the key factors affecting wheat yield. By optimizing the growing environment, managing the crop properly, and improving the genetics, the number of grains per ear can be effectively increased, thereby increasing wheat yield. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide SNP-C430G related to the number of grains per ear of wheat and its application, and at the same time to construct and expand the technical path for its theoretical research on the number of grains per ear of wheat and its potential applications in wheat molecular breeding and agricultural yield increase.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0007] A SNP site associated with the number of grains per ear of wheat, wherein the SNP site corresponds to the 430th base from the 5' end of the sequence shown in SEQ ID NO.1, and when the site is C / C homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B; the grain number per ear is: wheat homozygous for genotype A is greater than or candidate greater than wheat homozygous for genotype B.

[0008] This invention also includes the use of the aforementioned wheat SNP sites, which is for theoretical research on the principles of wheat spike grain number development based on the SNP sites, and / or for research on the molecular regulatory pathways of wheat spike grain number development based on the SNP sites; including: based on the SNP sites, identifying, characterizing and / or distinguishing downstream associated effector molecules through genotypic differences at the sites, and constructing a molecular regulatory pathway for wheat spike grain number; the effector molecules include, but are not limited to, messenger RNA, proteins, associated biological enzymes, various molecular regulatory components, and various molecular signaling components; further, based on the construction of the molecular regulatory pathway for wheat spike grain number, identifying and confirming major or key regulatory nodes and their corresponding biomacromolecules or small molecule components.

[0009] The present invention also includes another use of the above-mentioned SNP sites, which is to screen or assist in screening wheat spike grain number phenotype in the early stage of molecular marker-assisted selection breeding.

[0010] The present invention also includes another use of the aforementioned wheat SNP sites, which is to regulate the number of wheat grains per ear in the agricultural industry according to production needs based on the SNP sites, including: increasing the number of wheat grains per ear based on the methyl genotype and decreasing the number of wheat grains per ear based on the B genotype; potential application scenarios for increasing the number of wheat grains per ear are: ensuring food security reserves and producing more wheat for the development of the bioenergy industry; potential application scenarios for decreasing the number of wheat grains per ear are: increasing the nutrient content of wheat and using high-nutrient wheat for the production of infant food.

[0011] The present invention also includes a gene detection kit for detecting the SNP site described in claim 1, wherein the gene detection kit contains a PCR amplification specific primer combination corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

[0012] As a preferred embodiment of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0013] The present invention also includes a method for identifying or assisting in the identification of wheat ear grain number in the early stage of breeding. Based on the SNP site described in claim 1, in the early stage of molecular marker-assisted selection breeding, primers are designed to amplify any DNA fragment containing the SNP site in the wheat genomic DNA to be tested by PCR. The wheat genotype is identified by enzyme digestion of the PCR amplification product. The wheat ear grain number phenotype is identified or assisted in the identification based on the following correlation between genotype and phenotype: the methyl genotype has a higher wheat ear grain number than the B genotype.

[0014] As a preferred embodiment of the present invention, the DNA fragment amplified by PCR is the 410-536 bp from the 5' end of SEQ ID NO.1; the specific primer pair for PCR amplification is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; the restriction endonuclease NotI is used for enzyme digestion.

[0015] As a preferred embodiment of the present invention, the enzyme digestion includes the following steps: using wheat genomic DNA as a template, amplifying with primers 1F and 1R to obtain a PCR product; diluting this PCR product 10 times, using it as a template, amplifying with primers 2F and 2R to obtain a PCR product; digesting the PCR product with the restriction endonuclease NotI; if the PCR product can be cleaved, the nucleotide polymorphism site is C / C, and the genotype is A; if the PCR product cannot be cleaved, the nucleotide polymorphism site is G / G, and the genotype is B; the number of grains per ear is: wheat homozygous for genotype A is greater than or candidate greater than wheat homozygous for genotype B.

[0016] The present invention also includes primer combinations for detecting the SNP sites, including primer pairs 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5.

[0017] The beneficial effects of adopting the above technical solution are as follows: Through genetic variation analysis of natural wheat variant populations, the research team of this invention discovered 11 SNPs, corresponding to positions 137, 353, 364, 430, 455, 491, 589, 1058, 1345, 1437, and 1548 from the 5' end of sequence listing 1, respectively; among them, SNP at position 430 exhibits major effect and stability. By designing a dCAPS marker for SNP position 430, two genotypes were found: genotype A (C) and genotype B (G). Association analysis demonstrated that, in homozygous types of these two genotypes, the number of grains per ear is: wheat homozygous for genotype A is greater than or candidate greater than wheat homozygous for genotype B. This invention also provides a dCAPS marker for detecting the aforementioned SNP. Experiments have shown that by detecting this SNP, wheat with a higher number of grains per ear can be identified. This invention provides a novel method for marker-assisted selection breeding of wheat, which is of great significance in the development of high-yielding wheat varieties and in related research. This SNP locus not only expands the genetic resource tools for wheat, but our scientific experiments and data statistics have also verified its good and broad application potential. Attached Figure Description

[0018] Figure 1 This is a schematic diagram of the gene structure and SNP sites of TabHLH93-B of the present invention.

[0019] Figure 2 The electrophoretic detection results of the SNP-developed dCAPS-labeled enzyme digestion products of this invention are shown below; where M is the molecular weight standard; lane C is the band cleaved by NotI, and lane G is the band that cannot be cleaved by NotI.

[0020] Figure 3 The results of the correlation analysis between TabHLH93-B of this invention and the number of grains per ear show that the number of grains per ear of type I is significantly higher than that of type II. Detailed Implementation

[0021] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. The wheat materials used in the following embodiments are all from the National Crop Germplasm Bank (http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm), and material information can be found on the China Crop Germplasm Information Network, website: http: / / icgr.caas.net.cn.

[0022] It should be understood that, when used in this specification and the appended claims, the term "comprising" indicates the presence of a described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof. It should also be understood that, as used in this specification and the appended claims, the term "and / or" refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.

[0023] As used in this application specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrase "if determined" or "if detected [the described condition or event]" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once detected [the described condition or event]," or "in response to detection [the described condition or event]."

[0024] Furthermore, in the description of this application and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" in this application mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in still other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "comprising," "including," "having," and variations thereof mean "including but not limited to," unless otherwise specifically emphasized.

[0025] Example 1: Detection of SNPs related to wheat ear grain number and their PCR-enzyme digestion polymorphisms

[0026] 1. Specific primers and sequence analysis for amplifying the genomic fragment containing this wheat SNP.

[0027] like Figure 1As shown, 11 SNPs were found in the wheat gene, corresponding to positions 137, 353, 364, 430, 455, 491, 589, 1058, 1345, 1437, and 1548 from the 5' end as shown in SEQ ID NO1; among them, SNP at position 430 exhibits major effect and stability. By designing dCAPS markers for SNP at position 430, two genotypes were found at this site in the naturally occurring wheat population:

[0028] Genotype A: C

[0029] Genotype B: G

[0030] Based on the sequence differences in different wheat genomes, specific primers were designed for PCR amplification of DNA fragments containing the SNP site:

[0031] F1: AGACACATCACTCTCTCCCGTCTCC (SEQ ID NO.2);

[0032] R1: GTCAGCAATGGCGCTCTGCTCC (SEQ ID NO.3);

[0033] F2: CCCCTTCCCCAATGCGGCCG (SEQ ID NO.4);

[0034] R2: GTCAGCAATGGCGCTCTCCTCC (SEQ ID NO.5);

[0035] The target sequences for PCR amplification using primer pairs F1 and R1 are as shown in positions 40-1101 of SEQ ID NO. 1 in the sequence listing; the target sequences for PCR amplification using primer pairs F2 and R2 are as shown in positions 410-536 of SEQ ID NO. 1 in the sequence listing. Enzyme digestion analysis showed that this polymorphism could be recognized by NotI.

[0036] 2. Establishment of PCR-restriction polymorphism detection and genotyping methods

[0037] 1) Extract genomic DNA from the wheat to be tested;

[0038] 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (20 μL) consists of: 7 μL ddH2O, 10 μL 2×Taq Mix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (50 ng / μL).

[0039] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, for 30 cycles; 72℃ for 10 min; and storage at 16℃.

[0040] 3) Dilute the PCR product from step 2) 10 times and use it as a template for PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) is as follows: ddH2O 7 μL, 2×Taq Mix 10 μL, primer F1 (10 μmol / L) and primer R1 (10 μmol / L) 1 μL, template (50 ng / μL) 1 μL.

[0041] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, for 32 cycles; 72℃ for 10 min; and storage at 16℃.

[0042] 4) Digest the PCR product obtained in step 3) with NotI enzyme to obtain the digested product. Perform 4% agarose gel electrophoresis to detect whether the PCR product was digested into two fragments. Determine and record the status of the wheat sample at the specified sites according to the following method:

[0043] If the enzyme digestion product is a small fragment: 106 bp, then the wheat being tested is C homozygous at the site (represented as C / C). Figure 2 Lane C in the middle of the swimming lane).

[0044] If the enzyme digestion product is a large fragment: 127 bp, then the wheat being tested is homozygous for G at the specified site (expressed as G / G). Figure 2 Lane G in the middle of the swim.

[0045] 5) Based on the results of step 4), wheat is classified into two types, I and II, at the stated site:

[0046] I:C / C (i.e., homozygous genotype A);

[0047] II: G / G (i.e., homozygous genotype B);

[0048] The part before the " / " represents the case on one homologous chromosome, and the part after the " / " represents the case on another homologous chromosome.

[0049] 3. Use dCAPS markers to genotype natural populations and perform association analysis with grain number trait.

[0050] Each wheat variety in a natural population consisting of 323 hexaploid wheat was used as a test wheat variety. Genotyping was performed according to the method in step 2. The amplification products of some wheat varieties were randomly sequenced for verification. The results are shown in Table 1.

[0051] Table 1. Information on the polymorphic sites described in natural wheat populations.

[0052]

[0053]

[0054]

[0055]

[0056] Example 2: Association Analysis of Gene Polymorphism Sites and Grain Number in Natural Populations

[0057] In 2018, wheat populations of the aforementioned natural populations were planted in dry and hot fields at the Luancheng Experimental Station of the Agricultural Resources Research Center, Chinese Academy of Sciences (Luancheng, Hebei Province); in 2019, in irrigated and dry fields at the Hengshui Experimental Farm of the Agricultural Resources Research Center, Chinese Academy of Sciences (Hengshui, Hebei Province); and in 2020, in dry, hydrothermal, and irrigated fields at the Institute of Crop Science, Chinese Academy of Agricultural Sciences (Zhaoxian Experimental Station). The number of grains per ear for each wheat variety was investigated. Exon capture sequencing was performed on 323 accessions, and specific genotyping was conducted on these materials. Genotyping included two cases: homozygous C / C genotype A and homozygous G / G genotype B. Furthermore, 316 of these 323 accessions had agronomic trait data from multiple years and locations, while the remaining 7 accessions did not have sufficient data to meet the requirements for subsequent analysis. Therefore, as shown in Table 2 and... Figure 3 As shown, only these 316 data points were used in the association analysis between the genetic polymorphism sites in the natural population and the number of spikelets per spike.

[0058] Table 2. Results of association analysis between gene polymorphism sites and grain number in natural populations.

[0059] The association analysis results in Table 2 show that the differences in grain number per spike between the two types in the natural population composed of 316 hexaploid wheat accessions in Table 1 were statistically significant (P < 0.05). Specifically, type I wheat had a higher grain number per spike than type II wheat. In several environments, type I wheat had 2.00, 1.36, 1.17, 1.33, 0.56, and 1.25 more grains per spike than type II wheat, respectively. This study of the natural population indicates that type I is a superior genotype for increasing wheat grain number per spike.

[0060] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these examples without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

[0061] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail or recorded in a certain embodiment, please refer to the relevant descriptions of other embodiments.

[0062] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. A SNP locus associated with wheat ear grain number, characterized in that: The SNP site corresponds to the 430th base from the 5' end of the sequence shown in SEQ ID NO.

1. When this site is C / C homozygous, the corresponding genotype is A; when this site is G / G homozygous, the corresponding genotype is B. The number of grains per ear is as follows: wheat homozygous genotype A is greater than or candidate greater than wheat homozygous genotype B.

2. The use of the wheat SNP site according to claim 1, characterized in that: The purpose is to conduct theoretical research on the principles of wheat spike grain number development based on the SNP loci, and / or to conduct molecular regulatory pathway research on wheat spike grain number development based on the SNP loci; including: based on the SNP loci, identifying, characterizing and / or distinguishing downstream associated effector molecules through locus genotypic differences, and constructing a molecular regulatory pathway for wheat spike grain number; the effector molecules include, but are not limited to, messenger RNA, proteins, associated biological enzymes, various molecular regulatory components, and various molecular signaling components; further, based on the construction of the molecular regulatory pathway for wheat spike grain number, identifying and confirming major or key regulatory nodes and their corresponding biomacromolecules or small molecule components.

3. The use of the wheat SNP site according to claim 1, characterized in that: The application is to screen or assist in screening wheat spike grain number phenotype in the early stage of molecular marker-assisted selection breeding.

4. The use of the wheat SNP site according to claim 1, characterized in that: The intended use is to regulate the number of grains per ear of wheat in the agricultural industry according to production needs based on the SNP locus, including: increasing the number of grains per ear of wheat based on the methyl genotype and decreasing the number of grains per ear of wheat based on the B genotype; potential application scenarios for increasing the number of grains per ear of wheat include: ensuring food security reserves and producing more wheat for the development of the bioenergy industry; potential application scenarios for decreasing the number of grains per ear of wheat include: increasing the nutritional content of wheat and using high-nutrition wheat for the production of infant food.

5. A gene detection kit, characterized in that: For detecting the SNP site as described in claim 1, the gene detection kit contains a PCR amplification specific primer combination corresponding to the SNP site, as well as template DNA, buffer, dNTPs, and other necessary components for gene detection.

6. The gene detection kit according to claim 5, characterized in that: The PCR amplification specific primer combination includes primer pairs 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.

5.

7. A method for identifying or assisting in the identification of wheat ear grain count in the early stages of breeding, characterized in that: Based on the SNP site described in claim 1, in the early stage of molecular marker-assisted selection breeding, primers are designed to amplify any DNA fragment containing the SNP site in the wheat genomic DNA to be tested by PCR. The wheat genotype is identified by enzyme digestion of the PCR amplification product, and the wheat ear grain number phenotype is identified or assisted in identification based on the following correlation between genotype and phenotype: the methyl genotype has a higher wheat ear grain number than the B genotype.

8. The method according to claim 7, characterized in that: The DNA fragment amplified by PCR is the 410-536 bp from the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; the restriction endonuclease NotI is used for enzyme digestion.

9. The method according to claim 7, characterized in that: The enzyme digestion includes the following steps: using wheat genomic DNA as a template, amplifying with primers 1F and 1R to obtain PCR products; diluting this PCR product 10-fold, using it as a template, amplifying with primers 2F and 2R to obtain PCR products; digesting the PCR product with the restriction endonuclease NotI; if the PCR product can be cleaved, the nucleotide polymorphism site is C / C, and the genotype is A; if the PCR product cannot be cleaved, the nucleotide polymorphism site is G / G, and the genotype is B; the number of grains per ear is: wheat homozygous for genotype A is greater than or candidate greater than wheat homozygous for genotype B.

10. A primer combination for detecting the SNP site of claim 1, comprising: Primer pairs 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5.

Images