A method for detecting and quantifying multiple human papillomavirus subtypes based on metal element and isotope labeling and catalytic hairpin assembly

Abstract

The application belongs to the technical field of biological detection, and particularly relates to a kind of quantitative detection method of multiple human papilloma virus subtype nucleic acid based on metal element and isotope labeling and catalytic hairpin assembly.The method labels nucleic acid probe with different metal elements or isotopes respectively, and fixes the formed multi-chain nucleic acid probe structure on a solid carrier; the first HPV subtype nucleic acid is used to initiate catalytic hairpin assembly, the obtained product is used to initiate cascade chain displacement with the second HPV subtype nucleic acid, so that the corresponding metal or isotope labeled probe enters the liquid phase. After solid-liquid separation, different metal or isotope signals are detected by ICP-MS to realize the differentiation and quantification of multiple HPV subtype nucleic acids; by introducing artificial enrichment isotope tracer, absolute quantification can also be realized by isotope dilution method. The detection method has a very wide linear range for human papilloma virus subtype nucleic acid detection, and provides technical support for constructing a new generation of nucleic acid absolute quantification standard method.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a quantitative detection method for multiple human papillomavirus subtypes based on metal element and isotope labeling and catalytic hairpin assembly. Background Technology

[0002] Viral testing plays a crucial role in the diagnosis of related diseases. Taking high-risk human papillomavirus (HPV) as an example, subtypes such as HPV-16 and HPV-18 play key roles in the screening, diagnosis, and treatment of various malignant tumors, including cervical cancer, vulvar cancer, vaginal cancer, penile cancer, anal cancer, and oropharyngeal cancer. Cervical cancer is the second leading cause of cancer-related deaths among women worldwide, with a particularly high incidence rate in developing countries. Although vaccination and viral screening have made cervical cancer one of the most preventable cancers, the limited accessibility of HPV vaccines and the fact that early infection often presents no obvious clinical symptoms mean that most cases are diagnosed at an advanced stage. Therefore, developing a bioanalytical platform capable of sensitively detecting HPV in clinical serum samples to achieve early screening and effectively reduce cervical cancer mortality has become an urgent scientific problem to be solved.

[0003] HPV nucleic acid testing is one of the most effective screening methods currently available. However, current virus testing often faces two challenges: first, due to the complexity of physiological samples such as serum, relatively quantitative detection methods often struggle to provide accurate quantitative results; second, traditional PCR-related signal amplification techniques not only pose an increased risk of contamination and require highly trained personnel and sophisticated instruments, but may also lead to false positive results during the amplification process.

[0004] Monitoring high-risk HPV infection is helpful for the early diagnosis of cervical cancer. Multiplex HPV testing is more accurate than single testing in assessing cancer risk and guiding early diagnosis and treatment. Therefore, developing a nucleic acid quantitative detection method that can simultaneously detect multiple HPV viral biomarkers (such as HPV-16 and HPV-18) is of vital importance in reducing cervical cancer mortality. Summary of the Invention

[0005] Isotope dilution is defined as a high-precision and high-accuracy technique for measuring elemental concentration. This technique calculates elemental concentration by measuring the mass of the sample, the mass of the added non-natural isotopic substance (i.e., the "tracer"), and the measured isotope ratio, providing absolute quantitative information. This method is considered a primary analytical approach, and its results are directly traceable to the International System of Units (SI). Metal element-labeled isotope dilution analysis overcomes the limitation of spectral band overlap in traditional optical detection by utilizing stable isotope encoding, supporting simultaneous detection of multiple components. This method calculates target content based on changes in isotope ratios, offering advantages such as high measurement accuracy and sensitivity, and minimal matrix effects and interference.

[0006] Unlike PCR, some signal amplification methods developed in recent years include entropy-driven catalysis (EDC) and catalytic hairpin assembly (CHA). CHA is an enzyme-free, efficient, isothermal nucleic acid amplification method that utilizes two DNA strands with complementary regions. Initially, both DNA strands have intra-strand and inter-strand complementary regions. After annealing, a stable hairpin structure is formed, masking the inter-strand complementary region and preventing hybridization when the two DNA strands are together. When an invading strand is introduced into the system, a toehold-mediated strand displacement reaction opens H1, exposing the single-stranded region that binds to the toehold of H2. This leads to a second toehold-mediated strand displacement reaction to open H2. Subsequently, after H2 is opened, a third strand displacement reaction displaces the invading strand, allowing the invading strand to be recycled, thus achieving the amplification effect.

[0007] In view of this, by integrating (1) the multiple coding capability of metal isotope labeling, (2) the multi-input signal processing capability of ICP-MS, and (3) the DNA cascade amplification strategy based on CHA, this invention develops a nucleic acid signal amplification strategy capable of outputting multi-component HPV virus signals. The constructed double-strand substitution reaction is initiated sequentially by HPV-16 and HPV-18, which respectively replace the labeled 159 Tb and 158 A DNA probe containing Gd was then used for detection by ICP-MS. ICP-MS can simultaneously output signals from both elements without band overlap, providing a basis for quantitative target detection. Simultaneously, artificial enrichment was performed. 155 The addition of Gd can also serve as an internal standard, enabling absolute quantification of HPV-18. This strategy, which integrates molecular-specific recognition, high-efficiency nucleic acid amplification, and metal-encoded quantification, provides a scalable platform for establishing multi-component disease biomarker analysis methods.

[0008] In one aspect, the present invention provides a method for quantitative detection of multiple human papillomavirus subtypes based on metal element and isotope labeling and catalytic hairpin assembly, comprising the following steps: (1) A solid-phase probe complex is provided, the solid-phase probe complex comprising a solid-phase support and a multi-stranded nucleic acid probe structure loaded on the solid-phase support; the multi-stranded nucleic acid probe structure comprises three nucleic acid probes, wherein the three nucleic acid probes are respectively labeled with metal elements and / or metal isotopes that can be distinguished and detected by inductively coupled plasma mass spectrometry. (2) Contact the sample to be tested with two hairpin nucleic acid probes; when the sample to be tested contains a first human papillomavirus subtype nucleic acid, the first human papillomavirus subtype nucleic acid initiates a catalytic hairpin assembly reaction to form a catalytic hairpin assembly product that can participate in subsequent chain displacement reactions; (3) The catalytic hairpin assembly product and the second human papillomavirus subtype nucleic acid in the sample to be tested are brought into contact with the solid-phase probe complex; the catalytic hairpin assembly product and the second human papillomavirus subtype nucleic acid sequentially or synergistically initiate at least two-stage chain displacement reactions in the multi-strand nucleic acid probe structure, so that the metal element-labeled or metal isotope-labeled nucleic acid probes corresponding to the first human papillomavirus subtype nucleic acid and the second human papillomavirus subtype nucleic acid respectively enter the liquid phase; (4) Separate the solid support from the liquid phase, use inductively coupled plasma mass spectrometry to detect multiple metal element labeling signals and / or metal isotope labeling signals in the liquid phase, and determine the content of the first human papillomavirus subtype nucleic acid and the second human papillomavirus subtype nucleic acid in the sample to be tested according to the different metal element labeling signals and / or metal isotope labeling signals.

[0009] In some implementations, the first human papillomavirus subtype nucleic acid is HPV-16 nucleic acid, and the second human papillomavirus subtype nucleic acid is HPV-18 nucleic acid.

[0010] In some embodiments, the multi-stranded nucleic acid probe structure includes a first nucleic acid probe HA1, a second nucleic acid probe HA2, and a third nucleic acid probe HA3, wherein HA1, HA2, and HA3 form a triple-stranded nucleic acid probe structure L3 through complementary pairing of nucleic acid bases.

[0011] In some implementations, the HA1 carries 155 Gd-labeled, HA2 is Tb-labeled, and HA3 is Gd-labeled, wherein the Gd-labeled components comprise stable isotopes of varying abundance. 157 Gd and 158 Gd, 158 Gd is used to determine the relative content of the second human papillomavirus subtype nucleic acid; 157 Gd is used to determine the absolute content of the second human papillomavirus subtype nucleic acid; 155 The Gd marker is used as an internal reference marker; the Tb marker contains stable isotopes. 159 Tb is used to determine the relative content of the first human papillomavirus subtype nucleic acid.

[0012] In some embodiments, the hairpin nucleic acid probe includes a first hairpin nucleic acid probe H1 and a second hairpin nucleic acid probe H2; H1 includes a first toehold, and H2 includes a second toehold. In the absence of the first human papillomavirus subtype nucleic acid, H1 and H2 maintain the hairpin structure through intra-strand complementary pairing and mask the inter-strand complementary regions between them. In the presence of the first human papillomavirus subtype nucleic acid, the first human papillomavirus subtype nucleic acid opens H1 through a first-pivot-mediated strand displacement reaction. The opened H1 further opens H2 through a second-pivot-mediated strand displacement reaction. H1 and H2 form an assembly product and displace and release the first human papillomavirus subtype nucleic acid, enabling the first human papillomavirus subtype nucleic acid to cycle and initiate subsequent catalytic hairpin assembly reactions.

[0013] In some implementations, the nucleic acid quantitative detection method is used for purposes other than disease diagnosis or treatment.

[0014] In some implementations, the nucleic acid quantification method is used for the quantification of human papillomavirus subtype nucleic acid, with the sole purpose of determining the relative or absolute content of human papillomavirus subtype nucleic acid in the sample to be tested, and does not involve steps for disease diagnosis.

[0015] In some implementations, step (4) uses the standard curve method to determine the relative content of at least one human papillomavirus subtype nucleic acid and the isotope dilution method to determine the absolute content of a second human papillomavirus subtype nucleic acid.

[0016] In some preferred embodiments, the relative amounts of the first human papillomavirus subtype nucleic acid and the second human papillomavirus subtype nucleic acid are determined in step (4) using the standard curve method.

[0017] In some preferred embodiments, the standard curve method includes: By establishing a standard curve between the detection signal of HPV nucleic acid standards with metal labeling and / or metal isotope labeling and their nucleic acid content, the test sample is subjected to a catalytic hairpin assembly reaction and the corresponding detection signal is obtained. The relative content of HPV nucleic acid in the test sample is determined based on the detection signal of the test sample and the standard curve.

[0018] As an optional implementation, the linear equation corresponding to the first human papillomavirus subtype nucleic acid is y = 1715lgx + 224, where: y is 159 Tb represents the ICP-MS signal intensity, and x represents the HPV-16 concentration.

[0019] As an optional implementation, the linear equation corresponding to the second human papillomavirus subtype nucleic acid is y = 713lgx + 119, where: y is 158 The ICP-MS signal intensity of Gd, where x is the concentration of HPV-18.

[0020] In some preferred embodiments, 155Gd-labeled nucleic acid probes were used as isotope tracers for determination by inductively coupled plasma mass spectrometry. 155 Gd and 157 The isotopic ratio of Gd, r155 / 157, was used to determine the absolute content of the second human papillomavirus subtype nucleic acid using the isotopic dilution method based on the isotopic ratio.

[0021] As an optional implementation, the calculation formula for the isotope dilution method is as follows: ; In the formula, This refers to the HA1 content quantified by ICP-MS. It is an enrichment of isotopes 155 The relative atomic weight of Gd is 154.98. This is the relative atomic weight of Gd, 157.25; It is an enrichment of isotopes 155 The abundance of Gd with a mass number of 155 was 90.2%. It is an enrichment of isotopes 155 The abundance of Gd with a mass number of 157 was 0.86%. It is a natural Gd 155 The abundance of Gd mass number was 14.8%. It is a natural Gd 157 The abundance of Gd mass number was 15.65%. It is the measurement ratio of 155 / 157.

[0022] In some embodiments, the catalytic hairpin assembly product initiates a first-stage chain displacement reaction, causing HA2 or a portion thereof to dissociate from the triple-stranded nucleic acid probe structure L3; the second human papillomavirus subtype nucleic acid initiates a second-stage chain displacement reaction, causing HA3 or a portion thereof to dissociate from the triple-stranded nucleic acid probe structure L3.

[0023] In some implementations, the first human papillomavirus subtype nucleic acid corresponds to the metal element signal of Tb, and the second human papillomavirus subtype nucleic acid corresponds to the metal element signal of Gd.

[0024] In some embodiments, at least one nucleic acid probe in the multi-stranded nucleic acid probe structure carries biotin, the surface of the solid support carries streptavidin, and the multi-stranded nucleic acid probe structure is immobilized on the solid support by the affinity interaction between biotin and streptavidin.

[0025] In some embodiments, the metal element label and / or metal isotope label are linked to the multi-stranded nucleic acid probe structure via a bifunctional linker molecule containing a metal chelating group.

[0026] In some embodiments, the metal chelating group is selected from at least one of DOTA, DTPA, EDTA, NOTA, TETA and their derivatives.

[0027] In some embodiments, the bifunctional linker molecule further includes a linker group capable of coupling with a thiol, amino, azide, or alkynyl group on the multi-stranded nucleic acid probe.

[0028] In some preferred embodiments, the bifunctional linker is DOTA-maleimide, and the nucleic acid probe is thiol-modified single-stranded DNA; after the DOTA-maleimide coordinates with metal ions, the maleimide group undergoes a coupling reaction with the thiol group on the single-stranded DNA to form a metal element-labeled nucleic acid probe or an isotope metal-labeled nucleic acid probe.

[0029] In some embodiments, the solid support is selected from at least one of magnetic microspheres, magnetic nanoparticles, polymer microspheres, silica microspheres, metal oxide particles, membrane materials, microporous plates, and chip surfaces.

[0030] In some preferred embodiments, the solid-phase support is streptavidin-modified magnetic microspheres, and the solid-phase probe complex is magnetic microspheres MBs-L3 loaded with a triple-stranded nucleic acid probe structure L3.

[0031] In some implementation schemes, by detection 159 The Tb signal is used to quantify the nucleic acid of the first human papillomavirus subtype, and the Gd signal is used to quantify the nucleic acid of the second human papillomavirus subtype.

[0032] In some preferred embodiments, by detecting the Gd signal and 155 The Gd signal was used to perform absolute quantification of the second human papillomavirus subtype nucleic acid.

[0033] In some implementations, step (4) further includes: processing the separated liquid phase before inductively coupled plasma mass spectrometry detection to convert the metal-labeled nucleic acid probe entering the liquid phase into a test solution containing metal ions.

[0034] In some implementations, the sample to be tested is derived from blood, serum, plasma, secretions, urine, saliva, tissue samples, or cell samples.

[0035] In some embodiments, the concentration of the first hairpin nucleic acid probe H1 and the second hairpin nucleic acid probe H2 is 2 µM, and the total volume of the first hairpin nucleic acid probe H1 and the second hairpin nucleic acid probe H2 is 5 µL to 25 µL, wherein the first hairpin nucleic acid probe H1 and the second hairpin nucleic acid probe H2 have the same volume.

[0036] In some preferred embodiments, the total volume of the first hairpin nucleic acid probe H1 and the second hairpin nucleic acid probe H2 is 10 µL.

[0037] In some preferred embodiments, the volume of the first hairpin nucleic acid probe H1 is 5 µL, and the volume of the second hairpin nucleic acid probe H1 is 5 µL.

[0038] In some embodiments, the volume of the solid support is 0.5 µL to 1.5 µL.

[0039] In some preferred embodiments, the volume of the solid support is 1.0 µL.

[0040] In some embodiments, the temperature of the catalytic hairpin assembly reaction is 18°C ​​to 42°C.

[0041] In some preferred embodiments, the temperature of the catalytic hairpin assembly reaction is 32°C.

[0042] In some embodiments, the catalytic hairpin assembly reaction takes 30 min to 150 min.

[0043] In some preferred embodiments, the catalytic hairpin assembly reaction takes 90 minutes.

[0044] In some implementations, the nucleotide sequence of the first hairpin nucleic acid probe H1 is shown in SEQ ID NO: 1.

[0045] In some embodiments, the nucleotide sequence of the second hairpin nucleic acid probe H2 is shown in SEQ ID NO: 2.

[0046] In some implementations, the nucleotide sequence of the first human papillomavirus subtype nucleic acid is shown in SEQ ID NO:3.

[0047] In some implementations, the nucleotide sequence of the second human papillomavirus subtype nucleic acid is shown in SEQ ID NO:4.

[0048] In some implementations, the nucleotide sequence of the first nucleic acid probe HA1 is shown in SEQ ID NO: 5.

[0049] In some embodiments, the nucleotide sequence of the second nucleic acid probe HA2 is shown in SEQ ID NO: 6.

[0050] In some embodiments, the nucleotide sequence of the third nucleic acid probe HA3 is shown in SEQ ID NO: 7.

[0051] In another aspect, the present invention provides products for implementing the aforementioned nucleic acid quantitative detection method, the products comprising the necessary materials for implementing the aforementioned nucleic acid quantitative detection method, such as: the nucleic acid probe, the metal or metal isotope label, the solid-phase support, and other reagents or devices used in conjunction with the nucleic acid quantitative detection method.

[0052] In some implementations, the product includes, but is not limited to, reagents, kits, detection chips, or detection systems.

[0053] This invention constructs a novel nucleic acid signal amplification strategy based on metal isotope labeling and CHA cascade amplification, successfully achieving sensitive detection and absolute quantitative analysis of HPV viral biomarkers HPV-16 and HPV-18. The nucleic acid quantitative detection method includes:

[0054] A solid-phase probe complex is provided, comprising a solid support and a multi-stranded nucleic acid probe structure loaded on the solid support; the multi-stranded nucleic acid probe structure comprises three nucleic acid probes, wherein the three nucleic acid probes are respectively labeled with metal elements and / or metal isotopes that can be distinguished and detected by inductively coupled plasma mass spectrometry; the sample to be tested is brought into contact with two hairpin nucleic acid probes; when the sample to be tested contains a first human papillomavirus subtype nucleic acid, the first human papillomavirus subtype nucleic acid initiates a catalytic hairpin assembly reaction to form a catalytic hairpin assembly product that can participate in subsequent chain displacement reactions; the resulting reaction system, the second human papillomavirus subtype nucleic acid in the sample to be tested, and the hairpin nucleic acid are then brought into contact with the hairpin nucleic acid probes. The solid-phase probe complex contacts the catalytic hairpin assembly product and the second human papillomavirus (HPV) subtype nucleic acid, which sequentially or synergistically trigger at least two-stage chain displacement reactions in the multi-stranded nucleic acid probe structure, allowing the metal-labeled or metal isotope-labeled nucleic acid probes corresponding to the first and second HPV subtype nucleic acids to enter the liquid phase. The solid-phase support is then separated from the liquid phase, and inductively coupled plasma mass spectrometry (ICP-MS) is used to detect multiple metal element signals and / or metal isotope signals in the liquid phase. Based on the different metal element signals and / or metal isotope signals, the content of the first and second HPV subtype nucleic acids in the sample to be tested is determined.

[0055] The proposed detection method exhibits an extremely wide linear range for detecting human papillomavirus (HPV) subtype nucleic acids, ranging from approximately 5 pM to 30,000 pM, with a detection limit as low as the pM level. Furthermore, in spiked recovery analysis of actual human serum samples, the recoveries for HPV-16 and HPV-18 ranged from 92.6% to 108.8%, with relative standard deviations (RSDs) of 0.08% to 9.3%. When combined with isotope dilution analysis of serum samples, the recovery rates ranged from 93.3% to 107.5%, with RSDs between 3.4% and 9.9%. This validates the ability of the constructed detection method to quantify multiplex HPV subtype nucleic acids and to perform absolute quantification, providing technical support for the development of next-generation standard methods for absolute nucleic acid quantification. Attached Figure Description

[0056] Figure 1 A schematic diagram illustrating the strategy of quantifying multiple HPV viruses using nucleic acid signal amplification.

[0057] Figure 2 The MALDI-TOF-MS detection results after labeling three DNA strands with lanthanides are shown. Where a represents HA1-DOTA- 155 b is the MALDI-TOF-MS detection result of Gd; c is the MALDI-TOF-MS detection result of HA2-DOTA-Tb; and c is the MALDI-TOF-MS detection result of HA3-DOTA-Gd.

[0058] Figure 3 This demonstrates MMA-DOTA and its relationship with Ln. 3+ ESI-MS characterization results of chelation. Where a is the ESI-MS spectrum of MMA-DOTA; MMA-DOTA, ESI-MS, m / z, experimental value: 525.2 ([MH)). - ); Calculated value: 525.5 ([MH]) - b is MMA-DOTA- 155 Gd's ESI-MS spectrum; MMA-DOTA- 155 Gd, ESI-MS, m / z, experimental value: 677.1 ([MH]) - ); Calculated value: 677.4 ([MH]) - c represents the ESI-MS spectrum of MMA-DOTA-Tb; MMA-DOTA-Tb, ESI-MS, m / z, experimental value: 681.1 ([M+H]). + ); Calculated value: 681.1 ([M+H] + ). d represents the ESI-MS spectrum of MMA-DOTA-Gd; MMA-DOTA-Gd, ESI-MS, m / z, experimental value: 680.1 ([MH]) -); Calculated value: 679.7 ([MH]) - ).

[0059] Figure 4 The characterization and feasibility verification results of the nucleic acid amplification strategy are shown. Specifically, a) shows the zeta potential detection results of MBs and MBs-L3; b) shows the zeta potential detection results of MBs and MBs-L3 in three tests; c) shows the gel electrophoresis results, where lane 1: DNA marker, lane 2: 2.4 μM HPV-16, lane 3: 2.4 μM H1, lane 4: 2.4 μM H2, lane 5: 2.4 μM hairpin H1, lane 6: 2.4 μM hairpin H2, lane 7: 2 μM hairpin H1 + 2 μM hairpin H2, lane 8: 2 μM hairpin H1 + 2 μM hairpin H2 + 0.2 μM HPV-16; d) shows the simultaneous detection of different concentrations of HPV-16 and HPV-18 based on ICP-MS.

[0060] Figure 5 The results of the optimized experimental conditions for the detection method are shown. Specifically, a represents the optimized results for the H1 and H2 content; b represents the optimized results for the amount of magnetic beads used; c represents the optimized results for the reaction temperature of CHA; and d represents the optimized results for the reaction time.

[0061] Figure 6 The analytical performance of the detection method is shown. In this diagram, a represents the signal response detection results for different concentrations of HPV-16; b represents the signal response detection results for different concentrations of HPV-18. a and b show the linear fitting curves between the ICP-MS signal intensity and the logarithm of different HPV concentrations. Error bars represent the standard deviation of three independent measurements. c and d represent the specificity detection results for HPV-16 (c) and HPV-18 (d), respectively, where the concentrations of HPV-16 and HPV-18 are 2 nM and 5 nM, respectively, while the concentrations of SM, TM, NC1, and NC2 are the same as the target analyte concentrations.

[0062] Figure 7 This is a schematic diagram of isotope analysis. Detailed Implementation

[0063] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and accompanying drawings.

[0064] Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.

[0065] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0066] Unless the context clearly indicates otherwise, the terms “a” and “an” as used herein include plural references. For example, reference to “a cell” includes multiple such cells and equivalents known to those skilled in the art, etc.

[0067] The numerical ranges used in this article should be understood as including all numbers within that range. For example, the range 1 to 20 should be understood to include any number, combination of numbers, or subrange from the following group: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0068] As used herein, the term "comprising" or "including" means "including, but not limited to." This term is intended to be open-ended to specify the presence of any of the stated features, elements, integers, steps, or components, but does not exclude the presence or addition of one or more other features, elements, integers, steps, components, or groups thereof. Therefore, the term "comprising" includes the more restrictive terms "consisting of" and "substantially consisting of." In one embodiment, the term "comprising" as used throughout the application, particularly in the claims, may be replaced by the term "consisting of."

[0069] As used herein, the terms “optional,” “any,” “arbitrary,” or “any one” mean that the event or situation subsequently described may, but does not have to, occur, including the circumstances in which the event or situation occurs or does not occur. As used herein, “an” and “a” refer to one or more grammatical objects.

[0070] The term “and / or” as used herein should be understood to mean any one of the options or any combination of two or more of the options.

[0071] Experimental methods and materials: (1) The reagents and materials involved in this invention Shanghai Sangon Biotech Co., Ltd. (Shanghai, China) provided 2 M tris(hydroxymethyl)aminomethane (Tris-HCl) solution, tris(2-carboxyethyl)phosphine hydrochloride (TCEP), 12% pre-prepared GLgel TBE PAGE gel (15 wells), ethylenediaminetetraacetic acid (EDTA), 10×PBS buffer solution, 5 M NaCl solution, and DEPC-treated water. Streptavidin-modified magnetic microspheres (Dynabeads™ M-280 Streptavidin, product number 11206D) were purchased from Thermo Fisher Scientific (USA). 1,4,7,10-tetraazacyclododecane-1,4,7-triacetic acid-10-maleimide ethylacetamide (MMA-DOTA, product number B-272) was purchased from Macrocyclics (USA). Gadolinium(III) chloride hexahydrate (GdCl3·6H2O) and terbium(III) chloride hexahydrate (TbCl3·6H2O) were purchased from Shanghai Titan Technology Co., Ltd. (Shanghai, China). 155 Gd-enriched Gd₂O₃ was provided by the National Institute of Metrology, China. Ammonium acetate (NH₄Ac), acetic acid (HOAc), hydrochloric acid (HCl), sodium hydroxide (NaOH), and nitric acid (HNO₃) were purchased from Chengdu Kelong Chemical Reagent Factory (Chengdu, China). Ultrapure water (UPW, 18.2 MΩ·cm) -1 The water was prepared using a Milli-Q Integral water purifier. Penicillin-streptomycin solution and 0.25% trypsin-0.53 mM EDTA were purchased from Thermo Fisher Scientific (USA). Clinical serum samples were provided by the Seventh People's Hospital of Chengdu.

[0072] The buffer solution formula used is as follows: a) NH4AC buffer solution: 0.5 M NH4AC, pH 5.8; b) PBS buffer solution: 1.37 M NaCl, 26.83 mM KCl, 81 mM Na2HPO4, 17.6 mM KH2PO4, pH 7.4; c) TNM buffer solution: 10 mM Tris-HCl, 100 mM NaCl, 10 mM Mg 2+ pH 7.4; d) TNM 5 buffer solution: 10 mM Tris-HCl, 500 mM NaCl, 10 mM Mg 2+ pH 7.4; e) Solution A: 0.1 M NaOH, 0.05 M NaCl; f) Solution B: 0.1 M NaCl; g) B&W buffer solution: 5 mM Tris-HCl, 1 M NaCl, 0.5 mM EDTA, pH 7.4; h) 2×B&W buffer solution: 10 mM Tris-HCl, 2 M NaCl, 1 mM EDTA, pH 7.4.

[0073] (2) The instruments and equipment involved in this invention This invention utilized a PerkinElmer NexION 350 inductively coupled plasma mass spectrometer, the optimized parameters of which are summarized in Table S2. The formation experiments of the H1 and H2 hairpin structures and the triple-stranded DNA structure (L3) were performed on a K960 thermal cycler (Heal Force Inc., China). Electrospray ionization mass spectrometry (ESI-MS) data were recorded using a TSQ QuantumUltra liquid chromatography-mass spectrometry system (Thermo Fisher Scientific, Inc., USA). Elementally labeled substrates were characterized using AXIMA Performance matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF-MS, Shimadzu, Japan). Zeta potential measurements were performed using a Zetasizer Nano ZS nanoparticle size and zeta potential analyzer (Malvin Panaco, UK).

[0074] (3) The nucleic acid sequence used for HPV detection in this invention is shown in Table 1.

[0075] Table 1 Nucleic acid sequences used for HPV detection H1 SEQ ID NO: 1 TGGGGTCAGGTAAATGTATTCTCCACTTCCGCAAAGAATACATTTACC / H2 SEQ ID NO: 2 ATGTATTCTTTGCGGAAGTGGAGAATACATTTACCCACTTCCGCAACTCTCCACAA / HPV-16 SEQ ID NO: 3 AGAATACATTTACCTGACCCCA / HPV-18 SEQ ID NO: 4 GAAGATGGTGATATGGTAGATA / HA1 SEQ ID NO: 5 TTTTTTTTTTTTTTTATCTACCATATCACCATCTTCTTGTGGAGAGTTGCGGAAGTGGTTTTT 5'-Biotin; 3'-SH HA2 SEQ ID NO: 6 ACTCTCCACAAGAAGATGGTTTTT 3'-SH HA3 SEQ ID NO: 7 TGATATGGTAGATATTTTT 3'-SH SM-16 SEQ ID NO: 8 AGAATACATTTACCTGATCCCA / TM-16 SEQ ID NO: 9 AGAATACATTAACCTGATTCCA / SM-18 SEQ ID NO: 10 GAAGCTGGTGATATGGTAGATA / TM-18 SEQ ID NO: 11 GAATCTGGTGACATGGTAGATA / (4) The experimental method involved in this invention 1. Zeta potential analysis MB-L3 and MB were diluted with water to appropriate concentrations and analyzed using a Zetasizer Nano ZS (Marvin Panaco, UK). All measurements were performed at 25°C.

[0076] 2. Polyacrylamide gel electrophoresis (PAGE) Each DNA sample was prepared to approximately 4 μM concentration and mixed with 6× loading buffer. The successful occurrence of the CHA reaction was verified using 12% non-denaturing polyacrylamide gel electrophoresis (PAGE). This experiment was performed in standard 1× TBE buffer, with electrophoresis first at 70V for 35 minutes at room temperature, followed by constant voltage electrophoresis at 90V for 32 minutes. Finally, the gels were imaged using Fluorchem M.

[0077] 3. MALDI-TOF-MS 3-Hydroxypyridine acid (3-HPA) was used as the matrix solution in the assay. After mixing the sample with an equal volume of matrix solution, 2 µL of the mixture was dropped onto the target plate and allowed to air dry at room temperature. Finally, the assay was performed using MALDI-TOF-MS (Shimadzu, Japan) in linear mode.

[0078] 4. DNA strand labeling HA1 was dissolved in 0.5 M NH4Ac at pH 5.6 to a final concentration of 100 µM. 20 µL of the dissolved HA1 was then mixed with excess TCEP and incubated at 37°C for 30 min to reduce disulfide bonds in the DNA strand. The mixture was then purified three times using ultrafiltration to remove excess TCEP. Simultaneously, 5 mM MMA-DOTA and 10 mM... 155 Gd-enriched GdCl3 was mixed and incubated at 37°C for 1 hour. After the reaction was complete, an appropriate amount of 10 mM EDTA was added, and the reaction was continued for another 15 minutes to neutralize excess EDTA. 155 Gd-enriched GdCl3. Then, HA1 after reducing ultrafiltration was added to the system, and the reaction was continued for 2 hours. The solution after the reaction was completed was purified 8 times with ultrafiltration tubes, and finally the formed HA1-MMA-DOTA- was purified with TNM buffer. 155 The Gd solution was diluted to 6 µM for later use. The formation steps of HA2-MMA-DOTA-Tb and HA3-MMA-DOTA-Gd are the same as above.

[0079] 5. Formation and fixation of the DNA triple helix structure Equal volumes of lanthanide-labeled solutions HA1, HA2, and HA3 were mixed and annealed in a PCR instrument. The annealing program was 95°C for 10 min, followed by slow cooling to 25°C and holding for 1 hour. The resulting triplet structure (L3) was stored at 4°C. 50 µL of 10 mg / mL magnetic microspheres (MBs) were washed sequentially with solution A, 0.1 M NaCl, and B&W buffer, then reconstituted with 2×B&W buffer to a final volume of 100 µL. The prepared L3 was then added to each, and the mixture was reacted at 25°C with shaking for 1 hour. The successfully prepared MBs-L3 was washed at least 5 times with TNM 5 buffer to remove excess L3 and reduce experimental background, and finally diluted to 50 µL for later use.

[0080] 6. ICP-MS detection First, the annealed hairpins H1 and H2 were reacted with a certain concentration of HPV-16 at 32℃ with shaking for 1.5 h. The annealing procedure for H1 and H2 was the same as that for L3 formation. Then, the resulting solution was mixed with a certain concentration of HPV-18 and 10 µL of MBs-L3 in a PCR tube, for a total volume of 100 µL. The sample was then incubated at 37℃ with shaking for 2.5 h to perform a double-strand displacement reaction, releasing lanthanide ions. After the reaction, magnetic separation was performed, and the collected supernatant was dispersed in 500 µL of 1% HNO3. Finally, ICP-MS mass spectrometry was performed. The specific steps of ICP-MS mass spectrometry are as follows: After igniting the ICP-MS instrument, 2% HNO3 was used as the washing buffer for 5 min, while selecting the isotope to be measured. Then, the blank signal of 2% HNO3 was measured to subtract the background signal. The supernatant dispersed in 500 µL of 1% HNO3 was then directly injected for detection.

[0081] The operating parameters of ICP-MS are shown in Table 2.

[0082] Table 2 ICP-MS Operating Parameters Vacuum pressure (Torr) <![CDATA[3.50×10 -7 ]]> ICP RF power (W) 1300 Atomizer gas flow rate (L / min) 0.94 Auxiliary gas flow rate (L / min) 1.2 Plasma gas flow rate (L / min) 18 Sample injection rate (L / min) 0.25 Dwell time (ms) 50 Dead time (ns) 35 Number of scans per reading 120 Measuring isotopes <![CDATA[ 159 Tb, 158 Gd, 157 Gd, 155 Gd]]> in, 159 Tb is used for relative quantification of HPV-16; 158 Gd is used for the relative quantification of HPV-18; 155 Gd was used as an isotope dilution internal standard for the absolute quantification of HPV-18. 157 Gd was used as a reference isotope, and measurements were performed... 155 Gd / 157 The Gd ratio is used for absolute quantification of HPV-18. Note: 157 Gd and 158 Both Gd isotopes are labeled on HA3. Both are stable isotopes inherent in natural gadolinium (Gd). They coexist in natural Gd, differing only in their natural abundance. 159 Tb is natural Tb, labeled in HA2. 155 Gd is used as an internal standard and is marked on HA1.

[0083] Example 1 Characterization and Feasibility of Nucleic Acid Amplification Strategy The design principle of the nucleic acid signal amplification strategy of this invention is as follows: Figure 1 As shown.

[0084] Based on cascade amplification reactions using lanthanide metal labeling and catalytic hairpin assembly, combined with the multi-input signal processing capabilities of ICP-MS, this invention constructs a nucleic acid quantitative detection method capable of detecting and absolutely quantifying HPV virus. First, lanthanide elements... 155Gd, Tb, and Gd label the three DNA strands HA1, HA2, and HA3, respectively. Figure 1 a and Figure 2 After annealing and cooling, a triple-chain structure L3 was formed and loaded onto MBs via non-covalent bonds formed by streptavidin and biotin. Then, the signal of a single HPV-16 was amplified into multiple H2 signals using a CHA reaction, and the presence of HPV-18 was converted into a measurable signal via a chain substitution reaction. 158 After the reaction, magnetic separation was performed and the supernatant was collected. The supernatant was then diluted and quantitatively analyzed by ICP-MS for lanthanides. Furthermore, artificially enriched lanthanides were labeled on the HA1 chain. 155 Gd was measured using isotopic dilution and ICP-MS. 155 Gd and 157 The ratio of Gd (r155 / 157) can achieve absolute quantification of the analyte HPV-18. Figure 1 (b).

[0085] Characterization of nucleic acid amplification strategies.

[0086] Successfully chelating MMA-DOTA with lanthanides is a crucial step in achieving DNA labeling. First, the chelation results of lanthanides and MMA-DOTA were characterized and validated using ESI-MS. The characterization results of MMA-DOTA are as follows: Figure 3 As shown in Figure a, a [MH]- peak at 525.2 ppm was observed. The theoretical molecular weight of MMA-DOTA is 526.5 ppm, and the experimental results are consistent with the theoretical results. In negative ion mode, MMA-DOTA- 155 The calculated molecular weight of Gd is 677.4. Figure 3 In b, the value of [MH]- can be observed to be 677.1, which is basically consistent with the theoretical value and the measured value, indicating that MMA-DOTA has successfully... 155 GdCl3 forms MMA-DOTA- 155 Gd complexes. Similarly, from Figure 3 As can be seen from c, in negative ion mode, the theoretical molecular weight of MMA-DOTA-Tb and the measured molecular weight are 681.1 and 681.1, respectively; Figure 3 As can be seen from the data, in negative ion mode, the theoretical molecular weight and the measured molecular weight of MMA-DOTA-Gd are 679.7 and 680.1, respectively. The theoretical values ​​and the measured values ​​are consistent, indicating that the MMA-DOTA-Tb and MMA-DOTA-Gd chelates were successfully synthesized.

[0087] Loading lanthanide-labeled triple-stranded structures onto magnetic beads is fundamental for the separation step after the reaction. Zeta potential experiments were used to characterize the loading of L3 on the magnetic beads. Without DNA loading, the surface of the magnetic beads is positively charged, while the DNA, composed of a phosphate backbone, is negatively charged. Therefore, when DNA is loaded onto the surface of the magnetic beads, the surface charge changes from positive to negative. Figure 4 As can be seen from a, after washing the product from the reaction of L3 and MBs, Zeta potential analysis yielded results consistent with theoretical analysis, showing that the surface charge of the magnetic beads changed from positive to negative. Figure 4 Figure b shows the results of three parallel tests of the Zeta potential experiment, indicating that DNA labeled with lanthanides was successfully modified on the surface of the magnetic beads.

[0088] Feasibility of nucleic acid quantitative detection methods. Using DNA fragments from HPV-16 and HPV-18 as model targets, a multiplex nucleic acid signal amplification strategy was developed and validated to demonstrate its ability to perform simultaneous multiplex detection. Specifically, DNA probes were immobilized on magnetic beads, and then the analyte was added to the solution. After the reaction between the DNA probe and the target analyte was completed, 159 Tb and 158 Gd was released into the supernatant, and after magnetic separation, the supernatant was diluted by a certain factor. Finally, quantitative detection was performed by ICP-MS. First, the progress of the CHA reaction was verified by gel electrophoresis. Figure 4 c). The results showed that in the absence of the target (HPV-16), the hairpin structures (H1 and H2) remained intact, and very few nonspecific interactions were observed in the blank group. This demonstrates the specificity of the CHA reaction, thus supporting the feasibility of the nucleic acid quantification method. Furthermore, the detected elemental content increased proportionally with the concentration of the target, indicating that higher target levels promoted the release of DNA strands from the magnetic beads. This correlation confirms the feasibility of quantifying the target based on the elemental content in the supernatant. Figure 4 d).

[0089] Example 2: Optimization of Experimental Conditions To further enhance the analytical performance of isotope-based nucleic acid amplification strategies for quantifying multicomponent HPV viruses, it is necessary to optimize key influencing factors in the experiment. Building upon previous research, we systematically optimized critical factors affecting the CHA reaction, including the amounts of H1 and H2 added, the amount of magnetic beads used, and the temperature and time of the CHA reaction. These optimizations aim to maximize signal amplification efficiency while minimizing nonspecific background, thereby improving the sensitivity and accuracy of the multiplex HPV quantification platform.

[0090] 2.1 Contents of H1 and H2 In the catalytic hairpin assembly reaction, the ratio between the two hairpins and the target analyte determines the amplification factor of the hairpins. Theoretically, a higher ratio of hairpin content to HPV-16 content indicates a greater amplification factor and higher detection sensitivity; however, a higher ratio will also lead to a larger blank signal in the system. Conversely, a ratio that is too low will result in insufficient amplification. Therefore, the content of hairpins H1 and H2 is a factor that needs to be optimized.

[0091] First, hairpin additions of 5 µL, 10 µL, 15 µL, 20 µL, and 25 µL were set to explore the optimal experimental conditions. Other experimental conditions were kept constant: magnetic bead volume 1 µL, CHA reaction temperature 32℃, and CHA reaction time 90 min. Figure 5 As can be seen from graph 'a', the blank value increases with the increase of hairpin addition, and the signal-to-noise ratio (S / N) reaches its maximum when the hairpin addition is 10 µL. Therefore, 10 µL is chosen as the hairpin content to balance amplification efficiency and background suppression effect.

[0092] 2.2 Amount of magnetic beads used In this system, quantification is based on the elemental content in the supernatant, requiring a relatively large total elemental signal. Therefore, the amount of MBs used was re-optimized. MBs dosages of 0.5 µL, 0.75 µL, 1 µL, 1.25 µL, and 1.5 µL were set. Other experimental conditions were fixed as follows: total volume of H1 and H2 10 µL, CHA reaction temperature 32℃, and CHA reaction time 90 min. The results are as follows... Figure 5 As shown in Figure b, when the amount of MBs added increases from 0.5 µL to 1.5 µL, the elemental signals detected in the supernatant gradually increase, and the blank signal value also increases accordingly. The highest signal-to-noise ratio is obtained when the amount added is 1 µL. Therefore, the amount of MBs added is chosen to be 1 µL.

[0093] 2.3 CHA reaction temperature Higher reaction temperatures lead to faster DNA binding and higher reaction efficiency, while lower temperatures result in lower efficiency and are less conducive to DNA strand substitution. However, for catalytic hairpin assembly experiments, excessively high reaction temperatures can open the hairpin structure, resulting in a large blank value. Therefore, the temperature of the CHA reaction needs to be optimized. Reaction temperatures of 18℃, 25℃, 32℃, 37℃, and 42℃ were set. Other experimental conditions were fixed as follows: total volume of H1 and H2 10 µL, magnetic bead volume 1 µL, and CHA reaction time 90 min. The results are as follows: Figure 5As shown in Figure c, the detected elemental signals gradually increase with increasing temperature, indicating that the higher the temperature, the greater the DNA strand displacement efficiency and the greater the content of elements released into the supernatant. The signal-to-noise ratio reaches its maximum at 32℃. Therefore, 32℃ was chosen as the reaction temperature for the catalytic hairpin assembly experiment.

[0094] 2.4 CHA reaction time To ensure complete CHA reaction, reaction time was a crucial factor to optimize. 30 min, 60 min, 90 min, 120 min, and 150 min were set as optimal reaction times. Other experimental conditions were fixed as follows: H1 and H2 concentrations of 10 µL, magnetic bead dosage of 1 µL, and CHA reaction temperature of 32℃. The results are as follows... Figure 5 As shown in d, the optimal signal-to-noise ratio is achieved at a reaction time of 90 min. Therefore, 90 min was chosen as the reaction time for catalytic hairpin assembly.

[0095] 2.5 Analytical Performance After optimizing the influencing factors of this quantitative detection method, the optimal reaction conditions were obtained. Next, under these optimal reaction conditions, the analytical performance of this method for detecting multiple target DNAs was investigated. The signal values ​​of elements in the supernatant of samples reacted with different concentrations of target analytes were tested, and the experimental results are as follows: Figure 6 As shown in figures a and b, with increasing amounts of HPV-16 and HPV-18 added, the levels detected by ICP-MS... 158 Gd, 159 The Tb signal value increases.

[0096] The obtained 159 A linear fit was performed between the Tb signal value and the HPV-16 concentration, such as... Figure 6 As shown in Figure a, a good linear-logarithmic relationship was observed in the concentration range of 5 pM to 30000 pM, with the linear equation being y = 1715lgx + 224 (where y is...). 159 The ICP-MS signal intensity of Tb, where x is the concentration of HPV-16, and the square of the correlation coefficient R. 2 The value was 0.988, and the limit of detection (LOD, 3σ / k) was 1.6 pM. The obtained... 158 Linear fitting was performed between Gd signal intensity and HPV-18 concentration, such as... Figure 6 As shown in b, a good linear-logarithmic relationship was observed in the concentration range of 50 pM to 30000 pM, with the linear equation being y = 713lgx + 119 (where y is...). 158 The ICP-MS signal intensity of Gd, where x is the concentration of HPV-16, and the square of the correlation coefficient R 2The limit of detection (LOD, 3σ / k) was 0.996, and the limit of detection (LOD) was 2.7 pM. Table 3 shows the analytical performance of the constructed nucleic acid quantitative detection method. By comparing the differences in detection linearity and LOD of the proposed detection method for the two target analytes, it can be seen that the detection performance of this method for HPV-16 is better than that for HPV-18. This is attributed to the addition of CHA, indicating that the catalytic hairpin assembly reaction improves the detection sensitivity of the target analytes.

[0097] Table 3 Analytical performance of nucleic acid signal amplification strategies HPV-16 y = 1715lgx + 224 5 pM ~ 30000 pM 1.6 pM 0.988 HPV-18 y=713lgx+119 50 pM~30000 pM 2.7 pM 0.996 2.6 Specificity of Nucleic Acid Quantitative Detection Methods DNA undergoes semi-conservative replication using helicase, DNA polymerase, and other substances. During replication, the two strands of the parental DNA unwind, with each strand serving as a template to synthesize a new complementary strand according to the base pairing principle. During this process, single-base or multi-base mutations can occur, resulting in many similar fragments within the organism. Therefore, this invention prepared a sequence SM with a one-base mismatch with the target, a sequence TM with a three-base mismatch, and random sequences NC1 and NC2 to conduct specificity verification experiments for the constructed strategy. The experimental results are as follows: Figure 6 As shown in c and d, the signal intensities of samples SM, TM, NC1, and NC2 are not significantly different from the blank values, while the elemental signal intensity of the target analyte is greatly enhanced. This fully demonstrates that the signal amplification strategy constructed in this invention has high selectivity in DNA detection and can effectively analyze the target analyte.

[0098] Example 3: Application of quantitative detection methods in actual sample testing The proposed method for quantitative detection of multiple HPV viruses using isotope dilution was investigated in a spiked recovery experiment on human serum samples to explore its potential in practical sample detection.

[0099] Serum samples were centrifuged to remove impurities, diluted 100-fold, and then different concentrations of the target analyte were added. The reaction was carried out according to the above steps. After the reaction was completed, the elemental signal values ​​in the supernatant were detected, and the sample recovery rate was calculated. The results are shown in Table 4. After adding small, medium, and large concentrations of spikes, the recovery rates of all samples ranged from 92.6% to 108.8%, and the relative standard deviations (RSDs) ranged from 0.08% to 9.3%. The spiked recovery experiment in serum samples demonstrates that the proposed signal amplification strategy can effectively analyze real samples and has certain application potential in multiplex analysis.

[0100] Table 4. Spike recovery experiments of serum samples 3.1 Isotope dilution method Quantitative verification analysis was performed using the isotope dilution method. In the analysis of actual samples, the target analyte was quantified by detecting the elemental content released into the supernatant using ICP-MS. The magnetic beads remaining in the sample contained artificially enriched [elements / materials]. 155 Gd element was used as an internal standard. After the magnetic beads were completely digested with 20% HNO3, they could be used for isotope dilution analysis. Figure 7 The results are shown in Table 5. After adding different concentrations of HPV-18, the recovery rates of the samples were 93.3% to 107.5%, and the RSDs were between 3.4% and 9.9%. The spiked recovery verification experiment of isotope analysis showed that the proposed quantitative detection method can achieve dual-response detection of the samples: (1) relative quantification of HPV-18 by standard curve; (2) absolute quantification of the actual content by isotope dilution formula (Formula 1). This dual detection capability reduces the probability of false positives.

[0101] Formula 1: .

[0102] In the formula, This refers to the HA1 content quantified by ICP-MS. It is an enrichment of isotopes 155 The relative atomic weight of Gd is 154.98. This is the relative atomic weight of Gd, 157.25; It is an enrichment of isotopes 155 The abundance of Gd with a mass number of 155 was 90.2%. It is an enrichment of isotopes 155 The abundance of Gd with a mass number of 157 was 0.86%. It is a natural Gd 155 The abundance of Gd mass number was 14.8%. It is a natural Gd 157 The abundance of Gd mass number was 15.65%. It is the measurement ratio of 155 / 157.

[0103] Table 5. Isotope dilution analysis in serum samples It should be noted that, since the steps and methods used are the same as in the embodiments, preferred embodiments are described in this invention to avoid redundancy. Although preferred embodiments of the present invention have been described, those skilled in the art, once they understand the inventive concept of the present invention, can make other changes and modifications to these embodiments, and all such changes and modifications fall within the scope of the present invention.

[0104] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. If such modifications and variations fall within the scope of equivalents of this invention, then this invention also intends to include these modifications and variations.

Claims

1. A method for quantitative detection of multiple human papillomavirus subtypes based on metal element and isotope labeling and catalytic hairpin assembly, characterized in that, Includes the following steps: (1) A solid-phase probe complex is provided, the solid-phase probe complex comprising a solid-phase support and a multi-stranded nucleic acid probe structure loaded on the solid-phase support; the multi-stranded nucleic acid probe structure comprises three nucleic acid probes, wherein the three nucleic acid probes are respectively labeled with a metal element and / or a metal isotope. (2) The sample to be tested is brought into contact with two hairpin nucleic acid probes; when the sample to be tested contains the first human papillomavirus subtype nucleic acid, the first human papillomavirus subtype nucleic acid initiates the catalytic hairpin assembly reaction to form the catalytic hairpin assembly product; (3) The catalytic hairpin assembly product and the second human papillomavirus subtype nucleic acid in the sample to be tested are brought into contact with the solid-phase probe complex; the catalytic hairpin assembly product and the second human papillomavirus subtype nucleic acid sequentially or synergistically initiate at least two-stage chain displacement reactions in the multi-strand nucleic acid probe structure, so that the metal element-labeled or metal isotope-labeled nucleic acid probes corresponding to the first human papillomavirus subtype nucleic acid and the second human papillomavirus subtype nucleic acid respectively enter the liquid phase; (4) Separate the solid support from the liquid phase, use inductively coupled plasma mass spectrometry to detect multiple metal element labeling signals and / or metal isotope labeling signals in the liquid phase, and determine the content of the first human papillomavirus subtype nucleic acid and the second human papillomavirus subtype nucleic acid in the sample to be tested according to the different metal element labeling signals and / or metal isotope labeling signals.

2. The method according to claim 1, characterized in that, The first human papillomavirus subtype nucleic acid is HPV-16 nucleic acid, and the second human papillomavirus subtype nucleic acid is HPV-18 nucleic acid; and / or The metal element label and / or metal isotope label are linked to the multi-stranded nucleic acid probe structure via a bifunctional linker molecule containing a metal chelating group; and / or The multi-stranded nucleic acid probe structure includes a first nucleic acid probe HA1, a second nucleic acid probe HA2, and a third nucleic acid probe HA3; and / or The hairpin nucleic acid probe includes a first hairpin nucleic acid probe H1 and a second hairpin nucleic acid probe H2; H1 contains a first fulcrum, and H2 contains a second fulcrum; in the absence of a first human papillomavirus (HPV) subtype nucleic acid, H1 and H2 maintain the hairpin structure through intra-strand complementary pairing and mask the inter-strand complementary regions between them; in the presence of a first HPV subtype nucleic acid, the first HPV subtype nucleic acid opens H1 through a strand displacement reaction mediated by the first fulcrum, and the opened H1 further opens H2 through a strand displacement reaction mediated by the second fulcrum. H1 and H2 form an assembly product, displacing and releasing the first HPV subtype nucleic acid, allowing the first HPV subtype nucleic acid to cycle and initiate subsequent catalytic hairpin assembly reactions; and / or The catalytic hairpin assembly product initiates a first-stage chain displacement reaction, causing HA2 or a portion thereof to dissociate from the triple-stranded nucleic acid probe structure L3; the second human papillomavirus subtype nucleic acid initiates a second-stage chain displacement reaction, causing HA3 or a portion thereof to dissociate from the triple-stranded nucleic acid probe structure L3; and / or The HA1 has 155 Gd-labeled, HA2 is Tb-labeled, and HA3 is Gd-labeled, wherein the Gd-labeled components comprise stable isotopes of varying abundance. 157 Gd and 158 Gd, the Tb label contains stable isotopes 159 Tb; and / or The first human papillomavirus (HPV) subtype nucleic acid corresponds to the metal element labeling signal of Tb, and the second HPV subtype nucleic acid corresponds to the metal element labeling signal of Gd; and / or In step (4), the relative content of at least one human papillomavirus subtype nucleic acid is determined by the standard curve method, and the absolute content of the second human papillomavirus subtype nucleic acid is determined by the isotope dilution method.

3. The method according to claim 1 or 2, characterized in that, The metal chelating group is selected from at least one of DOTA, DTPA, EDTA, NOTA, TETA and their derivatives; and / or The bifunctional linker molecule also includes a linker group capable of coupling with a thiol, amino, azide, or alkynyl group on the multi-stranded nucleic acid probe.

4. The method according to claim 3, characterized in that, The bifunctional linker molecule is DOTA-maleimide, and the nucleic acid probe is thiol-modified single-stranded DNA. After the DOTA-maleimide coordinates with metal ions, the maleimide group undergoes a coupling reaction with the thiol group on the single-stranded DNA to form a metal element-labeled nucleic acid probe or an isotope metal-labeled nucleic acid probe.

5. The method according to claim 4, characterized in that, At least one nucleic acid probe in the multi-stranded nucleic acid probe structure carries biotin, the surface of the solid support carries streptavidin, and the multi-stranded nucleic acid probe structure is immobilized on the solid support by the affinity interaction between biotin and streptavidin; and / or The solid support is selected from at least one of magnetic microspheres, magnetic nanoparticles, polymer microspheres, silica microspheres, metal oxide particles, membrane materials, microporous plates, and chip surfaces.

6. The method according to claim 5, characterized in that, The solid-phase support is a streptavidin-modified magnetic microsphere, and the solid-phase probe complex is a magnetic microsphere loaded with a triple-stranded nucleic acid probe structure L3.

7. The method according to any one of claims 4 to 6, characterized in that, The samples to be tested are derived from blood, serum, plasma, secretions, urine, saliva, tissue samples, or cell samples.

8. The detection method according to claim 7, characterized in that, The concentration of the first hairpin nucleic acid probe H1 and the second hairpin nucleic acid probe H2 is both 2 µM, and the total volume of the first hairpin nucleic acid probe H1 and the second hairpin nucleic acid probe H2 is 5 µL to 25 µL, wherein the volumes of the first hairpin nucleic acid probe H1 and the second hairpin nucleic acid probe H2 are the same; and / or The volume of the solid support is 0.5 µL to 1.5 µL; and / or The temperature for the catalytic hairpin assembly reaction is 18℃~42℃; and / or The time for the catalytic hairpin assembly reaction is 30 min to 150 min.

9. The method according to claim 8, characterized in that, The total volume of the first hairpin nucleic acid probe H1 and the second hairpin nucleic acid probe H2 is 10 µL; and / or The volume of the solid support is 1.0 µL; and / or The temperature of the catalytic hairpin assembly reaction is 32°C; and / or The time for the catalytic hairpin assembly reaction is 90 min.

10. The method according to claim 9, characterized in that, The nucleotide sequence of the first hairpin nucleic acid probe H1 is shown in SEQ ID NO: 1; The nucleotide sequence of the second hairpin nucleic acid probe H2 is shown in SEQ ID NO: 2; The nucleotide sequence of the first human papillomavirus subtype nucleic acid is shown in SEQ ID NO: 3; The nucleotide sequence of the second human papillomavirus subtype nucleic acid is shown in SEQ ID NO: 4; The nucleotide sequence of the first nucleic acid probe HA1 is shown in SEQ ID NO: 5; The nucleotide sequence of the second nucleic acid probe HA2 is shown in SEQ ID NO: 6; The nucleotide sequence of the third nucleic acid probe HA3 is shown in SEQ ID NO: 7.

Images