Primer set, kit and method for detecting purity of insect-resistant, glyphosate-tolerant transgenic maize kj1003

Abstract

The application belongs to the technical field of gene detection, and relates to a primer group, a kit and a method for detecting the purity of a pest-resistant glyphosate-resistant transgenic corn KJ1003. The primer group comprises specific primer 1, specific primer 2 and a universal primer, and the sequences are shown in SEQ ID NO: 1-3. The primer group, the kit and the method for detecting the purity of the pest-resistant glyphosate-resistant transgenic corn KJ1003 can be used to detect whether the to-be-detected corn is the pest-resistant glyphosate-resistant transgenic corn event KJ1003 transformant and whether the to-be-detected corn is a homozygote or a heterozygote of the pest-resistant glyphosate-resistant transgenic corn event KJ1003 transformant based on the KASP technology, with high accuracy, high specificity, high sensitivity and high efficiency.

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology and relates to primer sets, kits and methods for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003. Background Technology

[0002] Transgenic technology is widely used in maize breeding. Insect-resistant and glyphosate-tolerant transgenic maize varieties have been launched on the international market, and my country has also successively approved transgenic maize varieties.

[0003] The applicant's earlier Chinese patent application CN202310319438.5 discloses a transgenic maize KJDLM528T201003 (commercial name KJ1003) that is insect-resistant and tolerant to high concentrations of glyphosate herbicide, which has good prospects for industrial application.

[0004] In the breeding process of genetically modified maize varieties, seed purity is the key to breeding success. Current technologies mainly determine seed purity by spraying herbicides, ELISA, and ordinary PCR. However, these methods are time-consuming, complex, and costly, making it difficult to meet the needs of rapid backcrossing and breeding. Furthermore, the types of samples tested are limited, and the methods are easily affected by environmental factors such as weather. It is also impossible to conduct large-scale testing simultaneously, and the process of screening for high purity samples after testing is also very complicated.

[0005] KASP (Kompetitive Allele Specific PCR) is a competitive allele-specific PCR technology that has been widely used in high-throughput SNP genotyping due to its high stability, accuracy, and low cost. KASP technology is particularly advantageous when dealing with large sample sizes. Applying KASP technology to the purity detection of transgenic events can further leverage its high accuracy, low cost, and speed.

[0006] Therefore, it is essential to develop a purity detection method for transgenic events using KASP technology, especially for the transgenic maize event KJ1003. Summary of the Invention

[0007] The primary objective of this invention is to provide a primer set for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, enabling high accuracy, high specificity, high sensitivity, and high efficiency in detecting whether the maize under test is a transformant of the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003, and whether the maize under test is homozygous or heterozygous for the transformant of the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003, based on KASP technology.

[0008] To achieve this objective, in a basic implementation, the present invention provides a primer set for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, the primer set comprising specific primer 1, specific primer 2 and universal primer, the sequences of which are shown in SEQ ID NO: 1-3, respectively.

[0009] The exemplary detection principle of this invention is as follows.

[0010] To perform KASP detection, this invention designs two pairs of primers for the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003 transformant and wild-type maize. The reverse primers of both pairs are identical, serving as universal primers (i.e., shared downstream primers for detecting both transformants and wild-type maize). The forward primers of the two pairs, namely specific primer 1 (i.e., upstream primer for detecting transformants) and specific primer 2 (i.e., upstream primer for detecting wild-type maize), are different, and the fluorescent reporter genes at their 5' ends each carry an allele sequence, allele2 and allele1, respectively, indicated in blue and red (e.g., ). Figure 1 (As shown). Simultaneously, the KASP mix reagent used for KASP detection contains allele1 and allele2 sequences labeled with fluorescent dyes. The quenching group is labeled onto the complementary strand, so it does not emit light when not amplified. If the amplification template contains wild-type or transformant sequences, complementary sequences of allele1 or allele2 will be generated. During PCR annealing, these complementary sequences compete with the complementary sequences of allele1 or allele2 containing the quenching group, binding to allele2 or allele1 labeled with FAM or HEX, thus causing FAM or HEX to move away from the quenching group and emit light. Therefore, the homozygous transformant of the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003 emits blue light because it only contains the transformant sequence; the wild-type maize emits red light because it only contains the wild-type sequence; and the heterozygous transformant of the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003 emits both blue and red light because it contains both the transformant and wild-type sequences, resulting in green light when the two light sources are combined.

[0011] In a preferred embodiment, the present invention provides a primer set for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, wherein the 5' end of the specific primer 1 carries the tail sequence of the fluorescent reporter gene 2, and the 5' end of the specific primer 2 carries the tail sequence of the fluorescent reporter gene 1.

[0012] In a preferred embodiment, the present invention provides a primer set for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, wherein the fluorescent reporter gene 2 is a FAM fluorescent reporter gene; and the fluorescent reporter gene 1 is a HEX or VIC fluorescent reporter gene.

[0013] The second objective of this invention is to provide a kit for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, which, based on KASP technology, can detect with high accuracy, high specificity, high sensitivity, and high efficiency whether the maize to be tested is a transformant of the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003, and whether the maize to be tested is homozygous or heterozygous for the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003.

[0014] To achieve this objective, in a basic implementation, the present invention provides a kit for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, the kit being based on KASP technology and containing the primer set as described above.

[0015] In a preferred embodiment, the present invention provides a kit for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, wherein the concentrations of the primers in SEQ ID NO: 1-3 in the kit are each independently 80-200 nmol / L, 80-200 nmol / L, and 200-600 nmol / L (preferably each independently 168 nmol / L, 168 nmol / L, and 420 nmol / L).

[0016] In a preferred embodiment, the present invention provides a kit for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, wherein the kit further comprises HiGeno 2 Probe Mix A (KASP reagent, Beijing Jiacheng Biotechnology Co., Ltd.).

[0017] The third objective of this invention is to provide a method for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, which, based on KASP technology, can detect with high accuracy, high specificity, high sensitivity, and high efficiency whether the maize to be tested is a transformant of the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003, and whether the maize to be tested is homozygous or heterozygous for the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003.

[0018] To achieve this objective, in a basic implementation, the present invention provides a method for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003. The method is based on KASP technology and includes the following steps: (1) Extract maize genomic DNA as a DNA template; (2) Use the primer set as described above or the kit as described above to amplify the DNA template obtained in step (1); (3) Perform fluorescence detection analysis on the amplification reaction product of step (2) to determine the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003.

[0019] In a preferred embodiment, the present invention provides a method for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, wherein in step (1), the method for extracting the maize genomic DNA to be tested is the magnetic bead method.

[0020] In a preferred embodiment, the present invention provides a method for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, wherein in step (2), the amplification reaction conditions are: 30°C, 30 seconds, 1 cycle; 95°C, 10 minutes, 1 cycle; 95°C, 20 seconds, 61-55°C, 40 seconds, 10 cycles; 95°C, 20 seconds, 55°C, 40 seconds, 32 cycles; 30°C, 30 seconds, 1 cycle.

[0021] In a preferred embodiment, the present invention provides a method for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, wherein in step (3), If only fluorescence corresponding to fluorescent reporter gene 2 is detected in the amplification reaction product, the maize to be tested is determined to be a homozygous insect-resistant and glyphosate-tolerant transgenic maize KJ1003; If only fluorescence corresponding to fluorescent reporter gene 1 is detected in the amplification reaction product, the maize to be tested is determined to be wild-type. If the fluorescence corresponding to fluorescent reporter gene 1 and fluorescent reporter gene 2 are detected simultaneously in the amplification reaction product, the maize to be tested is determined to be an insect-resistant and glyphosate-tolerant transgenic maize KJ1003 heterozygote.

[0022] The beneficial effects of this invention are that, by using the primer set, kit, and method of this invention for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, it is possible to detect, based on KASP technology, whether the maize to be tested is a transformant of the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003, and whether the maize to be tested is homozygous or heterozygous for the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003. Attached Figure Description

[0023] Figure 1 The diagram illustrates the principle of using KASP primers of the present invention to detect the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003.

[0024] Figure 2 This is an example of a schematic diagram illustrating the principle of using common PCR primers to detect the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003.

[0025] Figure 3 The image shows the KASP detection results of the KSAP01 primer combination in Examples 2 and 3.

[0026] Figure 4The image shows the KASP detection results of the KSAP02 primer combination in Examples 2 and 3.

[0027] Figure 5 The image shows the results of conventional PCR identification in Example 2, where AA represents the homozygous transformant of the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003, Aa represents the heterozygous transformant of the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003, and aa represents wild-type maize.

[0028] Figure 6 The image shows the KASP test results of actual samples from the offspring of five different maize inbred lines in Example 4.

[0029] Figure 7 This is a diagram showing the results of conventional PCR electrophoresis verification of actual samples from the offspring of maize inbred line 1 in Example 4. Detailed Implementation

[0030] To better understand the technical solutions and advantages of the present invention, the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0031] Example 1: Primer Design Based on the location and sequence of the foreign gene inserted into the maize genome disclosed in Table 1 of Chinese patent application CN202310319438.5, primers for KASP and control conventional PCR detection were designed as shown in Table 1 below. The principle of KASP primer detection for the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003 is as follows: Figure 1 As shown, the principle of using common PCR primers to detect the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003 is as follows: Figure 2 As shown.

[0032] Table 1 Primer design for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003.

[0033]

[0034]

[0035] Among them, specific primer 1 and universal primers were paired to detect the insect-resistant and glyphosate-tolerant transgenic maize transformant KJ1003, and the amplified sequence is as follows: GCCGGTGTCATCTATGTTACTAGATCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGACTGCCCGATGGACGCCTCAAACTCGGGCACGGTTGGGGA The specific primer 2 and the universal primer were paired to detect wild-type maize, and the amplified sequence is as follows: TCTGCAGCGCAGCCTCCCAAGTCCCACTCCTTGTCCTCCTCCAGTCCTCCTGCGTCGCCTCAACCACCGCAGCGGCCCCCAGAGGGGGCGGGAGCGCGAGGACTCGGGCACGGTTGGGGA The upstream and downstream primers of the transformant were paired to detect the insect-resistant and glyphosate-tolerant transgenic maize transformant KJ1003. The amplified sequence is as follows: TCCTCGCTCCCTTTTTCTCTTCCCCAACCGTGCCCGAGTTTGAGGCGTCCATCGGGCAGTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCTAGTAACATAGATGACACCGCGCGCGATAATTTATCCTAGTTTGCGCGCTATATTTTGTTTTCTATCGCGTATTAAATGTATAATTGCGGGACTCTAA Wild-type upstream and downstream primers were paired to detect wild-type maize, and the amplified sequences are as follows: GGCTGGGAGCGGGTGCCGACGCTCTGGCGGCGCTGGTGTTCCAGCTGACCGTGTCCTCGCTCCCTTTTCTCTTCCCCAACCGTGCCCGAGTCCTCGCGCTCCCGCCCCCTCTGGGGGCCGCTGCGGTGGTTGAGGCGACGCAGGAGGACTGGAGGAGGACAAGGAGTGGGACTTGGGAGGCTGCGCTGCAGAAGTGGAAGA CCAAGACTTACGCGCTCTCGGTGCCCCTCCGGAAAGGCGCGCTACGCGGCTCCTTCCCTCCATCTTGGATTAAGGTCTGGTCGCCCTCATCCACCATAAGCAAAGCATCCCCATTTGCCAGTTTAGTAGTTAAACCATAACATAACATGATTGCATAAATTTGTGTGAGCATGGAAGCTTGAATGGTGTATGGCCAGGGG Example 2: Determination of Detection Conditions 1. Extraction of maize genomic DNA using magnetic beads The plant (leaf) genome extraction kit (Cat#NMG0231-96) using magnetic beads, manufactured by Wuhan Nanomagnetic Biotechnology Co., Ltd., was used. The required reagents were prepared strictly according to the instructions, and different maize genomic DNA samples were extracted following the steps outlined in the instructions (including grinding, lysis, supernatant aspiration, and automated extraction). The concentration of each extracted maize genomic DNA sample was measured using a micro-volume UV spectrophotometer (Thermo Nano Drop One), and each sample was diluted with water to 10-30 ng / µL.

[0036] The extracted maize genomic DNA included DNA from homozygous transformants of the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003, DNA from heterozygous transformants of the insect-resistant and glyphosate-tolerant transgenic maize event KJ1003, and DNA from wild-type maize.

[0037] 2. PCR amplification 1) KASP amplification The primer system for KASP amplification is shown in Table 2 below.

[0038] Table 2 Primer system for KASP amplification

[0039] The reaction system for KASP amplification is shown in Table 3 below.

[0040] Table 3 Reaction system for KASP amplification

[0041] The reaction procedure for KASP amplification is shown in Table 4 below.

[0042] Table 4. Reaction Procedure for KASP Amplification

[0043] Amplification and fluorescence value reading can be performed directly using a quantitative real-time PCR instrument; alternatively, after the amplification cycle is completed using a conventional PCR instrument, the fluorescence signal value can be read using a quantitative real-time PCR instrument or a plate reader in endpoint fluorescence mode. Due to the chemical reaction principle of AQPTM, the fluorescence signal value of the sample needs to be read at an environment ≤40℃, and 30℃ is recommended. When using a quantitative real-time PCR instrument, the fluorescence signal value should be read at an environment ≤40℃ after the PCR reaction is completed, instead of using the endpoint curve generated by real-time data. Note: When amplifying KASP, at least two wells need to be set up for blank control, homozygous control, heterozygous control, and wild-type control.

[0044] Result interpretation: For example Figure 3 , Figure 4As shown, red dots represent wild type, blue dots represent homozygotes, green dots represent heterozygotes, and crossed dots represent blank controls, consistent with the actual situation of the samples.

[0045] This confirms that the above operations are suitable conditions for KASP amplification.

[0046] 2) Conventional PCR amplification The reaction system for conventional PCR amplification is shown in Table 5 below.

[0047] Table 5 Reaction system for conventional PCR amplification

[0048] The reaction procedures for designing conventional PCR amplification are shown in Tables 6 and 7 below.

[0049] Table 6. Reaction Procedure for Conventional PCR Transformant Amplification

[0050] Table 7. Reaction Procedure for Conventional PCR Wild-Type Amplification

[0051] Result interpretation: For example Figure 5 As shown, if the wild-type amplification is positive and the transformant amplification is negative, it indicates that the sample is wild-type (aa); if the wild-type amplification is negative and the transformant amplification is positive, it indicates that the sample is homozygous (AA); if both the wild-type amplification and the transformant amplification are positive, it indicates that the sample is heterozygous (Aa), and the interpretation of the results is consistent with the actual situation of the sample.

[0052] This confirms that the above operations are suitable conditions for routine PCR amplification.

[0053] Example 3: Specificity Test The detection results for primer combinations KASP01 and KASP02 (both for the same 96 samples, including 2 blanks, 45 homozygous samples, 45 heterozygous samples, and 4 wild-type samples) are as follows: Figure 3 and Figure 4 As shown, where Figure 3 (KASP01) compared to Figure 4 The distribution of the (KASP02) detection sample points is relatively more concentrated, so the KASP01 combination was selected as the final detection primer set.

[0054] Example 4: Actual Sample Testing The purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003 was determined by KASP (using primer combination KASP01) and conventional PCR on actual samples of the progeny of five different maize inbred lines (96 samples from each inbred line). The identification and detection conditions were the same as in Example 2. The KASP detection results are as follows: Figure 6 As shown, the results of conventional PCR verification of actual samples from the offspring of inbred line 1 are as follows: Figure 7 As shown in Table 8 (due to space limitations, the results of conventional PCR verification of actual samples from the offspring of inbred lines 2-5 are not presented individually), the statistical results are shown in Table 8. The detection results indicate that the detection results of actual samples from the offspring of the five different inbred lines using the method of this invention are consistent with those using conventional PCR.

[0055] Table 8. Detection results of actual samples from offspring of different maize inbred lines.

[0056] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims and their equivalents, this invention is also intended to include these modifications and variations. The above embodiments or implementations are merely illustrative examples of this invention, and it can also be implemented in other specific ways or forms without departing from its gist or essential characteristics. Therefore, the described embodiments should be considered illustrative rather than limiting in any respect. The scope of this invention should be defined by the appended claims, and any changes equivalent to the intent and scope of the claims should also be included within the scope of this invention.

Claims

1. A primer set for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, characterized in that: The primer set includes specific primer 1, specific primer 2 and universal primer, the sequences of which are shown in SEQ ID NO: 1-3, respectively.

2. The primer set according to claim 1, characterized in that: The 5' end of the specific primer 1 contains the tail sequence of the fluorescent reporter gene 2, and the 5' end of the specific primer 2 contains the tail sequence of the fluorescent reporter gene 1.

3. The primer set according to claim 2, characterized in that: The fluorescent reporter gene 2 is a FAM fluorescent reporter gene; the fluorescent reporter gene 1 is a HEX or VIC fluorescent reporter gene.

4. A kit for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, characterized in that: The kit is based on KASP technology and contains the primer set as described in any one of claims 1-3.

5. The reagent kit according to claim 4, characterized in that: The concentrations of the primers in the kit described herein are independently 80-200 nmol / L, 80-200 nmol / L, and 200-600 nmol / L, respectively.

6. The reagent kit according to claim 4, characterized in that: The kit also contains HiGeno 2 ProbeMix A.

7. A method for detecting the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003, characterized in that, The method described is based on KASP technology and includes the following steps: (1) Extract maize genomic DNA as a DNA template; (2) The DNA template obtained in step (1) is amplified using the primer set described in any one of claims 1-3 or the kit described in any one of claims 4-6; (3) Perform fluorescence detection analysis on the amplification reaction product of step (2) to determine the purity of insect-resistant and glyphosate-tolerant transgenic maize KJ1003.

8. The method according to claim 7, characterized in that: In step (1), the method for extracting the maize genomic DNA to be tested is the magnetic bead method.

9. The method according to claim 7, characterized in that, In step (2), the conditions for the amplification reaction are: 30℃, 30 seconds, 1 cycle; 95℃, 10 minutes, 1 cycle; 95℃, 20 seconds, 61-55℃, 40 seconds, 10 cycles; 95℃, 20 seconds, 55℃, 40 seconds, 32 cycles; 30℃, 30 seconds, 1 cycle.

10. The method according to claim 7, characterized in that: In step (3), If only fluorescence corresponding to fluorescent reporter gene 2 is detected in the amplification reaction product, the maize to be tested is determined to be a homozygous insect-resistant and glyphosate-tolerant transgenic maize KJ1003; If only fluorescence corresponding to fluorescent reporter gene 1 is detected in the amplification reaction product, the maize to be tested is determined to be wild-type. If the fluorescence corresponding to fluorescent reporter gene 1 and fluorescent reporter gene 2 are detected simultaneously in the amplification reaction product, the maize to be tested is determined to be an insect-resistant and glyphosate-tolerant transgenic maize KJ1003 heterozygote.

Images