Application of plantago asiatica l. extract in preparation of medicine for preventing and treating rice diseases

Abstract

The application discloses application of a plantago waste plant extract in preparation of a medicine for preventing and treating rice diseases, relates to the field of biological pesticides, and discloses a plantago waste plant after the collection of plantago asiatica L. and the collection of plantago asiatica L. seeds; the plantago waste plant extract comprises at least one of a water extract, an alcohol extract and different-polarity-component extracts; the different-polarity-component extracts are components of petroleum ether, dichloromethane, ethyl acetate, n-butanol and the remaining water of the alcohol extract of the plantago waste plant after further separation. The plantago waste plant extract has inhibiting effects on main diseases such as rice sheath blight, rice blast and white leaf blight; especially, different-polarity components can effectively prevent and treat common diseases such as rice sheath blight, rice blast and white leaf blight, provide a theoretical support for developing new pesticides for preventing and treating rice diseases, and have important significance.

Description

Technical Field

[0001] This invention relates to the field of biological pesticides, specifically to the application of an extract from waste plantain plants in the preparation of drugs for controlling rice diseases. Background Technology

[0002] Rice sheath blight, rice blast, and bacterial blight are three major diseases in rice production, and currently, control relies mainly on chemical pesticides. Commonly used agents include triazoles (such as difenoconazole), methoxyacrylates (such as pyraclostrobin), and thiazoles (such as copper thiamethoxam). Control methods typically involve regular spraying or application at the early stage of disease. Plants of the genus Plantago (such as Plantago asiatica and Plantago asiatica var. chinensis) have been reported to contain chemical components such as flavonoids, phenylethanol glycosides, iridoids, and polysaccharides. Some studies have confirmed that their extracts have inhibitory effects on Escherichia coli, Staphylococcus aureus, and Pseudomonas aeruginosa, but there are fewer reports on their antibacterial effects against plant pathogens. However, existing research mostly focuses on their medicinal value or a few standard extracts, and there are no systematic antibacterial studies on discarded Plantago asiatica plants, nor are there any systematic reports on the use of different polar parts of Plantago asiatica for the control of related diseases such as rice sheath blight, rice blast, and bacterial blight. Summary of the Invention

[0003] The purpose of this invention is to at least solve one of the technical problems existing in the prior art, and to provide an application of a waste plant extract from plantain in the preparation of drugs for the prevention and control of rice diseases.

[0004] The technical solution of the present invention is as follows: Application of a Plantago asiatica waste plant extract in the preparation of a drug for controlling rice diseases, wherein the waste plant is Plantago asiatica, a plant of the Plantaginaceae family. Plantago asiatica L. Waste plants after the psyllium husks have been harvested; The plant extract from waste plantain includes at least one of water extract from waste plantain, alcohol extract from waste plantain, and extracts of different polarities; the extracts of different polarities are components of petroleum ether fraction, dichloromethane fraction, ethyl acetate fraction, n-butanol fraction, and residual water fraction further separated from the alcohol extract from waste plantain. The rice diseases mentioned include rice sheath blight pathogen. Rhizoctonia solani Rice blast fungus Magnaporthe oryzae Bacterium oxysporum Xanthomonas oryzae pv. oryzae At least one of them.

[0005] Preferably, the method for preparing the water extract of the waste plantain plant is as follows: Take discarded plant material from the front of the plant (it can be crushed or directly added), add pure water, decoct and extract 2-4 times, each time for 0.5-1.5 hours, filter, combine the filtrates, concentrate under reduced pressure, and you will get the product.

[0006] Preferably, the preparation method of the ethanol extract of waste plantain plants is as follows: take waste plantain plants (which can be crushed or directly added), add ethanol, reflux extract 2-4 times, each time for 0.5-1.5 hours, filter, combine the filtrates, and recover ethanol under reduced pressure until there is no alcohol smell, and the product is obtained.

[0007] Preferably, the volume concentration of the ethanol is 50%-80%.

[0008] Preferably, the preparation method of the extracts of components with different polarities is as follows: Add the ethanol extract of the waste plant of Plantago asiatica to distilled water, stir or sonicate to disperse it evenly, and perform gradient extraction with petroleum ether, dichloromethane, ethyl acetate and n-butanol in sequence; collect the extracts of each fraction, recover the solvent under reduced pressure and evaporate to dryness until no organic solvent residue is left, thus obtaining the petroleum ether fraction, dichloromethane fraction, ethyl acetate fraction, n-butanol fraction and the remaining water fraction after concentration of the remaining aqueous phase after extraction.

[0009] Preferably, in gradient extraction, each solvent is used for extraction 3-5 times.

[0010] The beneficial effects of this invention are: (1) The plant extract of the waste plant of the present invention has an inhibitory effect on major diseases such as rice sheath blight, rice blast, and bacterial blight; especially its different polar parts can effectively prevent and control common diseases such as rice sheath blight, rice blast, and bacterial blight.

[0011] (2) This invention realizes the high-value utilization of waste plants in the plantain planting industry, turning waste into treasure, reducing resource waste and the potential risks brought about by returning to the field.

[0012] (3) This invention provides candidate substances for environmentally friendly plant-derived pesticides for green prevention and control of rice diseases, reduces dependence on chemical pesticides, and provides theoretical support for the development of new pesticides for the prevention and control of rice diseases, which is of great significance. Attached Figure Description

[0013] Figure 1 To investigate the antibacterial effects of extracts of different polarities against *Bacillus oryzae*, the following groups were selected: A: water extract group; B: 60% alcohol extract group; C: petroleum ether extract group; D: dichloromethane extract group; E: ethyl acetate extract group; F: n-butanol extract group; G: residual water extract group. Each group was ordered sequentially from low to high concentration (Y1-Y5) according to the blank control group (CK).

[0014] Figure 2To evaluate the antibacterial effects of extracts from different polar fractions against *Rhizoctonia solani*, the following groups were selected: H: water extract group, I: 60% alcohol extract group, J: petroleum ether fraction group, K: dichloromethane fraction group, L: ethyl acetate fraction group, M: n-butanol fraction group, and N: residual water fraction group. Each group was ordered in ascending order of drug concentration (Y1-Y5) according to the blank control group (CK).

[0015] Figure 3 The effect of extracts from waste plantain plants on the growth curve of Guy11.

[0016] Figure 4 The effect of extracts from waste plantain plants on the growth phenotype of Guy11.

[0017] Figure 5 The effect of extracts from waste plantain plants on mycelial morphology (scale bar length = 20 μm).

[0018] Figure 6 The effect of extracts from waste plantain plants on the dry weight of mycelia.

[0019] Figure 7 The effect of extracts from waste plantain plants on spore morphology (scale bar length = 10 μm).

[0020] Figure 8 The effects of extracts from discarded Plantago asiatica plants on mycelial physiological and biochemical indicators; A: Soluble protein assay results; B: Malondialdehyde content assay results; C: Pyruvate content assay results; D: Malate dehydrogenase activity assay results; E: CAT enzyme activity assay results; F: Chitinase activity assay results; G: Changes in cell membrane permeability; H: Ergosterol content assay results. Note: Compared with the control group, This indicates a significant difference (p<0.05); This indicates a highly significant difference (p<0.01).

[0021] Figure 9 The effect of extracts from discarded plants before removal from the vehicle on mycelial morphology was investigated using scanning electron microscopy. Detailed Implementation

[0022] The embodiments of the present invention are described in detail below. These embodiments are exemplary and are only used to explain the present invention, and should not be construed as limiting the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0023] Example 1: Preparation method of extract from waste plantain plants The plantain plants used in this embodiment are: discarded plants after the harvesting of plantain seeds (hereinafter referred to as: discarded plants). The collected plant specimens were obtained from the plantain planting base in Taihe County, Jiangxi Province, and were identified as Plantain (Plantago asiatica), a plant of the Plantaginaceae family. Plantago asiatica L.).

[0024] (1) Standardized preparation of waste plant samples from Plantago asiatica Take the above-ground parts of the plant that are discarded after harvesting the plantain seeds (discarded plants after removing the seeds), air dry them naturally or dry them at low temperature, then crush and sieve them.

[0025] Preparation of water extract: Take 600g of waste plant of Plantago asiatica, crush it and pass it through a No. 2 sieve. Add 8 times the volume of pure water, decoct and extract twice, 1 hour each time. Filter, combine the filtrates, and concentrate under reduced pressure until the crude drug content is 1g / mL to obtain water extract. Store at 4℃ for later use.

[0026] Preparation of 60% ethanol total extract: Take 600g of waste plantlets from Plantago asiatica, crush them and pass them through a No. 2 sieve. Add 8 times the volume of 60% ethanol, reflux and extract twice, 1 hour each time. Filter, combine the filtrates, and recover the ethanol under reduced pressure until there is no alcohol odor to obtain the 60% ethanol extract. Store at 4℃ for later use.

[0027] (2) Separation of different polarity sites (liquid-liquid extraction) Add an appropriate amount of distilled water to the 60% alcohol extract and stir or sonicate to ensure uniform dispersion (or suspension). Perform a gradient extraction with petroleum ether, dichloromethane, ethyl acetate, and n-butanol, three times for each solvent. Collect the extracts from each fraction separately, recover the solvent under reduced pressure, and evaporate to dryness until no organic solvent residue remains. This yields the petroleum ether fraction, dichloromethane fraction, ethyl acetate fraction, and n-butanol fraction. The remaining aqueous phase after extraction is concentrated and evaporated to dryness to obtain the residual aqueous fraction; store at 4°C for later use.

[0028] Test Example 1: Method for Evaluating Antibacterial Activity Test strain: Rice sheath blight pathogen ( Rhizoctonia solani Rice blast fungus ( Magnaporthe oryzae, Guy11 (fungus) and rice bacterial blight fungus ( Xanthomonas oryzae pv. oryzae (bacteria); strains of rice blast fungus FXPS001, rice sheath blight fungus FXPS051, and rice bacterial blight fungus were all purchased from Hangzhou Fengxun Biotechnology Co., Ltd.

[0029] (1) Experimental method (mycelial growth rate method, applicable to rice sheath blight fungus and rice blast fungus): Prepare potato dextrose agar (PDA) medium, sterilize it, and then cool it to 45-50℃.

[0030] The extract to be tested and the positive drug were mixed evenly with PDA medium at different concentrations and poured into petri dishes to prepare drug-containing plates. At the same time, PDA medium with only the corresponding solvent was added as a blank control to eliminate the influence of the solvent itself on the growth of pathogens.

[0031] Fresh, uniformly aged mycelium cakes with a diameter of 5 mm were inoculated in the center of the plate.

[0032] Incubate at 25℃ for 11 days and measure the colony diameter.

[0033] Calculate the inhibition rate using the following formula: ; Among them, the diameter of the control colony is the diameter of the blank control colony, and the diameter of the treated colony is the diameter of the colony treated with the extract to be tested or the positive drug.

[0034] (2) Experimental method (shaking culture + PCR detection, applicable to bacterial blight pathogen) Shaking culture: The strain was inoculated into KB liquid medium and cultured at 28°C with shaking at 180 rpm until OD. 600 =0.6-0.8. Different concentrations of the test extract and positive control were added, and the mixture was cultured for another 16 hours until the bacteria were in the logarithmic growth phase. A blank control was prepared by adding only an equal volume of the corresponding solvent to the liquid culture medium.

[0035] PCR detection: Bacterial cells were collected by centrifugation, and genomic DNA was extracted. Real-time quantitative PCR (qPCR) was performed using primers specific to *Bacillus thuringiensis* (e.g., 16S rDNA or hrp gene), and the inhibition rate was calculated based on the DNA copy number. ; Among them, the control copy number is the blank control bacterial cell DNA copy number, and the treatment copy number is the DNA copy number of the extract to be tested or the positive drug; The specific primer sequences for the bacterial blight pathogen are as follows: FX0647F: 5'GTACCAGACAAAGCCGTAGGTG 3', see SEQ ID NO.1; FX0647R: 5'CTCAAAGAAGTGCTGCGTGAT 3', see SEQ ID NO.2, length 150bp.

[0036] Calculate the half-maximal effective concentration (EC50) of each extract. 50 The test results are shown in Table 1 and Figure 1 , Figure 2 EC 50This refers to the concentration required to achieve half the effect (50% kill rate). The smaller the value, the lower the concentration required to achieve the same effect, and the stronger the drug's efficacy.

[0037] Table 1. EC50 of different polarity parts of discarded Plantago asiatica plants against plant pathogens. 50 value

[0038] from Figure 1 , Figure 2 As shown in Table 1, the extracts from different phases of waste plantain plants exhibited certain antibacterial activity against rice sheath blight, rice blast fungus, and bacterial blight at different mass concentrations.

[0039] Regarding the inhibitory activity against rice blast fungus, experimental results showed that different extracts of Plantago asiatica exhibited varying degrees of inhibitory effects on the fungus, with their EC50 values ​​being [missing information]. 50 The values ​​varied significantly, ranging from 0.299 mg / mL to 246.6 mg / mL. The petroleum ether fraction exhibited the strongest antibacterial activity, with an EC50 value of [missing value]. 50 The value was only 0.299 mg / mL, with a coefficient of determination R. 2 The value was 0.985, with a 95% confidence interval of 0.8786–1.874, indicating that this region exhibited the most stable and reliable antibacterial effect. The second most stable region was the dichloromethane region, with EC... 50 The EC value of the ethyl acetate fraction was 0.595 mg / mL. 50 EC value of 1.098 mg / mL, 60% alcohol fraction 50 The EC values ​​for the n-butanol extract and water extract were 15.17 mg / mL. 50 The values ​​were 19.5 mg / mL and 44.47 mg / mL, while the inhibitory activity was weakest in the remaining water fraction, EC 19.5 mg / mL and 44.47 mg / mL, respectively. 50 The value was as high as 246.6 mg / mL.

[0040] In the antibacterial experiment against *Rhizoctonia solani*, different extracts of *Plantago asiatica* EC... 50 The values ​​ranged from 0.351 mg / mL to 56.55 mg / mL. Among them, the petroleum ether fraction showed the strongest inhibitory activity, EC 100%. 50 The value was 0.351 mg / mL, followed by the EC value of the ethyl acetate fraction. 50 The value was 0.944 mg / mL, and the EC value of the dichloromethane fraction was... 50 The EC value was 3.275 mg / mL, and the value of the n-butanol fraction was... 50 EC50 of 60% ethanol extract with a concentration of 8.874 mg / mL 50 The value was 17.79 mg / mL, and the inhibitory activity of the water extract was weak. EC 50The value was 18.65 mg / mL, and the inhibitory activity was weakest in the remaining water fraction, EC 50 The value was 56.55 mg / mL.

[0041] In the antibacterial experiment of *Bacillus thuringiensis*, different extracts of *Plantago asiatica* EC showed significant antibacterial activity. 50 The values ​​ranged from 0.4137 to 74.15 mg / mL. Among them, the petroleum ether fraction showed the strongest inhibitory activity, EC 100%. 50 The value was 0.4137 mg / mL, followed by the EC value of the ethyl acetate fraction. 50 The value was 0.8043 mg / mL, and the EC value of the dichloromethane fraction was... 50 The EC value was 1.919 mg / mL, and the value of the n-butanol fraction was... 50 EC value of 8.675 mg / mL, 60% ethanol extract 50 The value was 25.80 mg / mL, and the inhibitory activity of the water extract was weak. EC 50 The value was 12.020 mg / mL, and the inhibitory activity was weakest in the remaining water fraction. EC 50 The value was 74.15 mg / mL.

[0042] Test Example 2: Study on Antibacterial Mechanism To investigate the inhibitory effect of discarded plantain plants on rice pathogens, this test case used rice blast fungus (Pseudomonas oryzae), a common pathogenic fungus of rice. Magnaporthe oryza Guy11 was the tested strain. The petroleum ether extract of waste Plantago asiatica was used as the sample to reveal the effects of the extract on the growth phenotype and physiological functions such as cell membrane permeability of rice blast fungus at the growth phenotype, physiological morphology and molecular level, and to elucidate its antibacterial mechanism.

[0043] 1. Effects on phenotype and growth and development (growth curve, mycelial dry weight, light microscopic observation) (1) Effects on growth phenotype On freshly cultured plates of Guy11 rice blast fungus, mycelial cakes were punched using a 6mm punch and inoculated into plates containing petroleum ether extract at a final concentration of 0.02 mg / ml. A blank control group was also included, consisting of 30 ml of ddH2O containing 1% DMSO, mixed thoroughly, and poured onto solid plates. Both groups were cultured continuously for 11 days. Colony morphology was recorded, and growth curves were plotted. Figure 3 As shown, the results indicated that petroleum ether extracts significantly inhibited the growth of rice blast fungus colonies, with an overall growth rate that was significantly slowed down. Figure 4As shown, in the blank control group (CK): colonies grew vigorously, mycelia were fluffy, the edge mycelia were healthy, well-developed, and naturally extended, and the colony morphology was intact. In the petroleum ether extract treatment group: the overall surface of the colonies was rough, lacking the fluffy feel of normal mycelia, the center of the colonies showed obvious collapse, and the growth was weak. This indicates that the extract from waste plantain plants can achieve antibacterial effect by interfering with the development of pathogenic fungal colonies and inhibiting mycelial expansion.

[0044] (2) Effects on mycelial morphology and dry weight After treating the culture with petroleum ether extract solution (final concentration 0.2 mg / mL) for 24 hours, the hyphae morphology showed obvious abnormalities as observed by electron microscopy and scanning electron microscopy. A blank control group was also set up, consisting of 30 ml of ddH2O containing 1% DMSO. Figure 5 The blank control group, as observed under an electron microscope, showed that the hyphae were spread out, smooth, and normally branched, with uniform thickness and a loose and orderly arrangement. The petroleum ether extract treatment group showed that the hyphae were thinner, had no normal branches, and were in a dissolved state.

[0045] like Figure 6 As shown, after treatment with petroleum ether extract of waste plantain plants (final concentration 0.2 mg / mL) for 24 h, the dry weight of rice blast fungus mycelium decreased significantly from 0.572 g in the blank control group to 0.465 g, with an inhibition rate of 18.7%, indicating that the extract can effectively inhibit the accumulation of rice blast fungus mycelial biomass.

[0046] (3) Effects on spore morphology Rice blast fungus spores were washed from the culture plate in (1) above and observed under an electron microscope. The results showed that the extract from waste plantain plants could significantly interfere with normal spore development, leading to spore morphological abnormalities. Figure 7 The blank control group (CK) showed spores that were typically pear-shaped, plump, and regular in form. Most spores had two clear septa and intact internal structures. The petroleum ether extract treatment group showed significant differences in spore morphology compared to the control group, with reduced septa, morphological distortion, and similarly significant changes in internal structure, indicating inhibited normal spore development. These results demonstrate that the extract from discarded Plantago asiatica plants not only inhibits mycelial growth but also reduces spore germination and pathogenicity by disrupting spore morphology and reducing septa formation.

[0047] 2. Measurement of physiological and biochemical indicators (MDA, pyruvate, soluble protein, chitin, ergosterol, cell membrane permeability) The soluble protein content, malondialdehyde content, pyruvate content, malate dehydrogenase activity, catalase activity, chitinase activity, and ergosterol content of *Stromboma oryzae* mycelia in the blank control group (CK) and the petroleum ether extract treatment group were determined in (1) above. Following (2) above, the conductivity was measured after shaking the mycelium for 24 hours to observe the effect of the extract from discarded *Plantago asiatica* plants on the permeability of *Guy11* mycelial cell membranes. Each treatment was repeated three times. The results are shown in Table 2. Figure 8 .

[0048] Table 2. Effects of Plantago asiatica waste plant extracts on mycelial physiological and biochemical indicators

[0049] Note: Compared with the blank control group (CK), This indicates a significant difference (p<0.05); This indicates a highly significant difference (p<0.01).

[0050] Compared with the blank control group, the petroleum ether extract treatment group showed significantly increased malondialdehyde (28.28±5.61 nmol / g), pyruvate (1.49±0.07 μmol / g), and cell membrane permeability (1.513±0.049×1000 μS / cm) (p<0.01), and significantly decreased ergosterol (4.16±0.68 mg / g) (p<0.05). Soluble protein content (48.69±1.16 μg / mg), malate dehydrogenase activity (4.91±0.55 U / g), catalase activity (229.28±27.95 U / g), and chitinase activity (2.64±0.36 mg / h / g) were all lower than the blank control group. The above results indicate that petroleum ether extract can induce membrane lipid peroxidation in rice blast fungus, disrupt cell membrane integrity and ergosterol synthesis, interfere with tricarboxylic acid cycle energy metabolism, and reduce soluble protein content, malate dehydrogenase activity, catalase activity and chitinase activity, thereby exerting an antibacterial effect.

[0051] 3. Ultramorphological observation of hyphae (scanning electron microscopy, SEM) As an untreated blank control group, the hyphae exhibited a regular network structure with a relatively smooth and flat surface, without obvious wrinkles or traces of foreign substances adhering to them. The hyphae showed high uniformity in thickness and strong consistency in morphology (such as curvature and length) among individuals. The hyphae were loosely and orderly arranged, naturally connected to each other, without excessive entanglement or aggregation, and the overall integrity was good. Figure 9 .

[0052] The mycelia treated with petroleum ether extract exhibited specific textures and local morphological changes. The surface texture was significantly different from that of the CK group, with unique undulating or grooved structures. The variation in mycelial thickness was regional, with some segments being slender and others appearing "swollen" due to structural deformation. The degree of aggregation and structural regularity between mycelia was slightly worse than that of the natural loose state of the CK group.

[0053] The embodiments described above are merely preferred embodiments of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various other corresponding changes and modifications based on the technical solutions and concepts described above, and all such changes and modifications should fall within the protection scope of the claims of the present invention.

Claims

1. The application of an extract from waste plantain plants in the preparation of drugs for controlling rice diseases, characterized in that, The discarded plantain plant is *Plantago asiatica*, a plant belonging to the Plantaginaceae family. Plantago asiatica L. Waste plants after the psyllium husks have been harvested; The plant extract from waste plantain includes at least one of water extract from waste plantain, alcohol extract from waste plantain, and extracts of different polarities; the extracts of different polarities are components of petroleum ether fraction, dichloromethane fraction, ethyl acetate fraction, n-butanol fraction, and residual water fraction further separated from the alcohol extract from waste plantain. The rice diseases mentioned include rice sheath blight pathogen. Rhizoctonia solani Rice blast fungus Magnaporthe oryzae Bacterium oxysporum Xanthomonas oryzae pv. oryzae At least one of them.

2. The application of the extract from waste plantain plants according to claim 1 in the preparation of drugs for controlling rice diseases, characterized in that, The method for preparing the water extract of the waste plantlets from Plantago asiatica is as follows: Take discarded plants from the plant, add pure water, decoct and extract 2-4 times, each time for 0.5-1.5 hours, filter, combine the filtrates, concentrate under reduced pressure, and you will get the product.

3. The application of the extract from waste plantain plants according to claim 1 in the preparation of drugs for controlling rice diseases, characterized in that, The preparation method of the ethanol extract of waste plantain plants is as follows: Take waste plantain plants, add ethanol, reflux extract 2-4 times, each time for 0.5-1.5 hours, filter, combine the filtrates, and recover ethanol under reduced pressure until there is no alcohol odor, and the extract is obtained.

4. The application of the extract from waste plantain plants according to claim 3 in the preparation of drugs for controlling rice diseases, characterized in that, The volume concentration of the ethanol is 50%-80%.

5. The application of the extract from waste plantain plants according to claim 1 in the preparation of drugs for controlling rice diseases, characterized in that, The preparation methods of the extracts of the components with different polarities are as follows: Add the ethanol extract of the waste plant of Plantago asiatica to distilled water, stir or sonicate to disperse it evenly, and perform gradient extraction with petroleum ether, dichloromethane, ethyl acetate and n-butanol in sequence; collect the extracts of each fraction, recover the solvent under reduced pressure and evaporate to dryness until no organic solvent residue is left, thus obtaining the petroleum ether fraction, dichloromethane fraction, ethyl acetate fraction, n-butanol fraction and the remaining water fraction after concentration of the remaining aqueous phase after extraction.

6. The application of the extract from waste plantain plants according to claim 5 in the preparation of drugs for controlling rice diseases, characterized in that, In gradient extraction, each solvent is used for extraction 3-5 times.

Images