Application of neurolysin NLN in diagnosis and prognosis evaluation of breast cancer and pharmaceutical use of inhibitor of neurolysin

Abstract

The application discloses a drug use of neurolysin (NLN) as a breast cancer diagnosis marker, a prognosis evaluation marker and an inhibitor, and belongs to the technical field of biological medicine. The application firstly finds that the mRNA and protein levels of NLN are significantly up-regulated in breast cancer tissues through TCGA and CPTAC database analysis, and the high expression in triple-negative breast cancer is the most significant; the ROC curve analysis based on the TCGA database shows that NLN has a distinguishing effect on breast cancer and triple-negative breast cancer. Further, the high expression of NLN in breast cancer tissues is verified by using 122 pairs of clinical tissue samples, and the immunohistochemical analysis of 134 clinical cases confirms that the patients with high expression of NLN are more likely to have distant metastasis, and the overall survival period and progression-free survival period are significantly shortened. The in-vitro cell experiment shows that the overexpression of NLN significantly promotes the proliferation, migration and invasion of triple-negative breast cancer cells; the mouse tumor-bearing experiment confirms that the overexpression of NLN promotes the growth of tumors in vivo, and the knockdown of NLN significantly inhibits the growth of tumors. The application provides a new molecular target for early diagnosis, prognosis evaluation and targeted treatment of breast cancer, and has important clinical application value.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of neurolysin NLN in the diagnosis and prognostic assessment of breast cancer and the pharmaceutical use of its inhibitors. Background Technology

[0002] Breast cancer is the most common malignant tumor among women worldwide and the leading cause of cancer death in women, seriously threatening their health and quality of life. In recent years, influenced by lifestyle, environmental factors, genetic factors, and endocrine disorders, the incidence of breast cancer has been rising globally and in my country, placing increasing pressure on clinical diagnosis and treatment. Besides the rapid increase in incidence, another important characteristic of breast cancer in my country is the relatively young age of onset. The age of initial onset of breast cancer below 35 years old is a significant factor contributing to high recurrence rates; the younger the age of initial onset, the higher the recurrence rate. While mammography has been proven to be an effective tool for breast cancer screening, the breast tissue of young women is relatively dense, resulting in low diagnostic sensitivity of mammography. Furthermore, considering the potential radiation damage from mammograms, frequent examinations are not advisable.

[0003] Furthermore, the clinical diagnosis and treatment system for breast cancer mainly relies on imaging examinations, pathological tissue biopsies, and traditional tumor marker detection. Among these, imaging examinations suffer from low accuracy in identifying early lesions and difficulty in distinguishing between benign and malignant small lesions. Pathological biopsies, as invasive procedures, are complex and time-consuming, making them unsuitable for early screening and dynamic disease monitoring. Commonly used traditional markers such as CA15-3, CA125, and CEA generally suffer from low specificity and insufficient sensitivity, easily producing false-positive results in benign breast hyperplasia and inflammation, making it difficult to accurately differentiate the progression of breast cancer and failing to meet the core clinical needs of early diagnosis, prognostic assessment, and treatment efficacy prediction. Breast cancer exhibits high tumor heterogeneity; different patients show significant differences in pathological type, proliferative and invasive capacity, risk of metastasis and recurrence, and sensitivity to radiotherapy, chemotherapy, and targeted therapy. This directly leads to inconsistent clinical treatment outcomes, with extremely poor prognoses for patients in advanced stages.

[0004] With the rapid development of precision oncology and proteomics technologies, tumor-specific protein biomarkers have become a core research direction for early diagnosis, targeted therapy, and prognostic assessment of breast cancer. Compared to traditional detection indicators, abnormally expressed proteins in tumors can directly participate in core biological processes such as tumor cell proliferation, invasion, migration, immune escape, and microenvironment remodeling, accurately reflecting the developmental status of tumors and representing a key breakthrough for achieving precision diagnosis and treatment of breast cancer. Currently, biomarkers such as HER2 and Ki-67 used clinically can only cover the diagnosis and assessment of some breast cancer subtypes. There are still many clinical challenges, such as the lack of specific biomarkers for many subtypes of breast cancer, a shortage of early warning indicators for advanced metastasis and recurrence, and insufficient targeted therapy targets, which greatly limit the development of precision medicine for breast cancer. Summary of the Invention

[0005] To address the problems existing in the prior art, this invention provides the application of neurolysin NLN in the diagnosis and prognostic assessment of breast cancer, as well as the pharmacological use of its inhibitors. This invention, through screening the TCGA and CPTAC databases, found that NLN is significantly highly expressed in breast cancer tissues, especially in triple-negative breast cancer. Independent validation using 122 clinical tissue samples and 134 clinical cases confirmed that high NLN expression is associated with distant metastasis and poor prognosis. In vitro cell experiments and in vivo animal experiments confirmed that NLN promotes breast cancer progression, while knocking down NLN significantly inhibits tumor growth.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solutions.

[0007] This invention discloses the application of reagents for detecting the expression level of neurolysin (NLN) protein or its encoding gene in the preparation of kits for diagnosing breast cancer.

[0008] Furthermore, the breast cancer described is triple-negative breast cancer.

[0009] Furthermore, the test samples for the kit are selected from tissues.

[0010] The present invention also discloses the application of reagents for detecting the expression level of neurolysin (NLN) protein or its encoding gene in the preparation of kits for assessing the prognosis of breast cancer patients.

[0011] Furthermore, the prognostic assessment includes predicting the patient's risk of distant metastasis, overall survival, and / or progression-free survival.

[0012] Furthermore, the breast cancer described is triple-negative breast cancer.

[0013] The present invention also discloses the use of neurolysin (NLN) inhibitors in the preparation of medicaments for the treatment of breast cancer.

[0014] Furthermore, the breast cancer described is triple-negative breast cancer.

[0015] Furthermore, the NLN inhibitor is a shRNA, siRNA, antisense oligonucleotide, or small molecule compound that targets the NLN gene.

[0016] Furthermore, the drug is used to treat breast cancer patients with high NLN expression.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows.

[0018] This patent is the first to discover that neurolysin (NLN) protein is highly expressed in clinical breast cancer tissues and is associated with poor prognosis in breast cancer patients. NLN overexpression promotes the proliferation, migration, and invasion of breast cancer cells. NLN overexpression also promotes the in vivo growth of breast cancer cells. ROC curve analysis shows that NLN gene expression levels have discriminative efficacy against breast cancer. The therapeutic effect was verified using shRNA knockdown of NLN, which showed that knockdown of NLN inhibited the in vivo growth of breast cancer cells. This is the first time that NLN has been found to serve as a tumor marker for breast cancer diagnosis and holds promise as a new target for breast cancer treatment. Attached Figure Description

[0019] Figure 1 Analysis of NLN mRNA expression in breast cancer tissues. A. NLN mRNA expression in breast cancer and adjacent normal tissues predicted by the TCGA database. Red indicates NLN mRNA expression in cancer tissues (n=1085 cases), and gray indicates adjacent normal tissues (n=291 cases), *P<0.05; B. NLN mRNA expression in breast cancer and adjacent normal tissues predicted by the TCGA database at different molecular subtypes. Red indicates NLN expression in cancer tissues, and gray indicates adjacent normal tissues, *P<0.05.

[0020] Figure 2 Expression analysis of NLN protein in breast cancer tissues. A. CPTAC database prediction of NLN protein expression in breast cancer and adjacent normal tissues, red indicates NLN protein expression in cancer tissues (n=125 cases), blue indicates adjacent normal tissues (n=18 cases); B. CPTAC database prediction of NLN protein expression in breast cancer and adjacent normal tissues of different molecular subtypes.

[0021] Figure 3 Survival analysis of NLN expression was performed using information from the GEO database.

[0022] Figure 4 ROC curve of NLN gene expression level in breast cancer diagnosis.

[0023] Figure 5 ROC curve for the diagnostic effect of NLN gene expression level in triple-negative breast cancer.

[0024] Figure 6 Western blot detection of NLN expression in clinical cases: A: 122 pairs of fresh frozen clinical breast cancer tissues and adjacent normal tissues were extracted and detected with NLN antibody, with β-actin as an internal control. The figure shows 6 representative images. P represents adjacent normal tissue, and C represents breast cancer tissue; B: The figure shows the statistical results of 122 cases, ***P<0.001.

[0025] Figure 7 Immunohistochemical detection of NLN expression in clinical cases. A: Paraffin sections from 134 breast cancer patients were collected, and NLN protein expression was detected by immunohistochemistry. The figure shows a representative image of NLN staining. Magnification: 100×; B: Patients were grouped according to whether metastasis had occurred. NLN IHC staining scores were statistically analyzed. ***P<0.001 Figure 8 right Figure 7 Survival analysis of the results: A: Overall survival (OS) of patients with high and low NLN expression, *P<0.05; B: Progression-free survival (DFS), ***P<0.001.

[0026] Figure 9 Construction of stable NLN overexpression cell lines. A. Western blot analysis was performed to detect NLN protein expression in five triple-negative breast cancer cell lines, with GAPDH as an internal control. B. Western blot analysis was performed to verify the construction of stable NLN overexpression cell models using lentiviruses in the MDA-MB-231 (left) and Hs 578T (right) cell lines, with Tubulin as an internal control.

[0027] Figure 10 CCK-8 assay to verify the effect of NLN overexpression on the proliferation of triple-negative breast cancer cells. A: CCK-8 viability assay to detect cell viability of MDA-MB-231 cells stably transfected with NLN overexpression within 0-72 h. The figure shows the statistical analysis of relative growth rate, n=3, ***P<0.001; B: CCK-8 viability assay to detect cell viability of Hs578T cells stably transfected with NLN overexpression within 0-72 h. The figure shows the statistical analysis of relative growth rate, n=3, ***P<0.001.

[0028] Figure 11 Clonogenic assays were used to verify the effect of NLN overexpression on the proliferation of triple-negative breast cancer cells. A: The figure shows the visualization and statistical analysis of the clonogenic ability of MDA-MB-231 cells stably transfected with NLN overexpression, n=3, ***P<0.001; B: The figure shows the visualization and statistical analysis of the clonogenic ability of Hs 578T cells stably transfected with NLN overexpression, n=3, **P<0.01.

[0029] Figure 12To verify the effect of NLN overexpression on the lateral migration ability of triple-negative breast cancer cells. A: The figure shows the visualization and statistical analysis of the lateral migration ability of MDA-MB-231 cells stably transfected with NLN overexpression within 0-48 h, n=3, ***P<0.001, ns: no statistical significance; B: The figure shows the visualization and statistical analysis of the lateral migration ability of Hs 578T cells stably transfected with NLN overexpression within 0-48 h, n=3, **P<0.01, ***P<0.001. ns: No statistical significance.

[0030] Figure 13 To verify the effect of NLN overexpression on the migration and invasion abilities of triple-negative breast cancer cells. A: The figure shows the visualization and statistical analysis of the migration and invasion abilities of MDA-MB-231 cells stably transfected with NLN overexpression, n=3, ***P<0.001; B: The figure shows the visualization and statistical analysis of the migration and invasion abilities of Hs 578T cells stably transfected with NLN overexpression, n=3, **P<0.01.

[0031] Figure 14 Western blot experiments were used to verify the construction of a stable 4T1 mouse triple-negative breast cancer cell line overexpressing NLN, with GAPDH used as an internal control.

[0032] Figure 15 In vivo validation of the effect of NLN overexpression on the growth of triple-negative breast cancer cells. A: Gross (top) and tumor (bottom) imaging of BALB / c tumor-bearing mouse model; B: Average tumor volume measured at the time points shown in the figures and growth curves plotted, n=5, ***P<0.001.

[0033] Figure 16 Construction of stable NLN overexpression / knockdown 4T1 cell lines.

[0034] Figure 17 Knockdown of NLN was used to validate the therapeutic effect in vivo. A: Tumor imaging in BALB / c tumor-bearing mouse model, n=5; B: Average tumor volume was recorded and growth curves were plotted according to the time points shown in the figure, n=5, *P<0.05, ***P<0.001, ns: no statistical significance. Detailed Implementation

[0035] The present invention will be further described in detail below with reference to specific embodiments. However, this should not be construed as limiting the scope of the above-described subject matter of the present invention to the following embodiments; all technologies implemented based on the content of the present invention fall within the scope of the present invention.

[0036] Unless otherwise specified, all reagents and materials used in this invention are commercially available.

[0037] Example 1: Expression of NLN in breast cancer tissue and its clinical significance.

[0038] 1. NLN expression screening.

[0039] 1.1 Experimental Materials. TCGA database (https: / / gdc.cancer.gov / ), CPTAC database (https: / / pdc.cancer.gov / ).

[0040] 1.2 Experimental Methods. The expression of NLN mRNA (http: / / gepia.cancer-pku.cn / detail.php) and protein (https: / / ualcan.path.uab.edu / tutorial.html) in normal tissues and in breast cancer as a whole and in different subtypes was analyzed using an online analysis website.

[0041] 1.3 Experimental Results.

[0042] (1) The expression of NLN in breast cancer and various molecular subtypes of breast cancer was analyzed using The Cancer Genome Atlas (TCGA). It was found that NLN mRNA was highly expressed in breast cancer tissue (normal group n=291 cases, breast cancer group=1085 cases, *P<0.05). Figure 1 A). Furthermore, it showed high expression in breast cancer tissues of different molecular subtypes (normal group n=291 cases, triple-negative breast cancer group n=135 cases, HER2-positive breast cancer group n=66 cases, Luminal A breast cancer group n=415 cases, Luminal B breast cancer group n=194 cases, *P<0.05). Figure 1 (B) This suggests that NLN may play an important role in the progression of breast cancer.

[0043] (2) The expression of NLN protein in breast cancer and various molecular subtypes of breast cancer was analyzed using the Clinical Proteomic Tumor Analysis Consortium (CPTAC) database. It was found that NLN protein was highly expressed in breast cancer tissues (normal group n=18 cases, breast cancer group n=125 cases, P=0.007). Figure 2 A), especially in triple-negative breast cancer, the expression was most significant (normal group n=18 cases; Luminal breast cancer group n=64 cases, compared with normal group P=0.108; HER2-positive breast cancer group n=10 cases, compared with normal group P=0.103; triple-negative breast cancer group n=16 cases, compared with normal group P=0.004) Figure 2(B) This suggests that NLN may be more significant in the progression of triple-negative breast cancer.

[0044] 2. ROC curve diagnostic efficacy assessment.

[0045] 2.1 Experimental Materials. GEO database (https: / / www.ncbi.nlm.nih.gov / geo), TCGA database (https: / / gdc.cancer.gov / ).

[0046] 2.2 Experimental methods.

[0047] Survival analysis: The correlation between NLN expression and recurrence-free survival (RFS) was analyzed using an online analysis website (https: / / kmplot.com / analysis / index.php?p=service).

[0048] ROC curve analysis: Using the TCGA-BRCA breast cancer public cohort dataset, NLN gene mRNA expression data were extracted and matched with clinical binary outcomes. NLN gene expression level was used as a continuous predictor variable, and receiver operating characteristic (ROC) curves were employed to assess its discriminative power against study outcomes. The horizontal axis represents 1-specificity, and the vertical axis represents sensitivity. The area under the ROC curve (AUC) was calculated to quantify discriminative power. R language was used to plot the curves and perform AUC statistical calculations.

[0049] 2.3 Experimental results.

[0050] (1) The correlation between NLN expression and recurrence-free survival (RFS) was predicted using the Gene Expression Omnibus (GEO) database. The results showed that patients with high NLN expression had a poorer prognosis. Figure 3 The above results suggest that high expression of NLN in breast cancer tissue is associated with poor patient prognosis.

[0051] (2) Based on the TCGA breast cancer cohort (normal control group n=113 cases, breast cancer group n=1111 cases), ROC curve analysis showed that NLN gene expression level had discriminatory power against breast cancer, with an AUC value of 0.709 ( Figure 4 This suggests that NLN may serve as a potential molecular marker for breast cancer.

[0052] (3) Based on the TCGA breast cancer cohort (normal control group n=113 cases, triple-negative breast cancer group n=197 cases), ROC curve analysis showed that NLN gene expression level had discriminatory power for breast cancer, with an AUC value of 0.736 ( Figure 5 This suggests that NLN may serve as a potential molecular marker for triple-negative breast cancer.

[0053] 3. Independent clinical samples validated NLN expression in breast cancer tissues.

[0054] 3.1 Experimental materials.

[0055] Two independent experimental cohorts were selected. 122 pairs of fresh, frozen clinical breast cancer and adjacent normal tissues were collected from the Department of Breast Surgery, First Affiliated Hospital of China Medical University, between September 2021 and September 2023. Additionally, primary lesion tissue samples from 134 breast cancer patients were collected, and immunohistochemical analysis was performed on their clinicopathological sections or biopsy specimens.

[0056] List of reagents used: Tissue preservation solution (Albisin, Cat#abs9474); 4% tissue and cell fixative (Solepro, Cat#P1110); Blocked goat serum (Solepro, Cat#SL038); Benzyl sulfonyl fluoride (PMSF) (Solepro, Cat#P0100); Protease inhibitor (PI) (Wuhan Sanying, Cat#PR20016); Immunohistochemistry EliVision™ plus assay kit (Maixin, Cat#KIT-9730); Prestained protein marker VIII (8-270 kDa) (Seville, Cat#G2089-250UL); Prestained protein marker II (10-200 kDa) (Seville, Cat#G2058-250UL); Tween 20 (Dingguo Changsheng, Cat#MB-P4732); TEMED (Dingguo Changsheng, Cat#T7024); DAB developing solution (Maixin, Cat#AEC-0037); Hematoxylin staining solution (Maixin, Cat#CTS-1096); Neutral gum (Maixin, Cat#AEC-1040); Xylene (Hushi, Cat#1330-20-7); Anhydrous ethanol (Hushi, Cat#64-17-5).

[0057] List of antibodies used: NLN Mouse Monoclonal antibody (OriGene, Cat#TA504178); BetaActin Monoclonal antibody (Wuhan Sanying, Cat#66009-1-Ig); HRP-Goat Anti-Mouse IgG (H+L) (Wuhan Sanying, Cat#SA00001).

[0058] 3.2 Experimental methods.

[0059] Tissue protein extraction: Take the experimental tissue, wash three times with PBS, add an appropriate amount of cell lysis buffer, and mince with tissue scissors. Transfer to a 1.5 mL centrifuge tube and lyse on ice for 20 min. Use a tissue ultralysis device to fully lyse the tissue, then centrifuge at 13000 rpm for 20 min. Collect the supernatant into a new 1.5 mL centrifuge tube. Protein concentration determination is performed using the same method as cell protein extraction. Different protein samples are adjusted to the same final concentration using 6× loading buffer and double-distilled water. Centrifuge briefly to the bottom of the centrifuge tube, selectively boil to denature according to the target protein characteristics, and store at -80℃ for later use.

[0060] Protein immunoblotting: Prepare an appropriate concentration of SDS-PAGE gel, load the prepared protein sample and separate it by electrophoresis; after electrophoresis, transfer the protein to an activated PVDF membrane at a constant current of 200mA for 2 hours on ice. After the transfer, block the membrane with 5% skim milk powder at room temperature for 1 hour, then add the target protein antibody diluted with PBST buffer and incubate overnight at 4°C. Incubate with secondary antibody at room temperature for 1 hour. After each incubation step, rinse thoroughly with PBST buffer; finally, add ECL luminescent solution and develop the image using a chemiluminescence imaging system.

[0061] Immunohistochemical staining: This experiment used the ready-to-use ultrasensitive immunohistochemical UltraSensitive™ staining. The SP kit was used for the following steps: Paraffin sections were baked at 65°C for 6 hours, dewaxed in three xylene baths (15 min / battery), and then hydrated sequentially with high-concentration ethanol (100%, 100%, 95%, 10 min / battery) and low-concentration ethanol (90%, 80%, 70%, 5 min / battery). After washing with distilled water for 5 min, the sections were washed three times with PBS (5 min / wash). The sections were then autoclaved with freshly prepared antigen retrieval solution (4.8 g sodium citrate + 0.6 g citric acid, diluted with distilled water to 1.6 L) (boiling and holding at pressure for 90 s, then immediately cooling to room temperature). The tissue was circled with a histochemical pen and washed three times with PBS (5 min / wash). Reagent 1 from the kit was added and incubated at room temperature for 10 min to eliminate endogenous peroxidase and biotin, followed by incubation with reagent 2 at room temperature for 10 min for blocking. Primary antibody diluted in pre-cooled PBS (50 µL, appropriate concentration) was added, and the sections were incubated overnight at 4°C in a humidified chamber. The next day, the sections were warmed to room temperature for 30 min and washed three times with PBS (5 min / wash). (n / time); Add reagent 3 from the kit and incubate at room temperature for 10 min (secondary antibody), wash 3 times with PBS (5 min / time), then add reagent 4 and incubate at room temperature for 10 min, wash 3 times with PBS (5 min / time); prepare DAB chromogenic solution according to the instructions, develop DAB for 1-3 min, stop the reaction with tap water and rinse with running water for 10 min; stain with hematoxylin for 2 min, stop with tap water, differentiate with 1% differentiation solution (hydrochloric acid: ethanol = 1:99) for 10 s, rinse with tap water for 10 min, wash with single-distilled water for 5 min; then dehydrate with low concentration ethanol (70%, 80%, 90%, 8 min / piece), high concentration ethanol (95%, 95%, 100%, 5 min / piece), and 3 xylenes (3 min / piece), add neutral resin to mount (avoid air bubbles), and take pictures after solidification; finally, evaluate the protein expression level according to the percentage of positive cells and staining intensity (6-12 points for high expression, 0-4 points for low expression).

[0062] 3.3 Experimental results.

[0063] (1) To further verify the protein expression level of NLN in clinical cases, Western blot was used to detect the expression of NLN protein in 122 pairs of fresh clinical breast cancer and paired adjacent normal tissues. It was found that NLN was highly expressed in breast cancer tissues compared with paired adjacent normal tissues. Figure 6 ).

[0064] (2) To verify the correlation between NLN expression and patient prognosis in clinical cases, the expression of NLN protein in paraffin sections of 134 clinical orthotopic breast cancer tissues was detected by immunohistochemistry. Figure 7A) NLN protein expression was assessed based on the product of the percentage of positive cells and the staining intensity score (scoring range 0-12). Patients were divided into two groups based on whether they had metastases. Analysis of NLN expression in the primary lesions of both groups revealed that the median NLN score in the metastatic group was significantly higher than that in the non-metastatic group, indicating that breast cancer patients with high NLN expression in the primary lesion are more prone to distant metastases. These results suggest that high NLN expression is positively correlated with breast cancer progression. Figure 7 B).

[0065] (3) In addition, the overall survival (OS) and progression-free survival (DFS) of 134 breast cancer patients were statistically analyzed, confirming that patients with high NLN expression in breast cancer showed poor overall survival. Figure 8 A) and progression-free survival ( Figure 8 B). The above results indicate that high expression of NLN in breast cancer tissue predicts a poor prognosis for patients.

[0066] Example 2: Effect of NLN on the malignant phenotype of triple-negative breast cancer cells.

[0067] 1. Experimental Materials. The human breast cancer cell lines MDA-MB-231, MDA-MB-468, BT-549, HCC1937 and Hs 578T used in this experiment were all derived from cells owned by our laboratory.

[0068] List of reagents used: NLN lentivirus (Nanjing Zebrafish Biotechnology Co., Ltd.); DMEM medium (KGI Biotechnology, Cat#KGL1206-500); Leibovitz's L-15 medium (KGI Biotechnology, Cat#KGL1805-500); RPMI-1640 medium (KGI Biotechnology, Cat#KGL1501-500); Superior fetal bovine serum (EcoSyne, Cat#FSP500); Trypsin (KGI Biotechnology, Cat#KGA1519-5); Puromycin (Soluble Biotech, Cat#P8230); Benzyl sulfonyl fluoride (PMSF) (Soluble Biotech, Cat#P0100); Protease inhibitor (PI) (Wuhan Sanying, Cat#PR20016); Cell Counting Kit-8 (Beyotime, Cat#C0046); Prestained protein marker VIII (8-270) (kDa) (Seville, Cat#G2089-250UL); Prestained protein Marker II (10-200 kDa) (Seville, Cat#G2058-250UL); Tween 20 (Dingguochangsheng, Cat#MB-P4732); EDTA (Dingguochangsheng, Cat#AC-0021); TEMED (Dingguochangsheng, Cat#T7024); Methanol (Shanghai Testing, Cat#67-56-1); Matrigel (BD, Cat#354234).

[0069] List of antibodies used: DYKDDDDK tag Monoclonal antibody (Wuhan Sanying, Cat#66008-4-Ig); GAPDH Monoclonal antibody (Wuhan Sanying, Cat#60004-1-Ig); Alpha Tubulin Monoclonal antibody (Wuhan Sanying, Cat#66031-1-Ig); Beta Actin Monoclonal antibody (Wuhan Sanying, Cat#66009-1-Ig); NLN Mouse Monoclonal antibody (OriGene, Cat#TA504178); HRP-Goat Anti-Mouse IgG (H+L) (Wuhan Sanying, Cat#SA00001); HRP-Goat Anti-Rabbit IgG (H+L) (Wuhan Sanying, Cat#RGAR301).

[0070] 2. Experimental methods.

[0071] Cell culture: MDA-MB-231 and MDA-MB-468 were cultured in Leibovitz's L-15 medium; Hs 578T were cultured in DMEM medium supplemented with 10 µg / mL recombinant human insulin; BT-549 and HCC1937 were cultured in RPMI-1640 medium; all cell cultures were supplemented with 10% FBS. Cells were cultured at 37°C in a 5% CO2 incubator.

[0072] Stable transfection of cells with lentivirus: Empty vector control virus and stably overexpressed lentivirus were used to infect cells. The procedure was performed according to the product instructions. Cells were cultured normally for 12 hours after infection, and selected using puromycin after 72 hours.

[0073] CCK-8 assay for cell viability: Logarithmic growth phase cells (2-3 × 10⁻⁶) were used... 3 (Numbers / well) were seeded in a 96-well plate with 3 replicates. CCK-8 reagent was added after 0, 12, 24, 36, 48, and 72 hours. After incubation at 37°C for 2 hours, the absorbance was measured at 450 nm.

[0074] Clonal formation experiment: Logarithmic growth phase cells (1-2×10⁻⁶) were used. 3 (1 clone / well) were inoculated into 6-well plates with 3 replicates. After culturing until clones formed, approximately 14 days later, the plates were stained with 1% crystal violet, washed with PBS, air-dried, photographed, and the number and size of clones were counted.

[0075] Scratch assay: Logarithmic growth phase cells were seeded in 6-well plates with 3 replicates. When the cell confluence was 90%, scratches were performed, and the culture medium was replaced with serum-free medium. Photos were taken and the results were analyzed at 0, 24, and 48 h.

[0076] Migration and Invasion Assay: The migration assay used logarithmic growth phase cells (5 × 10⁻⁶) 4 Cells (100 µL / well) were seeded in the upper chamber of a 24-well Transwell chamber. 500 µL of complete culture medium containing 10% FBS was added to the lower chamber to establish a stable chemotactic environment and induce cell migration. For the invasion assay, a layer of matrix gel was pre-coated onto the polycarbonate membrane of the 24-well Transwell chamber to mimic the extracellular matrix; the remaining steps were the same as for the migration assay. Both migration and invasion assays were performed in triplicate. After observing cell adhesion in the lower chamber, the Transwell chamber was removed, washed with PBS, fixed with 4% paraformaldehyde for 30 min, stained with 1% crystal violet, and the cells in the upper chamber were wiped off. After washing and drying, the cells were photographed, counted, and statistically analyzed. The migration assay was completed after 24 hours, and the invasion assay after 36 hours.

[0077] 3. Experimental results.

[0078] (1) Since the expression of NLN in breast cancer cells has not been reported, we further examined the expression of NLN protein in various triple-negative breast cancer cell lines. We found that NLN protein was lowly expressed in MDA-MB-231 and Hs 578T cell lines; highly expressed in MDA-MB-468 and HCC-1937; and almost not expressed in BT-549. This suggests that the NLN-related cellular pathways in BT-549 cells may be extremely weak and not suitable for further study. Figure 9 A). Therefore, the MDA-MB-231 and Hs578T cell lines with low NLN expression were selected to construct a stable NLN overexpression model, and the successful transfection was verified by Western blot experiment. Figure 9 B).

[0079] (2) Since the function of NLN in breast cancer cells has not been reported, we further explored the biological function of NLN using triple-negative breast cancer MDA-MB-231 and Hs578T cells stably overexpressing NLN. To investigate the effect of NLN expression on the proliferation of triple-negative breast cancer cells, we first used the CCK-8 viability assay to reflect the cell proliferation rate in a short period of time. The results showed that, compared with the empty vector control group, NLN overexpression could significantly promote the proliferation of triple-negative breast cancer cells ( Figure 10 ).

[0080] (3) Further colony formation assays were used to examine the independent survival and long-term proliferation potential of cells. The results showed that, compared with the empty vector control group, NLN overexpression significantly promoted the colony formation ability of triple-negative breast cancer cells. These results indicate that NLN can significantly promote the proliferation of triple-negative breast cancer cells. Figure 11 ).

[0081] (4) To investigate the effect of NLN overexpression on the lateral migration ability of triple-negative breast cancer cells, a scratch wound healing assay was used to examine the healing status of MDA-MB-231 and Hs 578T cells stably transfected with NLN overexpression 24h and 48h after scratching. The results showed that in MDA-MB-231 cells, after 24h, the migration distance of the control group was approximately 250µm, while that of the NLN overexpression group was approximately 400µm; after 48h, the trend was consistent, with the migration distance of the control group approximately 300µm and that of the NLN overexpression group approximately 500µm. The same results were obtained in Hs578T cells. These results indicate that NLN can significantly promote the lateral migration ability of triple-negative breast cancer cells. Figure 12 ).

[0082] (5) To investigate the effect of NLN overexpression on the migration and invasion of triple-negative breast cancer cells, the migration and invasion of MDA-MB-231 and Hs 578T cells stably transfected with NLN overexpression were examined using a Transwell assay. The migration and invasion experiments demonstrated that NLN overexpression significantly promoted the migration and invasion of triple-negative breast cancer cells. These results indicate that NLN can promote the migration and invasion of triple-negative breast cancer cells (…). Figure 13 ).

[0083] Example 3: Effects of NLN on the in vivo growth of triple-negative breast cancer and its knockdown therapeutic effect.

[0084] 1. Experimental Materials. The 4T1 mouse breast cancer cell line used in this experiment was derived from our own cells. The experiment involved 5-week-old female BALB / c immunogenic mice (SPF grade, purchased from Beijing Huafukang).

[0085] List of reagents used: NLN lentivirus (Nanjing Zebrafish Biotechnology Co., Ltd.); RPMI-1640 medium (KGI Biotechnology, Cat#KGL1501-500); Superior fetal bovine serum (EcoSy, Cat#FSP500); Trypsin (KGI Biotechnology, Cat#KGA1519-5); Puromycin (Solepro, Cat#P8230); Benzyl sulfonyl fluoride (PMSF) (Solepro, Cat#P0100); Protease inhibitor (PI) (Wuhan Sanying, Cat#PR20016); Prestained protein marker VIII (8-270 kDa) (Seville, Cat#G2089-250UL); Prestained protein marker II (10-200 kDa) (Seville, Cat#G2058-250UL); Tween 20 (Dingguo Changsheng, Cat#MB-P4732); EDTA (Dingguo Changsheng, Cat#AC-0021); TEMED (Dingguo Changsheng, Cat#T7024).

[0086] List of antibodies used: DYKDDDDK tag Monoclonal antibody (Wuhan Sanying, Cat#66008-4-Ig); NLN Mouse Monoclonal antibody (OriGene, Cat#TA504178); GAPDH Monoclonal antibody (Wuhan Sanying, Cat#60004-1-Ig).

[0087] ShNLN sequence: GATCCCCAGACGATACTTGGAAAATTCAAGAGATTTTCCAAGTATCGTCTGGTTTTTTG; Target sequence: CCAGACGATACTTGGAAAA.

[0088] 2. Experimental methods.

[0089] Cell culture: 4T1 cells were cultured in RPMI-1640 medium with 10% FBS added to the culture medium and incubated at 37°C in a 5% CO2 cell culture incubator.

[0090] Stable transfection of cells with lentivirus: Empty vector control virus, stably overexpressed lentivirus, and knockdown lentivirus were used to infect cells. The procedure was performed according to the product instructions. Cells were cultured normally for 12 hours after infection, and selected using puromycin after 72 hours.

[0091] Animal experiments: The experiments involved the establishment of a xenograft model in 5-week-old female BALB / c immunomodulatory mice. The mice were housed in a specific pathogen-free environment (SPF grade), and all experiments were approved by the Ethics Committee of China Medical University, with all procedures conducted in accordance with animal ethics.

[0092] 4T1 cells stably transfected with control Flag and Flag-NLN, and 4T1 cells stably transfected with control NC and shNLN (each cell concentration was 1×10⁻⁶) were used. 6 Cells were suspended in 100 µL of PBS buffer and injected subcutaneously into mice to construct a mouse xenograft tumor model. Tumor volume changes were dynamically monitored after cell injection, and the experiment was terminated before the tumor diameter reached 1.5 cm.

[0093] 3. Experimental results.

[0094] (1) 4T1 is a mouse-derived triple-negative breast cancer cell line. It exhibits high tumorigenesis rate and stable tumor growth in immunocompetent mice, making it more suitable for in vivo tumor microenvironment research. In contrast, MDA-MB-231 and Hs 578T are human cell lines that require inoculation in immunodeficient nude mice, which presents limitations such as a lack of immune microenvironment. Therefore, selecting mouse-derived 4T1 cells can better simulate the tumor progression process under physiological conditions. Thus, we constructed a stable mouse cell line overexpressing NLN ( Figure 14 ).

[0095] (2) Take 1×10 6 A stable 4T1 mouse TNBC cell line, overexpressing either the Flag empty vector control or Flag-NLN, was subcutaneously injected into immune-intelligent BALB / c mice, and tumor growth was dynamically monitored. In vivo tumor-bearing experiments in immunocompetent mice confirmed that NLN can promote the in vivo growth of breast cancer cells. Figure 15 ).

[0096] (3) To verify the role of NLN knockout in in vivo anti-tumor therapy, we constructed a stable transfection model in 4T1 cells and verified the successful construction of the knockdown control group and NLN knockdown group models by Western blot experiments. Figure 16 ). 1×10 6 The above-mentioned cells were inoculated into BALB / c mice for subcutaneous tumor bearing experiments. Growth curves were plotted during the tumor bearing period. The results showed that knockdown of NLN significantly inhibited the in vivo growth of breast cancer cells. The results suggest that knockdown of NLN can have an anti-cancer therapeutic effect. Figure 17 ).

[0097] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. Application of reagents for detecting the expression level of neurolysin (NLN) protein or its encoding gene in the preparation of kits for the diagnosis of breast cancer.

2. The application according to claim 1, characterized in that, The breast cancer mentioned is triple-negative breast cancer.

3. The application according to claim 1, characterized in that, The test samples for this kit are selected from tissues.

4. Application of reagents for detecting the expression level of neurolysin (NLN) protein or its encoding gene in the preparation of kits for assessing the prognosis of breast cancer patients.

5. The application according to claim 4, characterized in that, The prognostic assessment includes predicting the patient's risk of distant metastasis, overall survival, and / or progression-free survival.

6. The application according to claim 4, characterized in that, The breast cancer mentioned is triple-negative breast cancer.

7. Application of neurolysin (NLN) inhibitors in the preparation of drugs for the treatment of breast cancer.

8. The application according to claim 7, characterized in that, The breast cancer mentioned is triple-negative breast cancer.

9. The application according to claim 7, characterized in that, The NLN inhibitor is a shRNA, siRNA, antisense oligonucleotide, or small molecule compound that targets the NLN gene.

10. The application according to claim 7, characterized in that, The drug is used to treat breast cancer patients with high NLN expression.

Images