Microfluidic multiplex pet pathogen detection kit

Abstract

The application discloses a microfluidic multiplex pet pathogen detection kit, which comprises: a lower mixed solution A, which comprises 5X reaction buffer, 25X enzyme mixed solution, FPV-F forward primer, FPV-R reverse primer, FPV-P fluorescent probe, FeAstV-F forward primer, FeAstV-R reverse primer, FeAstV-P fluorescent probe, FBoV-F forward primer, FBoV-R reverse primer, FBoV-P fluorescent probe, internal reference DHIC07-F forward primer, internal reference DHIC07-R reverse primer and internal reference DHIC07 fluorescent probe; a middle liquid B, which comprises liquid paraffin, silicone oil and cleaning liquid; and an upper mixed solution C, which comprises a lysis solution, magnetic bead suspension and proteinase K; the lysis solution comprises guanidine isothiocyanate, PEG8000, isopropyl alcohol and Triton x-100. The multiplex primer probes are all optimized, and the amplification efficiencies of the target markers are balanced.

Description

Technical Field

[0001] This invention relates to the field of animal molecular diagnostics and microfluidics, and in particular to a microfluidic-based multiplex pet pathogen detection kit. Background Technology

[0002] The pet pathogen testing market is experiencing steady growth. With the continued increase in the global pet population and pet owners' growing awareness of animal health management, the demand for rapid and accurate pathogen diagnosis is becoming increasingly urgent. Currently, immunodiagnostics and molecular diagnostics are the main technological approaches in the pet pathogen testing market. Immunodiagnostics (such as lateral chromatography and ELISA) hold a significant market share in clinical veterinary settings due to their ease of operation and rapid results; while molecular diagnostics (represented by PCR technology), with its high sensitivity and specificity, is considered the "gold standard" for pathogen detection, and its market growth rate is significant.

[0003] However, existing testing methods still face numerous technical bottlenecks in practical applications. First, traditional nucleic acid testing procedures are complex, typically involving multiple independent steps such as sample pretreatment, nucleic acid extraction, and amplification system preparation. These procedures rely on professional personnel and laboratory infrastructure, making them difficult to implement immediately in grassroots veterinary clinics or on-site. Second, narrow sample compatibility is a significant drawback—some simplified direct amplification systems on the market are only suitable for swab samples and are incompatible with complex sample matrices such as feces, blood, and ascites, easily producing false negative results when faced with samples with high inhibitor content. Third, the throughput of existing molecular diagnostic systems for multiplex detection is limited. The number of optical channels in a quantitative PCR instrument typically restricts the number of targets detectable per tube, making it difficult to meet the clinical need for simultaneous identification of multiple pathogens. Furthermore, primer dimer formation and non-specific binding issues in multi-primer pool systems further limit the specificity and sensitivity of multiplex detection.

[0004] The aforementioned limitations have spurred the rapid development of POCT (point-of-care testing) technology in the field of pet pathogen detection. An ideal POCT solution for pet pathogens should have fully automated "sample in, result out" capabilities, integrate nucleic acid extraction and amplification detection, support multiplex testing, be compatible with universal extraction methods for various sample types, and complete the testing in a closed system to eliminate cross-contamination.

[0005] Microfluidic technology offers a feasible path to achieving these goals. By integrating magnetic bead-based nucleic acid extraction with TaqMan quantitative PCR amplification and detection into a single device, the entire process from sample lysis and nucleic acid purification to amplification and detection can be completed within a sealed cartridge, effectively reducing operational barriers and contamination risks. Existing research has shown that integrating microfluidic chips can achieve a fully integrated process of nucleic acid extraction and qPCR detection, with detection time controlled within 40 minutes; multi-target detection capabilities have also been validated in fields such as human respiratory pathogen detection. However, integrated reagent kits for the simultaneous detection of multiple common pet pathogens, combining compatibility with complex samples, high throughput for multiplex detection, and extremely simplified operation, still require further development and improvement.

[0006] Against this backdrop, we developed a kit for nucleic acid extraction based on microfluidic magnetic beads and TaqMan real-time PCR amplification and detection, enabling simultaneous, rapid, and accurate detection of multiple common pathogens in pets. This has significant clinical implications and market value.

[0007] The applicant previously filed an invention patent application with patent number 202311754018.6 for test tubes, and this application will reference the contents of that patent application. Summary of the Invention

[0008] This invention provides a microfluidic-based multiplex pet pathogen detection kit that can simultaneously detect multiple common pet pathogens.

[0009] Key points of protection in this application: 1. Primer and probe design: Primers and probes are designed for conserved sequences of various pathogens, including TaqMan probes, FAM, JOE, ROX, and CY5 fluorescent probes, and BHQ1 and BHQ2 as fluorescence quenching groups. Multiplex fluorescence and multiple differentiation are achieved, and there is no cross-reaction between them. All multiple primers and probes have been optimized to ensure balanced amplification efficiency among each target.

[0010] 2. Nucleic acid extraction and PCR amplification are integrated into a fully automated, sealed magnetically controlled test tube. Simply add the sample, and the instrument will automatically complete the entire process of nucleic acid extraction, PCR amplification, and result interpretation in just 40 minutes. The detection limit can reach 500 copies / mL. The silicone oil and paraffin are fully sealed to prevent contamination.

[0011] According to one aspect of this disclosure, a microfluidic-based multiplex pet pathogen detection kit is provided, the kit comprising: a lower layer mixture A, a middle layer liquid B, and an upper layer mixture C; The lower layer mixture A includes 5X reaction buffer, 25X enzyme mixture, feline panleukopenia virus FPV-F forward primer, feline panleukopenia virus FPV-R reverse primer, feline panleukopenia virus FPV-P fluorescent probe, feline astrovirus FeAstV-F forward primer, feline astrovirus FeAstV-R reverse primer, feline astrovirus FeAstV-P fluorescent probe, feline bocavirus FBoV-F forward primer, feline bocavirus FBoV-R reverse primer, feline bocavirus FBoV-P fluorescent probe, internal control DHIC07-F forward primer, internal control DHIC07-R reverse primer, and internal control DHIC07 fluorescent probe. The intermediate liquid B has three separate components, including liquid paraffin, silicone oil, and cleaning fluid; The upper mixture C includes lysis buffer, magnetic bead suspension, and proteinase K. The lysis buffer includes guanidine isothiocyanate, PEG 8000, isopropanol, and Tritonx-100. The magnetic bead suspension includes silanol-modified superparamagnetic beads; 5X reaction buffer contains: Tris-HCl (tris-hydroxymethylaminomethane hydrochloride), MgCl2, and KCl; The 25X enzyme mixture includes: RT enzyme and Taq enzyme.

[0012] In one possible implementation, the lower layer mixture A also includes a forward primer of the cat internal reference β-ACT actin gene DHIC07-F, a reverse primer of the cat internal reference β-ACT actin gene DHIC07-R, a cat internal reference β-ACT actin gene DHIC07 fluorescent probe, and the DHIC07-F forward primer, DHIC07-R reverse primer, and DHIC07 fluorescent probe as internal control controls to monitor experimental validity and avoid misinterpretation of results.

[0013] In one possible implementation, the fluorescent groups of the FPV fluorescent probe, FeAstV fluorescent probe, FBoV fluorescent probe, and internal control DHIC07 fluorescent probe are all different. The fluorescent group and quenching group connected to the FPV fluorescent probe are labeled as FAM / BHQ1, the fluorescent group and quenching group connected to the FeAstV fluorescent probe are labeled as ROX / BHQ2, the fluorescent group and quenching group connected to the FBoV fluorescent probe are labeled as CY5 / BHQ2, and the fluorescent group and quenching group of the internal control fluorescent probe are labeled as JOE / BHQ1. BHQ1 and BHQ2 are fluorescence quenching groups, exhibiting multiple fluorescence and multiple differentiation, and there is no cross-reaction between them.

[0014] In one possible implementation, the sequence of the FPV-F forward primer is as follows: GCTTGAGTTTGCTGTGATTTCC; The sequence of the FPV-R reverse primer is as follows: GGGTGTGGGGATTTCTACG; The sequence of the FPV-P fluorescent probe is as follows: CCGTTTTCCAAAAATTTAAATTCCGTC; The sequence of the FeAstV-F forward primer is as follows: AAAGAACTCCGCTGGAARATGAT; The sequence of the FeAstV-R reverse primer is as follows: GTTTAACAGGTTGTCMACATACCACT; The sequence of the FeAstV-P fluorescent probe is as follows: CAACAAAGARCAGCGTGAGAARTATGCA; The sequence of the FBoV-F forward primer is as follows: GTATCCACGATTTTATTCAATTCG; The sequence of the FBoV-R reverse primer is as follows: GCATAACGCAYTCTGGAGAGC; The sequence of the FBoV-P fluorescent probe is as follows: ATCCAGCATACACCTACGTGTTGCGTT.

[0015] In one possible implementation, the sequence of the DHIC07-F forward primer is as follows: CAGATCATGTTYGAGACCTTCAAC; The sequence of the DHIC07-R reverse primer is as follows: GAGTCCATCACGATGCCRGT; The sequence of the DHIC07 fluorescent probe is as follows: CCATGTACGTGGCCATCCAGGC.

[0016] In one possible implementation, the concentration of the FPV-F forward primer is 0.4-0.5 μM, the concentration of the FPV-R reverse primer is 0.4-0.5 μM, and the concentration of the FPV-P fluorescent probe is 0.4-0.5 μM. The concentration of the FeAstV-F forward primer is 0.2-0.3 μM; the concentration of the FeAstV-R reverse primer is 0.2-0.3 μM; and the concentration of the FeAstV-P fluorescent probe is 0.15-0.25 μM. The concentration of the FBoV-F reverse primer is 0.3-0.4 μM; the concentration of the FBoV-R fluorescent probe is 0.3-0.4 μM; and the concentration of the FBoV-P forward primer is 0.15-0.25 μM. The concentrations of the DHIC07-F forward primer and the DHIC07-R reverse primer are 0.2-0.3 μM, respectively, and the concentration of the DHIC07 fluorescent probe is 0.15-0.25 μM. 1 μM is equivalent to 10 -6 Moles per liter.

[0017] In one possible implementation, the concentration of the FPV-F forward primer is 0.45 μM, the concentration of the FPV-R reverse primer is 0.45 μM, and the concentration of the FPV-P fluorescent probe is 0.45 μM. The concentration of the FeAstV-F forward primer was 0.25 μM; the concentration of the FeAstV-R reverse primer was 0.25 μM; and the concentration of the FeAstV-P fluorescent probe was 0.2 μM. The concentration of the FBoV-F reverse primer was 0.35 μM; the concentration of the FBoV-R fluorescent probe was 0.35 μM; and the concentration of the FBoV-P forward primer was 0.2 μM. The concentrations of the DHIC07-F forward primer and the DHIC07-R reverse primer were 0.25 μM and 0.2 μM, respectively. The concentration of the DHIC07 fluorescent probe was 0.2 μM. 1 μM is equivalent to 10 -6 Moles per liter.

[0018] In one possible implementation, the kit further includes a positive control tube and a negative control tube, wherein the positive control tube is a positive plasmid pseudovirus standard and the negative control tube is an internal control plasmid pseudovirus standard.

[0019] Compared with the prior art, the beneficial effects of the present invention are: 1. The multiplex PCR POCT protocol can complete the entire process within 40 minutes.

[0020] 2. The fully automated closed testing system, which operates on a "sample in, result out" basis, requires no professional laboratory and is portable and flexible for deployment in scenarios such as pet hospitals, kennels, and even on-site testing.

[0021] 3. While pursuing speed, it can also achieve high sensitivity, enabling early detection of pathogens.

[0022] 4. Single-tube fully sealed design, completely eliminating contamination: The fully sealed packaging technology ensures that the entire extraction, purification, amplification, and detection process is completed within the sealed tube after sample addition, without any opening operations, thus avoiding cross-contamination between the environment and the sample; combined with the UNG enzyme + dUTP anti-contamination system within the system, it can effectively degrade residual amplification products caused by aerosols, solving the false positive problem at its source.

[0023] 5. Micro-magnetic control automation, extremely simple operation: The magnetic beads are driven by an external micro-magnetic control system for directional transfer, eliminating the need for centrifugation and manual pipetting, and the entire process is completed automatically; no professional molecular biology operators are required, greatly simplifying the operation steps and reducing the requirements for experimental sites and personnel.

[0024] 6. Stable detection performance through magnetic bead purification: Based on the principle of nucleic acid purification using silanol magnetic beads, the nucleic acid purity is high, the inhibitor residue is low, and it is highly adaptable to complex samples such as feces. Combined with the high specificity of TaqMan probes, the detection sensitivity and accuracy are significantly better than those of direct amplification. Attached Figure Description

[0025] Figure 1 A schematic diagram of a fully automated sealed magnetically controlled test tube structure according to an embodiment of the present disclosure is shown.

[0026] Figure 2 A schematic diagram showing the location of the amplification reaction chamber in a fully automated, sealed magnetically controlled test tube according to an embodiment of the present disclosure is provided.

[0027] Figure 3 This diagram illustrates the location of the cleaning and purification chamber in a fully automated, sealed, magnetically controlled test tube according to an embodiment of the present disclosure.

[0028] Figure 4 This diagram illustrates the location of the nucleic acid extraction chamber in a fully automated, sealed, magnetically controlled test tube according to an embodiment of the present disclosure.

[0029] Figure 5 This diagram illustrates the order of adding substances to the cleaning and purification chamber of a fully automated, sealed, magnetically controlled test tube according to an embodiment of the present disclosure, as well as the location of the inlet.

[0030] Figure 6 A flowchart illustrating the manufacturing process of a reagent kit according to an embodiment of this disclosure is shown.

[0031] Figure 7 A graph showing the optimization results of FPV primers according to an embodiment of this disclosure is provided.

[0032] Figure 8 A graph showing the optimization results of FeAs primers according to an embodiment of this disclosure is displayed.

[0033] Figure 9 A graph showing the optimization results of FBoV primers according to an embodiment of this disclosure is displayed.

[0034] Figure 10 A graph showing the optimization results of DHIC07 primers according to an embodiment of this disclosure is provided.

[0035] Figure 11 A graph showing the optimization results of an FPV probe according to an embodiment of this disclosure is provided.

[0036] Figure 12 A graph showing the optimization results of a FeAs probe according to an embodiment of this disclosure is provided.

[0037] Figure 13 A graph showing the optimization results of an FBoV probe according to an embodiment of this disclosure is provided.

[0038] Figure 14 A graph showing the optimization results of the DHIC07 probe according to an embodiment of this disclosure is provided. Detailed Implementation

[0039] Various exemplary embodiments, features, and aspects of this disclosure will now be described in detail with reference to the accompanying drawings. The same reference numerals in the drawings denote elements that have the same or similar functions. Although various aspects of the embodiments are shown in the drawings, they are not necessarily drawn to scale unless specifically indicated otherwise.

[0040] The term “exemplary” as used herein means “serving as an example, embodiment, or illustration.” Any embodiment illustrated herein as “exemplary” is not necessarily to be construed as superior to or better than other embodiments.

[0041] Furthermore, to better illustrate this disclosure, numerous specific details are set forth in the following detailed description. Those skilled in the art will understand that this disclosure can be practiced without certain specific details. In some instances, methods, means, components, and circuits well known to those skilled in the art have not been described in detail in order to highlight the main points of this disclosure.

[0042] I. Primer and probe screening experiment 1. Gene sequence acquisition and conserved region screening Nucleic acid sequences of the vp2 capsid protein gene of feline panleukopenia virus (FPV), the RdRp gene of feline astrovirus (FeAstV) RNA-dependent RNA polymerase, the NP1 gene of feline bocavirus (FBoV) non-structural protein, and the DHIC07 gene of feline internal reference β-ACT actin were downloaded from NCBI GenBank. Highly conserved regions with a mutation rate <5% were screened by multiple sequence alignment. Three sets of upstream and downstream primers + specific TaqMan probes were designed for each pathogen (TaqMan probes are dual-labeled oligonucleotide probes used for real-time quantitative PCR (qPCR)).

[0043] The fluorescent probe of FPV is labeled with the fluorescent group FAM, the fluorescent probe of FeAstV is labeled with the fluorescent group ROX, and the fluorescent probe of FBoV is labeled with the fluorescent group CY5.

[0044] 2. Experimental Design for Primer and Probe Initial Screening 1) Template preparation: Plasmids synthesized from the four target sequences were used as templates for screening primers and probes, and were uniformly diluted to 5×10⁻⁶. 7 copies / mL, 5×10 6 copies / mL, 5×10 5 copies / mL, 5×10 4 copies / mL, 5×10 3 copies / mL, 5×102 copies / mL, 5×10 1 copies / mL; 2) Initial screening reaction system (30μL): 6μL 5xBuffer, 0.5μL 0.2mM dNTPs, 0.4μM upstream and downstream of the primer to be screened, 0.2μM probe, 1μL Taq enzyme, 10μL template nucleic acid, and add nuclease-free water to 30μL.

[0045] 3) Keep warm at 95℃ for 3 min, cycle once; 95℃ for 10 seconds → 60℃ for 40 seconds (collect fluorescence), cycle 45 times, collect signals from FAM, JOE, ROX and CY5 fluorescence channels at 60℃.

[0046] 3. Screening and Judgment Criteria 1) Specificity: Only the corresponding pathogen showed an amplification curve, while other control pathogens showed no amplification or extraneous signals; 2) Sensitivity: The lower the Ct value, the higher the amplification efficiency; 3) Primer dimer-free, non-specific amplification; 4. Screening Results Multiple sets of primers and probes designed for each pathogen were screened, and the optimal set of primers and probes with an amplification efficiency of 90-110% and no non-specific amplification was retained as the formal detection sequence.

[0047] The primer and probe sequences are as follows: FPV-F:GCTTGAGTTTGCTGTGATTTCC FPV-R:GGGTGTGGGGATTTCTACG FPV-P:CCGTTTTCCAAAAATTTAAATTCCGTC FeAstV-F:AAAGAACTCCGCTGGAARATGAT FeAstV-R:GTTTAACAGGTTGTCMACATAACCACT FeAstV-P:CAACAAAGARCAGCGTGAGAARTATGCA FBoV-F:GTATCCACGATTTTATTCAATTCG FBoV-R:GCATAACGCAYTCTGGAGAGC FBoV-P:ATCCAGCATACACCTACGTGTTGCGTT DHIC07-F:CAGATCATGTTYGAGACCTTCAAC DHIC07-R:GAGTCCATCACGATGCCRGT DHIC07:CCATGTACGTGGCCATCCAGGC Target gene sequence: FPV: GGGTGTGGGGATTTCTACGGGTACTTTCAATAATCAGACGGAATTTAAATTTTTGGAAAACGGGTGGGTGGAAATCACAGCAAACTCAAGC FeAstV: AAAGAACTCCGCTGGAAAATGATCAACAAAGAGCAGCGTGAGAAATATGCAGGGGTTCATAAGTGGTATGTGGACAACCTGTTAAAC FBoV: GTATCCACGATTTTATTCAATTCGCGGATCCAGCATACACCTACGTGTTGCGTTTACCATTACCTGACTATTCAGATTATGAGAAAGCTCTCCAGAATGCGTTATGC DHIC07: CAGATCATGTTCGAGACCTTCAACATCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTGTACGCCTCTGGCCGCACCACCGGCATCGTGATGGACTC II. Primer final concentration gradient optimization experiment The optimal primer sequences obtained through screening were used to optimize the concentration gradient. The final probe concentration was fixed at 0.1 μM, and the final concentration gradients of the upstream and downstream primers were set as follows: 0.1 μM, 0.15 μM, 0.2 μM, 0.25 μM, 0.3 μM, 0.35 μM, 0.4 μM, 0.45 μM, and 0.5 μM.

[0048] Four nucleic acid plasmid templates optimized for pathogen primers, each with a capacity of 5 × 10⁻⁶. 7 copies / mL, 5×10 6 copies / mL, 5×10 5 copies / mL, 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL, 5×10 1 copies / mL; The reaction system (30 μL) consists of 6 μL of 5xBuffer, 0.5 μL of 0.2 mM dNTPs, the upstream and downstream probe combination of the primers to be screened, 1 μL of Taq enzyme, 10 μL of template nucleic acid, and nuclease-free water to a final volume of 30 μL.

[0049] Reaction procedure: Incubate at 95℃ for 3 min, cycle once; 95℃ for 10 s → 60℃ for 40 s (collect fluorescence), cycle 45 times, collect signals from FAM, JOE, ROX and CY5 fluorescence channels at 60℃.

[0050] Evaluation indicators: Ct value, fluorescence amplification of amplification curve, primer dimer, and degree of mutual interference in multiplex systems. Results are shown in […]. Figures 7-14 : Optimization conclusion: 1. When the primer concentration for FPV is 0.45 μM, the amplification curve is better, the fluorescence endpoint values ​​are more concentrated, and the Ct value is earlier. Therefore, 0.45 μM is selected as the primer concentration for FPV. 2. FeAstV exhibits better amplification curves and the highest detection gradient when the primer concentration is 0.25 μM. Therefore, 0.25 μM was chosen as the primer concentration for FeAstV. 3. FBoV exhibits better amplification curves, more concentrated fluorescence endpoint values, and the highest detection gradient when the primer concentration is 0.35 μM. Therefore, 0.35 μM was chosen as the primer concentration for FBoV. 4. When the final concentration of DHIC07 primers is 0.35 μM, the Ct is the lowest, the fluorescence increase is the highest, and there is no obvious primer dimer. Therefore, 0.25 μM is selected as the primer concentration for DHIC07.

[0051] III. TaqMan probe final concentration gradient optimization experiment 1. Fix the final concentration of FPV primers at 0.45 μM, and set the final concentration gradient of TaqMan probes: 0.10 μM, 0.15 μM, 0.2 μM, 0.25 μM, 0.3 μM, 0.35 μM, 0.4 μM, 0.45 μM.

[0052] 2. Fix the final concentration of FeAstV primers at 0.25 μM, and set the final concentration gradient of TaqMan probes: 0.10 μM, 0.15 μM, 0.2 μM, 0.25 μM, 0.3 μM.

[0053] 3. Fix the final concentration of FBoV primers at 0.35 μM, and set the final concentration gradient of TaqMan probes: 0.10 μM, 0.15 μM, 0.2 μM, 0.25 μM, 0.3 μM, 0.35 μM.

[0054] 4. Fix the final concentration of DHIC07 primer at 0.25 μM, and set the final concentration gradient of TaqMan probe: 0.10 μM, 0.15 μM, 0.2 μM, 0.25 μM, 0.3 μM.

[0055] Four target sequence-synthesized plasmids were used as templates for screening primers and probes, and were uniformly diluted to 5 × 10⁻⁶. 7 copies / mL, 5×10 6 copies / mL, 5×10 5 copies / mL, 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL, 5×10 1 copies / mL; The reaction system (30 μL) consists of 6 μL of 5xBuffer, 0.5 μL of 0.2 mM dNTPs, the upstream and downstream probe combination of the primers to be screened, 1 μL of Taq enzyme, 10 μL of template nucleic acid, and nuclease-free water to a final volume of 30 μL.

[0056] Reaction procedure: Incubate at 95℃ for 3 min, cycle once; 95℃ for 10 s → 60℃ for 40 s (fluorescence acquisition), cycle 45 times; acquire signals from FAM, JOE, ROX, and CY5 fluorescence channels at 60℃. Results are shown below. Figure 8 Evaluation metrics: fluorescence signal intensity and Ct repeatability.

[0057] Optimization conclusion: 1. At FPV levels of 0.45 / 0.45 μM, the Ct value was relatively high, indicating a better amplification gradient. Therefore, 0.45 / 0.45 μM was ultimately chosen. 2. FeAstV exhibited high fluorescence intensity and a high detection limit at 0.25 / 0.2 μM, therefore 0.25 / 0.2 μM was ultimately chosen. 3. FBoV showed higher Ct values ​​and detection limits at 0.35 / 0.2 μM, so 0.35 / 0.2 μM was ultimately chosen. 4. DHIC07 showed better amplification curves at 0.25 / 0.2μM, so 0.25 / 0.2μM was ultimately chosen.

[0058] IV. Optimized Quadruple Primer-Probe Mix Ratio Prepare a uniform quadruple primer-probe mixture, with the following final concentrations of each component: FPV forward and reverse primers: 0.45 μM each; probe: 0.45 μM FeAstV upstream and downstream primers: 0.25 μM each; probe: 0.2 μM FBoV upstream and downstream primers: 0.35 μM each; probe: 0.2 μM DHIC07 upstream and downstream primers: 0.25 μM each; probe: 0.2 μM Add 3 μL of primer-probe mix to each single reaction, and add nuclease-free water to a total 30 μL qPCR reaction system.

[0059] V. Complete and integrated testing process After completing primer and probe screening and concentration optimization, the microfluidic magnetic bead integrated extraction module of this invention is used for sample loading, sample lysis, magnetic bead adsorption, magnetic bead washing, and direct entry of the magnetic beads carrying nucleic acid into the PCR reaction chamber. The optimized quadruple primer and probe system is used to simultaneously complete the qualitative detection of FPV, FeAstV, FBoV, and DHIC07.

[0060] The integrated magnetron detection test tube described in this embodiment is a one-piece sealed centrifuge tube structure, made entirely of high-temperature resistant, low-fluorescence-background polypropylene material. The tube has three independent chambers coaxially arranged from top to bottom: a nucleic acid extraction chamber, a cleaning and purification chamber, and an amplification reaction chamber. Adjacent chambers are separated by an isolation layer with a central through-hole. Low-melting-point paraffin wax is poured into the through-hole to achieve a room-temperature liquid seal; heating to melt the wax allows the upper and lower chambers to be connected.

[0061] 1. Nucleic acid extraction chamber Located at the top of the test tube is a cylindrical chamber with a volume of 600 μL. The chamber is pre-filled with 400 μL of lysis buffer, 20 μL of proteinase K, and 6 μL of a suspension of silanol-modified superparamagnetic beads (200 nm in diameter). A screw-on cap is fitted at the top of the test tube; after adding the sample, tightening the cap creates a completely sealed reaction system. This chamber is used for sample lysis and nucleic acid adsorption: after the sample is added and thoroughly mixed with the lysis buffer, pathogenic microorganisms lyse, releasing nucleic acids. These nucleic acids specifically bind to the surface of the magnetic beads under a high-salt environment.

[0062] 2. Clean the purification chamber Located in the middle of the test tube, the chamber is pre-filled with 55 μL of nucleic acid washing buffer. A 1-2 mm diameter through-hole is centrally located in the isolation layer between the nucleic acid extraction chamber and the washing and purification chamber. This through-hole is filled with 52 μL of paraffin wax with a melting point of 52 μL. At room temperature, the paraffin wax solidifies, completely isolating the liquids in the upper and lower chambers. When heated above the melting point of the paraffin wax, the wax melts, and the through-hole becomes open. This chamber is used for the purification and washing of the magnetic bead-nucleic acid complex: the magnetic beads, carrying nucleic acids, are driven into the washing buffer by a magnet-driven module, causing the beads to reciprocate in the washing buffer, thoroughly washing away impurities such as proteins, salts, and PCR inhibitors.

[0063] 3. Amplification reaction chamber Located at the bottom of the test tube, this cone-shaped chamber has a volume of 70 μL. It contains a 30 μL pre-immobilized TaqMan quantitative PCR reaction premix, primers for three target pathogens and a canine internal reference gene, and TaqMan probes. A paraffin-sealed connecting hole is also provided between the cleaning and purification chamber and the amplification reaction chamber; 40 μL of paraffin is added. The bottom of the tube is made of optically transparent material, compatible with external fluorescence detection equipment for bottom-based fluorescence signal acquisition.

[0064] This chamber is used to perform multiplex TaqMan qPCR amplification and real-time fluorescence detection: after the magnetic beads carry purified nucleic acid into the reaction system, the nucleic acid is released and used as an amplification template, and amplification is completed under temperature-controlled conditions. The filling steps are as follows: 1. Assembly of the amplification reaction chamber: Add 30 μL of lower layer mixture A, place horizontally, and then add another 40 μL of paraffin to the junction of the amplification reaction chamber and the washing and purification chamber (e.g., Figure 2 The amplification reaction chamber has been assembled.

[0065] 2. Cleaning and assembling the purification chamber: Draw up silicone oil and seal all cavities except the purification chamber (according to...) with silicone oil. Figure 3 The sample addition sequence is ②-③-④-①-⑤. Silicone oil is added to ②, ③, and ④ respectively, with addition volumes of 25 μL, 20 μL, and 25 μL. 95 μL of paraffin is added to ①. After sealing, 55 μL of cleaning solution is quickly added to ⑤, and then the cleaning and purification chamber cover is slowly pressed in. The cleaning and purification chamber assembly is complete. Figure 3 The red box in the middle side view marks the location of the cleaning and purification chamber.

[0066] 3. Assembly of the nucleic acid extraction chamber: In the nucleic acid extraction chamber (see...) Figure 4 Add 400 μL of lysis buffer (guanidine isothiocyanate, PEG 8000, isopropanol, Tritonx-100, etc.), 20 μL of proteinase K, and 5 μL of magnetic beads sequentially to the reagent tube (highlighted in red). The nucleic acid extraction chamber is now assembled.

[0067] 4. Extraction and amplification program: lysis time 2 min, lysis temperature 60℃, extraction temperature 50℃, elution time 2 min, magnet rotation speed 2 min / revolution, number of revolutions 1 revolution.

[0068] 5. Reaction program: Incubate at 50℃ for 10 min, incubate at 95℃ for 2 min, cycle once; 95℃ for 5 seconds → 60℃ for 10 seconds, cycle 5 times; 95℃ for 5 seconds → 60℃ for 10 seconds, cycle 40 times, acquire signals from the FAM, JOE, ROX and CY5 fluorescence channels at 60℃.

[0069] The kit components include an anti-inhibition direct amplification lysis buffer, sample tubes pre-loaded with detection reagents (primers and probes), and positive and negative control samples; the sample tubes are pre-mixed with pathogen-specific TaqMan primers and probes.

[0070] Table 1 Fluorescence Channel Selection: , 6. Sample addition and amplification: Add 300 μL of pathogen pseudovirus sample to the reaction well and perform qPCR; each well's primers and probes only identify the corresponding pathogen, and the positive and negative control samples are used for simultaneous amplification.

[0071] Table 2 shows the interpretation results of the fluorescence Ct values ​​of each channel. , 7. Program optimization: (1) Keep warm at 50℃ for 10 min, keep warm at 95℃ for 2 min, repeat once; keep warm at 95℃ for 10 seconds → keep warm at 60℃ for 30 seconds, repeat 5 times; keep warm at 95℃ for 10 seconds → keep warm at 60℃ for 30 seconds, repeat 40 times. (2) Keep warm at 50℃ for 10 min, keep warm at 95℃ for 2 min, repeat once; keep warm at 95℃ for 5 seconds → keep warm at 60℃ for 20 seconds, repeat 5 times; keep warm at 95℃ for 5 seconds → keep warm at 60℃ for 20 seconds, repeat 40 times. (3) Keep warm at 50℃ for 10 min, keep warm at 95℃ for 2 min, repeat once; keep warm at 95℃ for 2 seconds → keep warm at 60℃ for 20 seconds, repeat 5 times; keep warm at 95℃ for 2 seconds → keep warm at 60℃ for 20 seconds, repeat 40 times. (4) Keep warm at 50℃ for 10 min, keep warm at 95℃ for 2 min, repeat once; 95℃ for 2 seconds → 60℃ for 10 seconds, repeat 5 times; 95℃ for 2 seconds → 60℃ for 10 seconds, repeat 40 times. Under all four reaction procedures, the amplification effect was good. To ensure amplification efficiency and shorten the time, procedure (4) was selected for subsequent amplification verification.

[0072] 8. The quality control test results of the combined positive and negative control samples for FPV, FeAstV, and FBoV met the requirements and were detected in clinical samples containing the corresponding pathogens, but not in clinical samples containing other pathogens, indicating that the reagent has good specificity.

[0073] Table 3. Detection results of different positive samples using reagents , 9. Sensitivity testing: The self-made pseudoviruses targeting three different targets were serially diluted to 5 × 10⁻⁶. 4 copies / mL, 5×10 3 copies / mL, 5×10 2 Copies / mL were used as templates. When the viral template was 5 × 10⁻⁶, the viral template was used as templates. 2When the template concentration is low (copies / mL), it is used as a template for amplification. Therefore, the kit described in this invention can still perform detection even at low template concentrations, thus exhibiting high sensitivity.

[0074] Table 4 Sensitivity Detection Results , 10. Stability test: Fill 20 vials of each reagent and store them at 37℃ and 4℃. At 37℃, test the positive and negative control samples continuously for 15 days. If the amplification is normal, test the positive and negative control samples at 4℃ once a week. If the amplification is normal, test the positive and negative control samples once a week.

[0075] Table 5. Cross-reactivity test results , 11. Specificity study: Clinically positive samples of other pathogens, such as feline coronavirus, feline chlamydia, feline calicivirus, and feline mycoplasma, were used for specific testing. The positive and negative control samples were normal, and no pathogens were detected in the clinical samples, indicating no cross-reactivity.

[0076] 12. Conclusion: This patent provides a combined detection reagent for feline panleukopenia virus / feline astrovirus / feline bocavirus, which can stably and rapidly detect low-copy viruses. Furthermore, it integrates POCT nucleic acid extraction and PCR amplification into a fully automated, sealed magnetically controlled test tube, making operation simple and convenient, with a completely closed and contamination-free process. It has a wide range of applications and broad prospects.

[0077] The prepared reaction system, consisting of buffer, enzyme, primer, and probe, is the contents of the kit in this application. It is then added to the amplification reaction chamber, followed by filling with paraffin silicone oil and cleaning solution, capping, adding lysis buffer, proteinase K, and magnetic beads, and finally capping.

[0078] This kit utilizes a micro-magnetically controlled nucleic acid extraction and amplification reagent tube. Through a microfluidic tubing design and fully enclosed packaging technology, the reagent tube is divided into three regions: a nucleic acid extraction chamber, a cleaning and purification chamber, and an amplification reaction chamber. The sample releases nucleic acid under high-temperature lysis of the nucleic acid extraction solution, and magnetic beads adsorb and enrich the nucleic acid. Through automated regulation by the micro-magnetic control system, the magnetic beads carrying the nucleic acid undergo cleaning and purification, ultimately settling into the amplification reaction chamber. PCR amplification and fluorescence detection are then performed using a temperature-controlled detection system. This achieves an integrated workflow of automated nucleic acid extraction, cleaning and purification, and PCR amplification and detection within a single sealed tube. Furthermore, the addition of UNG enzyme to the reaction system effectively solves the "false positive" problem caused by aerosol contamination.

[0079] The various embodiments of this disclosure have been described above. These descriptions are exemplary and not exhaustive, nor are they limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. The terminology used herein is chosen to best explain the principles, practical application, or technical improvements to the embodiments in the market, or to enable others skilled in the art to understand the embodiments disclosed herein.

Claims

1. A microfluidic-based multiplex pet pathogen detection kit, characterized in that, The kit includes: a lower layer mixture A, a middle layer liquid B, and an upper layer mixture C; The lower layer mixture A includes 5X reaction buffer, 25X enzyme mixture, feline panleukopenia virus FPV-F forward primer, feline panleukopenia virus FPV-R reverse primer, feline panleukopenia virus FPV-P fluorescent probe, feline astrovirus FeAstV-F forward primer, feline astrovirus FeAstV-R reverse primer, feline astrovirus FeAstV-P fluorescent probe, feline bocavirus FBoV-F forward primer, feline bocavirus FBoV-R reverse primer, feline bocavirus FBoV-P fluorescent probe, internal control DHIC07-F forward primer, internal control DHIC07-R reverse primer, and internal control DHIC07 fluorescent probe. The intermediate liquid B has three separate components, including liquid paraffin, silicone oil, and cleaning fluid; The upper mixture C includes lysis buffer, magnetic bead suspension, and proteinase K. The lysis buffer includes guanidine isothiocyanate, PEG 8000, isopropanol, and Tritonx-100. The magnetic bead suspension includes silanol-modified superparamagnetic beads; 5X reaction buffer contains: Tris-HCl (tris-hydroxymethylaminomethane hydrochloride), MgCl2, and KCl; The 25X enzyme mixture includes: RT enzyme and Taq enzyme.

2. The microfluidic-based multiplex pet pathogen detection kit according to claim 1, characterized in that, The lower layer mixture A also includes the forward primer DHIC07-F for the feline internal control β-ACT actin gene, the reverse primer DHIC07-R for the feline internal control β-ACT actin gene, the DHIC07 fluorescent probe for the feline internal control β-ACT actin gene, the DHIC07-F forward primer, the DHIC07-R reverse primer, and the DHIC07 fluorescent probe as internal control controls to monitor the effectiveness of the experiment and avoid misinterpretation of results.

3. The microfluidic-based multiplex pet pathogen detection kit according to claim 1, characterized in that, The fluorescent groups of the FPV fluorescent probe, FeAstV fluorescent probe, FBoV fluorescent probe, and internal control DHIC07 fluorescent probe are different. The fluorescent group and quenching group connected to the FPV fluorescent probe are labeled as FAM / BHQ1, the fluorescent group and quenching group connected to the FeAstV fluorescent probe are labeled as ROX / BHQ2, the fluorescent group and quenching group connected to the FBoV fluorescent probe are labeled as CY5 / BHQ2, and the fluorescent group and quenching group connected to the internal control fluorescent probe are labeled as JOE / BHQ1. BHQ1 and BHQ2 are fluorescence quenching groups, exhibiting multiple fluorescence and multiple differentiation, and there is no cross-reaction between them.

4. The microfluidic-based multiplex pet pathogen detection kit according to claim 1, characterized in that, The sequence of the FPV-F forward primer is as follows: GCTTGAGTTTGCTGTGATTTCC; The sequence of the FPV-R reverse primer is as follows: GGGTGTGGGGATTTCTACG; The sequence of the FPV-P fluorescent probe is as follows: CCGTTTTCCAAAAATTTAAATTCCGTC; The sequence of the FeAstV-F forward primer is as follows: AAAGAACTCCGCTGGAARATGAT; The sequence of the FeAstV-R reverse primer is as follows: GTTTAACAGGTTGTCMACATACCACT; The sequence of the FeAstV-P fluorescent probe is as follows: CAACAAAGARCAGCGTGAGAARTATGCA; The sequence of the FBoV-F forward primer is as follows: GTATCCACGATTTTATTCAATTCG; The sequence of the FBoV-R reverse primer is as follows: GCATAACGCAYTCTGGAGAGC; The sequence of the FBoV-P fluorescent probe is as follows: ATCCAGCATACACCTACGTGTTGCGTT.

5. The microfluidic-based multiplex pet pathogen detection kit according to claim 2, characterized in that, The sequence of the forward primer for DHIC07-F is as follows: CAGATCATGTTYGAGACCTTCAAC; The sequence of the DHIC07-R reverse primer is as follows: GAGTCCATCACGATGCCRGT; The sequence of the DHIC07 fluorescent probe is as follows: CCATGTACGTGGCCATCCAGGC.

6. The microfluidic-based multiplex pet pathogen detection kit according to claim 2, characterized in that, The concentration of the FPV-F forward primer is 0.4-0.5 μM, the concentration of the FPV-R reverse primer is 0.4-0.5 μM, and the concentration of the FPV-P fluorescent probe is 0.4-0.5 μM. The concentration of the FeAstV-F forward primer is 0.2-0.3 μM; the concentration of the FeAstV-R reverse primer is 0.2-0.3 μM; and the concentration of the FeAstV-P fluorescent probe is 0.15-0.25 μM. The concentration of the FBoV-F reverse primer is 0.3-0.4 μM; the concentration of the FBoV-R fluorescent probe is 0.3-0.4 μM; and the concentration of the FBoV-P forward primer is 0.15-0.25 μM. The concentrations of the DHIC07-F forward primer and the DHIC07-R reverse primer are 0.2-0.3 μM, respectively, and the concentration of the DHIC07 fluorescent probe is 0.15-0.25 μM. 1 μM is equivalent to 10 -6 Moles per liter.

7. The microfluidic-based multiplex pet pathogen detection kit according to claim 2, characterized in that, The concentration of the FPV-F forward primer was 0.45 μM, the concentration of the FPV-R reverse primer was 0.45 μM, and the concentration of the FPV-P fluorescent probe was 0.45 μM. The concentration of the FeAstV-F forward primer was 0.25 μM; the concentration of the FeAstV-R reverse primer was 0.25 μM; and the concentration of the FeAstV-P fluorescent probe was 0.2 μM. The concentration of the FBoV-F reverse primer was 0.35 μM; the concentration of the FBoV-R fluorescent probe was 0.35 μM; and the concentration of the FBoV-P forward primer was 0.2 μM. The concentrations of the DHIC07-F forward primer and the DHIC07-R reverse primer were 0.25 μM and 0.2 μM, respectively. The concentration of the DHIC07 fluorescent probe was 0.2 μM. 1 μM is equivalent to 10 -6 Moles per liter.

8. The microfluidic multi-pet system according to claim 1 Pathogen detection kit, characterized in that, The kit also includes a positive control and a negative control, wherein the positive control is a positive plasmid pseudovirus standard and the negative control is an internal control plasmid pseudovirus standard.

Images