Application of an immune inducer in preventing and treating citrus huanglongbing disease

Abstract

This invention belongs to the field of plant disease control technology and discloses the application of an immune inducer in the control of citrus Huanglongbing (HLB). The immune inducer is fraxin, a coumarin-based plant secondary metabolite. The immune inducer is used to activate the systemic acquired resistance response in citrus plants, thereby improving the systemic immune resistance level of citrus plants to HLB. This invention provides fraxin exogenously to citrus plants through foliar spraying and root irrigation, which can significantly activate the systemic acquired resistance response and substantially upregulate downstream key defense genes. PR1 , PR2 The expression level of [a specific substance] was reduced. This method can effectively reduce the expression level of [a specific substance] in citrus plants. C The titer of Las is safe and harmless to the environment and plants, significantly inhibiting the proliferation of Huanglongbing fungus in the phloem and alleviating phenotypic symptoms such as leaf yellowing. This invention provides a new approach for the integrated green control of citrus Huanglongbing, and greatly promotes the application and development of natural immune inducers in the control of forest and fruit diseases.

Description

Technical Field

[0001] This invention relates to the field of plant disease control technology, specifically to the application of an immune inducer in the control of citrus Huanglongbing (HLB). Background Technology

[0002] Citrus fruits, including mandarins, oranges, grapefruits, and lemons, belong to the Rutaceae family and are one of the most important fruits in the world due to their widest cultivation area and yield.

[0003] However, in recent years, the citrus industry has faced a devastating challenge. Citrus Huanglongbing (HLB) is caused by *Bacillus phloem* species Asianus (…). Candidatus Liberibacter asiaticus, C Huanglongbing (HLB) is a highly destructive bacterial disease caused by citrus, often referred to as the "cancer" of citrus, and has been listed as a global quarantine disease. The pathogen is primarily spread through the sap-sucking of citrus psyllids, which proliferate rapidly in the phloem tissue, disrupting the plant's nutrient transport system. Citrus plants infected with HLB exhibit symptoms such as mottled yellowing leaves, deformed fruit (red-nosed fruit), and root rot, ultimately leading to weakness and even death of the entire plant.

[0004] For a long time, there has been no specific treatment for citrus Huanglongbing (HLB), and existing control measures mainly rely on a three-pronged strategy: "cutting down diseased trees, planting virus-free seedlings, and spraying chemical pesticides to kill citrus psyllids." However, the long-term and extensive use of chemical pesticides has not only damaged the ecological environment but also accelerated the development of pesticide resistance in psyllids; simply cutting down trees cannot fundamentally protect healthy plants or those still in the latent stage.

[0005] Immune-induced resistance primarily involves activating and regulating the plant's intrinsic immune response system after treatment with immune inducers to resist pathogen invasion. Systemically acquired resistance (SAR) is a form of systemic immunity activated through signal transduction, protecting uninfected distal parts of the plant from secondary infection. Esculetin (6,7-dihydroxycoumarin) is a natural plant secondary metabolite that has shown potential and application prospects in agricultural pest and disease control. However, there are currently no reports on the use of franculetin for the control of citrus Huanglongbing (HLB), and its applicability in this field remains unknown. Therefore, this application is submitted. Summary of the Invention

[0006] This invention provides the application of immune inducers in the control of citrus Huanglongbing (HLB) to improve the resistance of citrus. It utilizes the plant secondary metabolite fraxin for HLB control, and through foliar spraying or soil irrigation, it can significantly upregulate downstream defense genes in plants. PR1 , PR2The expression of [a specific substance] activates systemic acquired resistance (SAR) in citrus, thereby significantly inhibiting the proliferation of Huanglongbing fungus in the phloem.

[0007] The present invention adopts the following technical solution: The purpose of this invention is to provide an immune inducer for the prevention and control of Huanglongbing (HLB) in citrus. The immune inducer is fraxin, a coumarin plant secondary metabolite. The immune inducer is used to activate the systemic acquired resistance response of citrus plants to improve the systemic immune resistance level of citrus plants to HLB.

[0008] As a preferred technical solution, the immune inducer activates the systemic acquired resistance response in citrus plants and upregulates downstream defense genes. PR1 , PR2 The amount of expression.

[0009] The application of the immune inducer provided in this invention in the prevention and control of citrus Huanglongbing (HLB) involves providing exogenous fraxin to citrus, which can significantly activate downstream defense genes in citrus. PR1 , PR2 The expression of [a specific substance] induces acquired resistance, overcoming the bottleneck of direct fungicides being unable to kill Huanglongbing (HLB). This invention significantly reduces [a specific substance] in the phloem of citrus plants by enhancing the plant's own baseline immunity. C The titer of Las alleviated phenotypic symptoms such as leaf yellowing.

[0010] Furthermore, as a natural secondary metabolite derived from plants, fraxin has good environmental compatibility and is unlikely to induce drug resistance in pathogens, making it an environmentally friendly green disease prevention technology.

[0011] As a preferred technical solution, the immune inducer upregulates downstream defense genes. PR1 , PR2 The expression level of [a specific substance] was adjusted to inhibit the proliferation of Huanglongbing fungus in the phloem of citrus plants.

[0012] As a preferred technical solution, the immune inducer is applied to citrus plants via an exogenous method.

[0013] As a preferred technical solution, fraxin is applied to the roots of citrus plants by soil drenching.

[0014] As a preferred technical solution, citrus plants are treated with an aqueous solution of fraxin with a mass concentration of 0.1~1.0 mM. Preferably, an aqueous solution of fraxin with a concentration of 1 mM is used in this invention.

[0015] As a preferred technical solution, the method for preparing the fraxin aqueous solution is as follows: Weigh out fraxetine, add dimethyl sulfoxide, shake to aid dissolution, and obtain fraxetine mother liquor; The fraxin mother liquor is obtained by adding ddH2O.

[0016] As a preferred technical solution, the roots of citrus plants are treated with a root irrigation of 1:100 of agent to soil volume, wherein the agent is an aqueous solution of fraxin.

[0017] This invention provides 1 mM fraxin to citrus trees through foliar spraying and root irrigation, significantly activating the systemic acquired resistance (SAR) response and substantially upregulating key downstream defense genes. PR1 , PR2 The expression level of [a specific substance] was reduced. This method can effectively reduce the expression level of [a specific substance] in citrus plants. C The titer of Las is safe and harmless to the environment and plants, thus significantly inhibiting the proliferation of Huanglongbing fungus in the phloem and alleviating phenotypic symptoms such as leaf yellowing.

[0018] As a preferred technical solution, the fraxin aqueous solution was applied externally to healthy late-maturing orange seedlings through soil drenching, and then the gene expression level was detected. The method for detecting the gene expression level is as follows: Two days after applying the fertilizer, cut citrus leaves and flash-freeze them with liquid nitrogen. Total RNA was extracted using a plant RNA extraction kit and reverse transcribed into cDNA. Citrus GAPDH As an internal reference gene, specific primers are used to target downstream defense genes. PR1 and PR2 Perform real-time quantitative fluorescence analysis.

[0019] As a preferred technical solution, Regarding the defense gene PR1 The specific primer sequences used for quantitative fluorescence analysis are as follows: RT-CsPR1-F:AAATGTGGGTGAATGAGAAAGC; RT-CsPR1-R:ATTATTGTTGCACGTCACCTTG; Regarding the defense gene PR2 The specific primer sequences used for quantitative fluorescence analysis are as follows: RT-CsPR2-F:TTCCACTGCCATCGAAACTG; RT-CsPR2-R:GTAATCTTGTTTAAATGAGCCTCTTG.

[0020] Compared with the prior art, the present invention has the following advantages and beneficial effects: The application of the immune inducer provided in this invention in the prevention and control of citrus Huanglongbing (HLB) involves providing exogenous fraxin to citrus, which can significantly activate downstream defense genes in citrus. PR1 , PR2 The expression of [a specific substance] induces acquired resistance, overcoming the bottleneck of direct fungicides being unable to kill Huanglongbing (HLB). This invention significantly reduces [a specific substance] in the phloem of citrus plants by enhancing the plant's own baseline immunity. C The titer of Las alleviated phenotypic symptoms such as leaf yellowing.

[0021] Meanwhile, fraxin, as a natural secondary metabolite derived from plants, has good environmental compatibility and is unlikely to induce drug resistance in pathogens, making it an environmentally friendly green disease prevention technology. Attached Figure Description

[0022] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of the present invention and should not be considered as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort. In the drawings: Figure 1 Phenotypic diagrams of leaves treated with different concentrations of fraxin.

[0023] Figure 2 This figure shows the expression of defense genes in leaves under different concentrations of fraxin. *** P <0.001.

[0024] Figure 3 Leaves after treatment with different concentrations of fraxin C Las content.

[0025] Figure 4 This invention relates to the defense genes in citrus leaves after application of 1 mM fraxin. PR1 , PR2 Quantitative results of relative expression levels; the values ​​in the figure represent the mean ± standard deviation of three independent trials. An asterisk indicates a significant difference compared to the simulated control group (Duncan's test, *). P <0.05,** P <0.01). In the figure, "Mock" represents the blank control group, and "Esculetin" represents the experimental group treated with fraxetine.

[0026] Figure 5 The results of soil irrigation with a 1mM fraxin solution for 7 days in this invention showed that the roots and leaves of diseased plants... CLas content. Values ​​are expressed as the mean ± standard deviation of three independent trials. An asterisk indicates a significant difference compared to the simulated control group (Duncan's test, *). P <0.05,** P <0.01). Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the embodiments and accompanying drawings. The illustrative embodiments and descriptions of this invention are only used to explain this invention and are not intended to limit this invention.

[0028] In the following description, numerous specific details are set forth in order to provide a thorough understanding of the invention. However, it will be apparent to those skilled in the art that these specific details are not necessary to practice the invention. In other embodiments, well-known structures, materials, or methods have not been specifically described in order to avoid obscuring the invention.

[0029] Throughout this specification, references to "an embodiment," "an example," or "an example" mean that a particular feature, structure, or characteristic described in connection with that embodiment or example is included in at least one embodiment of the invention. Therefore, the phrases "an embodiment," "an example," "an example," or "an example" appearing in various places throughout the specification do not necessarily refer to the same embodiment or example. Furthermore, specific features, structures, or characteristics can be combined in one or more embodiments or examples in any suitable combination and / or sub-combination. Moreover, those skilled in the art will understand that the illustrations provided herein are for illustrative purposes and are not necessarily drawn to scale. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0030] In the description of this invention, the terms "front", "rear", "left", "right", "up", "down", "vertical", "horizontal", "high", "low", "inner", and "outer" indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are only for the convenience of describing this invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limiting the scope of protection of this invention.

[0031] The "range" disclosed in this application is defined by a lower limit and an upper limit. A given range is defined by selecting a lower limit and an upper limit, which define the boundaries of a particular range. Ranges defined in this way can include or exclude endpoints and can be arbitrarily combined; that is, any lower limit can be combined with any upper limit to form a range. For example, if ranges of 60–120 and 80–110 are listed for a specific parameter, it is understood that ranges of 60–110 and 80–120 are also expected. Furthermore, if minimum range values ​​of 1 and 2 are listed, and if maximum range values ​​of 3, 4, and 5 are listed, then the following ranges are all expected: 1–3, 1–4, 1–5, 2–3, 2–4, and 2–5. In this application, unless otherwise stated, the numerical range "a–b" represents a shortened representation of any combination of real numbers between a and b, where a and b are real numbers. For example, the numerical range "0~5" indicates that all real numbers between "0~5" have been listed in this article; "0~5" is simply a shortened representation of these numerical combinations. Furthermore, when a parameter is stated as an integer ≥2, it is equivalent to disclosing that the parameter is, for example, an integer such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.

[0032] Unless otherwise specified, all embodiments and optional embodiments of this application can be combined to form new technical solutions.

[0033] Unless otherwise specified, all technical features and optional technical features of this application may be combined to form new technical solutions.

[0034] Unless otherwise specified, the terms "comprising" and "including" as used in this application can be open-ended or closed-ended. For example, "comprising" and "including" can mean that other components not listed may also be included, or that only the listed components may be included. Example 1:

[0035] To determine the optimal effective concentration of the plant secondary metabolite fraxin in the infiltration treatment of leaves infected with citrus Huanglongbing (HLB), and to evaluate its inhibitory effect on HLB titer and its impact on downstream defense genes. PR1 , PR2 Its activating effect.

[0036] Experimental materials: Infected (carrier) C Las) Ziyang orange leaves.

[0037] Concentration gradient settings: The concentration gradient of fraxetin aqueous solution was set to 0 mM (water control), 0.1 mM, 0.5 mM, 1.0 mM, 1.5 mM and 2.0 mM, with 6 biological replicates for each concentration gradient.

[0038] Treatment method: Cut off the cap of the 1.5 ml centrifuge tube and add 1 ml of the corresponding concentration of fraxin to each tube. Insert the petiole of a single Ziyang orange leaf into the centrifuge tube, and tightly wrap the tube opening with paraffin tape to minimize solution evaporation. Place the treated detached leaves in a ZRY series cold light source plant growth chamber with a preset temperature of 28°C for cultivation. Regularly check the petiole's wettability daily. If the liquid level drops and the petiole is not completely wetted, promptly add the corresponding concentration of fraxin to the 1 ml mark.

[0039] Sampling and testing: (1) From Figure 1 As can be seen, after 5 days of treatment, the leaves of the 0 mM water control group exhibited typical Huanglongbing (HLB) mottling yellowing and chlorosis symptoms. As the concentration gradually increased to 1.0 mM, the yellowing symptoms were significantly alleviated, and the leaves maintained a healthy, uniform green state with no obvious toxic spots. In the 1.5 mM treatment group, large areas of dark brown necrosis appeared on the midrib and surrounding tissues of the leaves. The leaves of the 2.0 mM treatment group showed severe dehydration, yellowing, and necrotic lesions, confirming that excessively high concentrations of fraxin can be toxic to plant tissues and trigger a strong hypersensitivity reaction.

[0040] (2) RNA was extracted from mesophyll tissue and reverse transcribed into cDNA. RT-qPCR was used to detect key defense genes. PR1 , PR2 The relative expression levels. The expression of defense genes in leaves under different concentrations of fraxin are shown in [the table / reference needed]. Figure 2 As shown in the figure, exogenous fraxin absorbed by the petiole can strongly induce the transcription of marker genes in the systemic acquired resistance pathway.

[0041] for PR1 Gene: Its relative expression level was significantly upregulated at a concentration of 1.0 mM, and reached an absolute peak at a concentration of 1.5 mM. When the concentration was increased to 2.0 mM, the expression level dropped sharply to near the control group level, presumably because the large-scale cell death caused by the high concentration blocked normal transcriptional activity.

[0042] for PR2 Gene expression: Expression levels showed a clear stepwise increase with increasing fraxetin concentration. A significant upregulation first occurred at 1.0 mM, followed by a slight decrease at 1.5 mM, but reached its maximum at 2.0 mM. This suggests... PR2 In addition to participating in routine immune defense, genes may also be highly involved in the stress response to tissue necrosis under high concentrations, acting as stress-related genes.

[0043] (3) DNA was extracted from leaf vein tissue and detected by PCR using a specific probe method. CLas pathogen titer. Leaves treated with different concentrations of fraxin. C Las content is shown in [reference]. Figure 3 As shown in the figure, the absolute quantitative results of probe-based PCR using extracted leaf vein DNA indicate that the uptake of fraxin effectively inhibits the proliferation of pathogens within the leaf vein system.

[0044] Among them, the 0 mM water control group C The Las titer was at its highest level. As the concentration of fraxetin increased, C Las titers exhibited a U-shaped trend of "first decreasing and then slightly increasing." (1.0 mM concentration group) C The Las titer decreased significantly to the lowest level in the experimental group, demonstrating the strongest in vivo antibacterial and clearance effects. When the concentration exceeded 1.0 mM (such as 1.5 mM and 2.0 mM), the pathogen titer actually increased slightly. This is most likely due to severe HR necrosis in the tissue, which disrupted the physiological function of the defense system of the living host cells.

[0045] Based on the above experimental results, 1.0 mM fraxin is the optimal effective concentration for treating Huanglongbing (HLB) in Ziyang sweet orange leaves. At this concentration, the solution can maximally reduce the amount of HLB within the tissue. C Las titers not only reduce leaf yellowing symptoms but also robustly activate downstream defense genes. PR1 and PR2 It is a way of expressing oneself that will not elicit a destructive HR response.

[0046] Example 2: Fraxin E activates SAR response and upregulates defense genes PR1 , PR2 expression Preparation of disease-free seedlings: Take healthy late-maturing orange seeds, remove the outer seed coat, germinate them, and then transfer them to nutrient soil. Incubate at 28℃ with 16 h·d light. -1 Healthy citrus seedlings are produced by cultivating them in a greenhouse for one month.

[0047] Preparation and processing of fraxetine solution: Purchase fraxetine standard with a purity ≥98% (purchased from Beijing Puxitang Biotechnology Co., Ltd., CAS No.: 305-01-1). Accurately weigh 100 mg of fraxetine (molar mass 178.14 g / mol) using an analytical balance, transfer it to a graduated 10 mL centrifuge tube, and slowly add approximately 5.0 mL of DMSO (dimethyl sulfoxide), vortexing to aid dissolution. After the solution cools to room temperature, add DMSO to a final volume of 5.61 mL using a pipette, invert and mix well to obtain a 100 mmol / L fraxetine stock solution. Accurately pipette 100 μL of the stock solution of the above two substances dissolved in 100 mmol / L DMSO into two separate 10 mL centrifuge tubes, add ddH2O to a final volume of 10 mL, and prepare a 1 mM fraxetine aqueous solution. The control group used sterile water containing the same concentration of solubilizer (DMSO) (without fraxetin). The solution was applied topically to healthy late-maturing orange seedlings via soil drenching.

[0048] Gene expression level detection: Citrus leaves were harvested two days after external application and flash-frozen in liquid nitrogen. Total RNA was extracted using the EASYspin Plant RNA Rapid Extraction Kit (Aidelai Biotechnology, catalog number: RN09) and reverse transcribed into cDNA. Citrus... GAPDH As an internal reference gene, specific primers are used to target downstream defense genes. PR1 and PR2 Real-time qPCR analysis was performed (results are shown in [link to results]). Figure 4 ).

[0049] in: GAPDH Internal reference gene ( Cs_ont_5g044290 The primer sequence for ) is: RT-GADPH-F: GCTTTCCGTGTACCCACTGT (denoted as SEQ ID NO: 1); RT-GADPH-R: CCTGACTCCGCCTTGATGG (denoted as SEQ ID NO: 2).

[0050] Regarding the defense gene PR1 ( Cs_ont_8g027120 The specific primer sequences used for quantitative fluorescence analysis are: RT-CsPR1-F: AAATGTGGGTGAATGAGAAAGC (referred to as SEQ ID NO: 3); RT-CsPR1-R:ATTATTGTTGCACGTCACCTTG (denoted as SEQ ID NO: 4).

[0051] Regarding the defense gene PR2 ( Cs_ont_9g018340 The specific primer sequences used for quantitative fluorescence analysis are: RT-CsPR2-F: TTCCACTGCCATCGAAACTG (denoted as SEQ ID NO: 5); RT-CsPR2-R: GTAATCTTGTTTAAATGAGCCTCTTG (denoted as SEQ ID NO: 6).

[0052] The results showed that exogenous soil irrigation with 1 mM fraxin significantly upregulated [the condition]. PR1 and PR2 The relative expression levels of the gene demonstrate that fraxetin, as an immune inducer, successfully activated the plant's SAR defense pathway.

[0053] Example 3: Exogenous fraxetin effectively reduces C Las titers in citrus fruits Leaf circumference grafting C Las: Select healthy late-maturing orange seedlings with uniform growth vigor, and use seedlings carrying... C The leaf discs of Las were grafted to transmit the virus, and then cultured in a ZRY series cold light source plant growth box until the pathogen systemically infected the plant.

[0054] Treatment: Two months after inoculation, when PCR testing confirms that the plants are infected. C During the Las treatment, the plants were divided into groups for application. A 1 mM fraxin solution was used for soil drenching (drug-to-soil volume ratio 1:100), while the control group received an equal volume of sterile water. Treatments were administered every 7 days for a total of 3 treatments.

[0055] Quantitative detection and evaluation of pathogen titers: Seven days after the last treatment, mature leaves from the same location on each group of plants were collected, and leaf vein DNA was extracted. Using targeted... C The specific probe and primers for Las 16S rDNA were used for absolute quantification by TaqMan ProbeqPCR. The probe sequence was AGACGGGTGAGTAACGCG (SEQ ID NO: 7), and the primer sequences were: HLBasf: TCGAGGCGCGTATGCAATACG (SEQ ID NO: 8) and HLBasr: GCGTTATCCCGTAGAAAAAGGTAG (SEQ ID NO: 9).

[0056] result( Figure 5 This indicates that plants treated with fraxin B have [a certain level of] [something related to their internal structure]. C The copy number of the Las pathogen was significantly lower than that of the control group, showing a strong inhibitory effect on proliferation.

[0057] In summary, the application of the immune inducer (plant secondary metabolite fraxin) provided in this invention in the control of citrus Huanglongbing (HLB) demonstrates that using fraxin, a plant secondary metabolite, for the control of HLB, through foliar spraying or soil irrigation, can significantly upregulate downstream defense genes in plants. PR1 , PR2 The expression of [a specific substance] activates acquired resistance in citrus systems, and this method can effectively reduce [a specific trait] in citrus plants. C The titer of Las is safe and harmless to the environment and plants, thus significantly inhibiting the proliferation of Huanglongbing fungus in the phloem and alleviating phenotypic symptoms such as leaf yellowing. This invention provides a new approach for the integrated green control of citrus Huanglongbing, and greatly promotes the application and development of natural immune inducers in the control of forest and fruit diseases.

[0058] Meanwhile, the fraxin used in this invention is a natural secondary metabolite derived from plants, which has good environmental compatibility and is not likely to induce drug resistance in pathogens. It is an environmentally friendly green disease prevention technology.

[0059] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of an immune inducer in the prevention and control of citrus Huanglongbing (HLB), characterized in that, The immune inducer is fraxin, a coumarin plant secondary metabolite. The immune inducer is used to activate the systemic acquired resistance response of citrus plants to improve the systemic immune resistance level of citrus plants to Huanglongbing (HLB).

2. The application of an immune inducer according to claim 1 in the prevention and control of citrus Huanglongbing (HLB), characterized in that, The immune inducer activates the systemic acquired resistance response in citrus plants and upregulates downstream defense genes. PR1 , PR2 The amount of expression.

3. The application of an immune inducer according to claim 2 in the prevention and control of citrus Huanglongbing, characterized in that, The immune inducer upregulates downstream defense genes. PR1 , PR2 The expression level of [a specific substance] was adjusted to inhibit the proliferation of Huanglongbing fungus in the phloem of citrus plants.

4. The application of an immune inducer according to claim 1 in the prevention and control of citrus Huanglongbing, characterized in that, The immune inducer is applied to citrus plants via exogenous means.

5. The application of an immune inducer according to claim 1 in the prevention and control of citrus Huanglongbing, characterized in that, Fraxin was applied to the roots of citrus plants by soil drenching.

6. The application of an immune inducer according to claim 1 in the prevention and control of citrus Huanglongbing, characterized in that, Citrus plants were treated with an aqueous solution of fraxin at a concentration of 0.1–1 mM.

7. The application of an immune inducer according to claim 6 in the prevention and control of citrus Huanglongbing, characterized in that, The method for preparing the fraxin aqueous solution is as follows: Weigh out fraxetine, add dimethyl sulfoxide, shake to aid dissolution, and obtain fraxetine mother liquor; The fraxin mother liquor is obtained by adding ddH2O.

8. The application of an immune inducer according to claim 6 in the prevention and control of citrus Huanglongbing, characterized in that, The roots of citrus plants were treated with a root irrigation solution of fraxinus 1:100, using a drug-to-soil volume ratio of 1:

100.

9. The application of an immune inducer according to claim 8 in the prevention and control of citrus Huanglongbing, characterized in that, After the fraxin aqueous solution was applied externally to healthy late-maturing orange seedlings via soil drenching, the gene expression level was detected. The method for detecting the gene expression level is as follows: Two days after applying the fertilizer, cut citrus leaves and flash-freeze them with liquid nitrogen. Total RNA was extracted using a plant RNA extraction kit and reverse transcribed into cDNA. Citrus GAPDH As an internal reference gene, specific primers are used to target downstream defense genes. PR1 and PR2 Perform real-time quantitative fluorescence analysis.

10. The application of an immune inducer according to claim 9 in the prevention and control of citrus Huanglongbing, characterized in that, Regarding the defense gene PR1 The specific primer sequences used for quantitative fluorescence analysis are as follows: RT-CsPR1-F:AAATGTGGGTGAATGAGAAAGC; RT-CsPR1-R:ATTATTGTTGCACGTCACCTTG; Regarding the defense gene PR2 The specific primer sequences used for quantitative fluorescence analysis are as follows: RT-CsPR2-F:TTCCACTGCCATCGAAACTG; RT-CsPR2-R:GTAATCTTGTTTAAATGAGCCTCTTG.

Images