A recombinant hepatitis b vaccine composition and a process for its preparation

Abstract

The present application relates to a kind of recombinant hepatitis B vaccine composition and its preparation method, belong to biological medicine technical field: recombinant hepatitis B vaccine composition includes HBV-3A-SVP and pharmaceutically acceptable adjuvant;The HBV-3A-SVP includes HBV big S, middle S and small S three viral membrane proteins;The adjuvant is CpG, or the composite adjuvant combination of aluminum adjuvant and CpG, in composite adjuvant, the hepatitis B virus three antigen subvirus particles are completely absorbed on the surface of aluminum adjuvant, part of the CpG adjuvant is absorbed on the surface of aluminum adjuvant, another part is free in buffer solution.The present application can improve the tumorigenic safety of recombinant antigen by double enzyme digestion knockout part HBV virus X gene, limit X gene protein expression, the present application also finds that adding adjuvant as CpG can improve the stability and immunogenicity of preS1 in HBV-3A-SVP of vaccine composition.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and specifically relates to a recombinant hepatitis B vaccine composition and its preparation method. Background Technology

[0002] Hepatitis B is an inflammatory liver disease caused by the hepatitis B virus (HBV), and is a major global public health issue. While acute infection can resolve spontaneously, some individuals develop chronic infection. According to data released by the World Health Organization (WHO), there are approximately 257 million chronic HBV carriers worldwide, with about 800,000 deaths annually from HBV-related complications, and approximately 1.5 million new cases of chronic infection each year.

[0003] Hepatitis B virus (HBV) belongs to the Hepatoviridae family. At least nine genotypes (A to I) and one undetermined genotype (J) have been identified. Its genome is a partially double-stranded circular DNA, approximately 3.2 kb in size. It primarily transcribes five RNAs, which translate into seven viral proteins: P, E, C, large S (LS), medium S (MS), small S (SS), and X. Hepatitis B can spread through blood (including minor skin and mucous membrane injuries), sexual contact, and mother-to-child transmission. Long-term chronic infection can lead to serious liver diseases such as cirrhosis and liver cancer.

[0004] Currently, chronic hepatitis B cannot be completely cured. Commonly used clinical treatments include interferon, nucleoside / nucleotide analogs (lamivudine, telbivudine, entecavir, adefovir dipivoxil, tenofovir disoproxil fumarate, and tenofovir alafenamide, etc.), and small nucleic acid drugs (small interfering RNA and antisense oligonucleotides). Most patients require long-term medication to control their condition, and only a small percentage of patients with therapeutic advantages can achieve functional cure, maintaining stable disease without relapse after discontinuing medication. For the general population, hepatitis B vaccination is currently the most effective and economical means of preventing HBV infection.

[0005] As a core means of HBV infection control, hepatitis B vaccines have undergone two generations of technological iterations: blood-derived vaccines and recombinant S antigen vaccines. In 1965, Blumberg discovered an abnormal antigen in the blood of Australian Aboriginal people, named "Australia antigen" (abbreviated as "Australia antigen"). This antigen was later confirmed to be the hepatitis B surface antigen (HBsAg), laying the core foundation for the development of hepatitis B vaccines. In 1976, American scholar Krugman discovered that heating and inactivating the Australia antigen in the serum of hepatitis B patients could effectively prevent active infection caused by Australia antigen-positive serum, providing the technological prototype for the first generation of blood-derived vaccines. In 1981, Merck & Co. developed the Heptavax-B vaccine using inactivated and purified HBsAg subviral particles from the plasma of hepatitis B patients as raw materials, and it was approved for marketing in the United States. Subsequently, institutions such as Pasteur Institute in France and the Beijing Institute of Biological Products in China also successfully developed blood-derived hepatitis B vaccines. However, due to the limited blood supply, complex inactivation and purification processes, and high production costs, these vaccines have been discontinued for clinical use.

[0006] Second-generation hepatitis B vaccines are recombinant vaccines produced through genetic engineering. Their principle involves using genetic engineering technology to transfer the gene containing HBsAg into yeast (Saccharomyces cerevisiae, Hansenula polymorpha, Pichia pastoris, etc.) or mammalian cells (such as Chinese hamster ovary cells and CHO cells) for expression. In mammalian cell expression systems, the small S protein undergoes glycosylation modification similar to that of natural viral membrane proteins, and the subviral particles formed by the small S protein can be naturally secreted into the cell supernatant. However, in yeast cell expression systems, the small S protein cannot undergo glycosylation modification, requiring cell disruption to release the subviral particles bound to the yeast inner membrane. Compared to blood-derived vaccines, subviral particles containing a single S antigen can achieve stable, large-scale production with significantly reduced production costs, making them the mainstream hepatitis B vaccine product currently used clinically.

[0007] However, existing second-generation hepatitis B vaccines still face two major challenges in clinical application: First, the effectiveness of the immune response varies among different populations. Although infants and young children generally have a good immune response after receiving the hepatitis B vaccine, the protective efficacy induced by the vaccine gradually declines with age. In adults, approximately 10%-30% experience a low or no response after vaccination. These individuals with low or no responses have a significantly increased risk of acute HBV infection when exposed to large HBV carrier populations in high-prevalence areas. Some of these infected individuals may further develop chronic HBV infection, becoming new HBV carriers and further exacerbating the risk of virus transmission.

[0008] Secondly, the control effect against mutant strains and specific genotypes of the virus is insufficient. The second-generation hepatitis B vaccine uses a single S antigen. In recent years, breakthrough infection cases caused by immune evasion mutant strains against HBsAg (such as G145R, T126A, M133L, etc.) have been gradually increasing, directly weakening the control efficacy of existing vaccines and failing to meet the needs of comprehensive clinical prevention and control.

[0009] To address the insufficient efficacy of second-generation hepatitis B vaccines, the development concept of a third-generation hepatitis B virus triantigen subviral particle (HBV-3A-SVP) multiantigen hepatitis B vaccine was proposed. Research has confirmed that the surface of natural HBV contains three key antigenic components: the S antigen, preS1 antigen, and preS2 antigen. The three membrane proteins on the HBV surface (large S, medium S, and small S) share the same C-terminus. Large S (LS) is composed of preS1, preS2, and S antigen sequences; medium S (MS) is composed of preS2 and S antigen sequences; and small S (SS) contains only the S antigen sequence. All three antigen sequences can induce a protective immune response. The S antigen binds to heparan sulfate proteoglycan (HSPG) on the host cell surface, and subsequently, the preS1 antigen binds to the sodium ion-taurocholic acid cotransport polypeptide (NTCP) receptor with higher affinity, mediating viral invasion of host cells.

[0010] The advantages of multi-antigen hepatitis B vaccines are mainly reflected in two aspects: First, preS1 and preS2 antigens can efficiently induce the body to produce a cellular immune response. They fuse with the S antigen in MS and LS proteins, which can help enhance the humoral immune protection induced by the S antigen and reduce the proportion of low-response / non-response individuals. Second, the preS1 antigen also has the ability to induce the body to produce broadly neutralizing antibodies across genotypes, preventing the virus from binding to the NTCP receptor on hepatocytes. This can effectively compensate for the immune evasion and breakthrough infection problems caused by viral S antigen mutations and improve the coverage of vaccine prevention and control.

[0011] The tri-antigen hepatitis B vaccine was originally developed by Israel Biosciences. It uses adherent cell culture for expression, with the culture medium containing bovine serum and antibiotics. The cell culture is harvested every other day for approximately one month, combined, and purified. After optimization of production standards and improvements to the formulation process by a US pharmaceutical company, it was approved by the US FDA in 2021 under the brand name PreHevbrio, and subsequently approved in the EU, UK, Canada, and other regions. While PreHevbrio significantly improved the immunogenicity of hepatitis B vaccines, clinical trial results showed that the two-dose immunization regimen was similar but did not meet the non-inferiority criteria of the three-dose regimen for monoantigen vaccines, requiring the continued use of the 0-1-6 month three-dose immunization schedule. Furthermore, the preS1 antigen content in the tri-antigen SVP particles is very low; only about 20% of the vaccinated population can induce specific preS1 antibodies, making it difficult to induce a high proportion of preS1-specific antibody responses. Due to business factors, PreHevbrio was withdrawn from the market in 2024.

[0012] The discontinued tri-antigen hepatitis B vaccine PreHevbrio failed to efficiently induce the body to produce specific antibodies against the preS1 antigen during clinical use. There are three main reasons for this: First, the preS1 antigen content in the tri-antigen HBV subviral particles is extremely low and its stability is poor; second, currently marketed third-generation hepatitis B vaccines use an outdated adherent cell culture process, requiring the collection and combined processing of multiple batches of cell supernatant, and the long storage and purification time leads to preS1 antigen degradation; third, the aluminum adjuvant failed to efficiently induce the body to produce specific antibodies against the preS1 antigen, further limiting the broad-spectrum immunogenicity of the third-generation vaccine.

[0013] Given that existing third-generation triantigen hepatitis B vaccines have failed to induce the body to produce specific antibodies against the three antigens, especially the preS1 antigen, in a wide and efficient manner, how to improve the stability of the preS1 antigen and the overall immunogenicity of the vaccine through process optimization and rational adjuvant formulation, while achieving synergistic immune protection of the three antigens, remains a technical bottleneck that urgently needs to be overcome in this field. Summary of the Invention

[0014] To address the shortcomings of existing technologies, this invention provides a method for improving the stability and immunogenicity of preS1 in the HBV vaccine triantigen SVP by adding a CpG adjuvant formulation. In clinical use, in addition to inducing HBsAb antibodies, it can also induce preS1 antibodies with broad-spectrum virus-neutralizing capabilities at high levels, while reducing the total vaccination schedule of the triantigen vaccine from three doses to two. Secondly, by partially knocking out the X gene coupled with the three HBV membrane proteins, the safety of the vaccine can be improved without affecting the expression abundance of the three membrane proteins. Thirdly, this invention is the first to utilize a chemically defined culture medium combined with suspension cell culture, enabling the direct secretion of SVP carrying multiple HBV antigens in a bioreactor. The single-batch fermentation process can shorten production time and effectively maintain the abundance and stability of preS1 in the triantigen SVP.

[0015] To achieve the above-mentioned objectives, the present invention provides the following technical solution: A recombinant hepatitis B vaccine composition comprising HBV-3A-SVP and a pharmaceutically acceptable compound adjuvant; wherein the HBV-3A-SVP antigen comprises three viral membrane proteins of HBV: large S, medium S, and small S; wherein the adjuvant is CpG, or a compound adjuvant combination of aluminum adjuvant and CpG, wherein the subviral particles of the hepatitis B virus triantigen are completely adsorbed onto the surface of the aluminum adjuvant, and a portion of the CpG adjuvant is adsorbed onto the surface of the aluminum adjuvant while the other portion remains free in the buffer solution.

[0016] Furthermore, the large S protein contains three antigens: preS1, preS2, and S; the medium S protein contains two antigens: preS2 and S; and the small S protein contains only the S antigen.

[0017] Furthermore, for every 5-100 μg of HBV-3A-SVP, 500-6000 μg of CpG adjuvant and 0-1000 μg of aluminum adjuvant calculated as Al³⁺ are added to the composition.

[0018] Furthermore, the HBV-3A-SVP is a spherical particle composed of three viral membrane proteins and lipids, with the lipid components including phospholipids, glycerides, sphingolipids, and cholesterol lipids.

[0019] A second aspect of the present invention provides a method for preparing the recombinant hepatitis B vaccine composition of the first aspect, comprising the following steps: S1. Construction of HBV Triantigen Expression Vector: The JQ688404 viral gene sequence was obtained from NCBI, and its 2412-0 / 3215-2038 sequence was synthesized de novo. This sequence was then inserted into the pPIGG plasmid via XbaI and EcoRI restriction sites to construct the pPIG-HBA3AX recombinant plasmid. pPIG-HBA3AX underwent partial NotI digestion and complete BamHI digestion, followed by treatment with mung bean nuclease to remove 32 bases from the ORF translation start codon end of the X gene. The plasmid was then re-ligated and circularized using T4 DNA ligase to construct the X gene expression-deficient recombinant plasmid pPIG-HBV3A. The nucleotide sequence encoding the HBV triantigen, which disrupts the X gene ORF, is shown in SEQ ID NO.2. S2, Preparation of engineered cell lines: The recombinant expression vector from step S1 was transfected into hamster ovary cell line CHO cells. After selection from a mixed clonal cell pool, screening of single clonal cells and verification of cell stability, an engineered cell line that can stably express HBV-3A-SVP was obtained, and a cell bank was established. S3, Antigen Expression and Harvesting: The engineered cell line from step S2 was cultured in a chemically defined culture medium via suspension culture, and the cell culture supernatant was collected. S4, Antigen purification: The supernatant from step S3 is subjected to hydrophobic chromatography, anion exchange chromatography, size exclusion chromatography, ultrafiltration concentration, and virus inactivation to obtain HBV-3A-SVP with a purity ≥90%. S5, Adjuvant compounding and formulation preparation: First, mix HBV-3A-SVP from step S4 with aluminum adjuvant and incubate at room temperature for 1-30 minutes to allow the antigen to be completely adsorbed onto the surface of the aluminum adjuvant; then add CpG adjuvant and continue incubation for 1-60 minutes, adjusting the pH of the system to 6.0-8.0.

[0020] Furthermore, in step S3, the suspension culture conditions are: temperature 25-39℃, CO2 concentration 5%, dissolved oxygen maintained at 10%-50%, pH 6.5-7.5, rotation / stirring speed 50-200rpm, cell culture volume is gradually scaled up, and finally fed culture is carried out in a bioreactor. Chemically defined culture medium is used throughout the process, with no animal-derived components and no antibiotics added.

[0021] The third aspect of the present invention provides the use of the recombinant hepatitis B vaccine composition described in the first aspect in the preparation of a vaccine for preventing hepatitis B virus infection, and / or in the preparation of a medicament for the combined treatment of chronic hepatitis B with antiviral drugs to achieve functional cure.

[0022] Furthermore, the antiviral drugs include interferon, nucleoside / nucleotide analogs, and small nucleic acid drugs; the nucleoside / nucleotide analogs include, but are not limited to: lamivudine, telbivudine, entecavir, adefovir dipivoxil, tenofovir disoproxil fumarate, and tenofovir alafenamide fumarate; the small nucleic acid drugs include, but are not limited to: antisense oligonucleotides, small interfering RNA, and microRNA.

[0023] Beneficial effects: 1. The constructed production cell lines exhibit significantly improved safety, with extremely low tumorigenicity and metastatic potential. Cell lines constructed using pPIG-HBV3AX and pPIG-HBV3A vectors can stably produce HBV-3A-SVP (hepatitis B virus triantigen subviral particles) carrying three antigens (preS1, preS2, and S). The pPIG-HBV3A vector exhibits partial knockout of the HBV X gene sequence, resulting in defective expression, while enhancing sequences and polyadenylate tailing signals related to the regulation of the three membrane proteins are preserved. Transfection of CHO cells with pPIG-HBV3A and pPIG-HBV3AX yields monoclonal cell lines with similar S protein expression levels. The pPIG-HBV3A vector, which is defective in HBV X gene expression, provides monoclonal production cells with low tumorigenicity and weak metastatic ability in nude mice, effectively addressing the potential tumorigenic risk of traditional recombinant hepatitis B vaccine CHO production cell lines and improving the safety of vaccine production and clinical application. Specific experimental verification shows that when using 1×102… 6 When CHO cells obtained after pPIG-HBV3AX transfection were inoculated into 10 nude mice, all of them developed tumor nodules. In contrast, cell lines obtained after pPIG-HBV3A transfection showed tumor nodules when inoculated into 10 mice. 6 The cells / nude mouse dose was administered, and no tumor nodules were developed in any of the administered nude mice. Gross autopsy revealed no signs of tumor metastasis. This indicates that knocking out the X gene of HBV can yield cells with extremely low tumorigenicity, meeting the safety requirements for cell lines used in vaccine production, and does not reduce the expression level of triantigen subviral particles.

[0024] 2. Significantly improved production efficiency, reduced production costs, and easier industrial scaling-up. This invention utilizes suspended CHO cells for large-scale HBV-3A-SVP production via bioreactor culture. Compared to the CHO adherent cell production process used in currently marketed recombinant hepatitis B vaccines, this method significantly optimizes production efficiency and industrial applicability. Experimental data shows that existing adherent cell culture supernatants yield only 1-4 mg of antigen protein per liter of harvested culture; while this invention, using a bioreactor to culture suspended CHO cells, yields 8-40 mg of antigen protein per liter of fermentation supernatant, increasing antigen yield per unit volume of culture medium by 8-10 times compared to existing technologies. Furthermore, the suspension culture process eliminates the need for adherent carriers, making the culture process easier to control. It can be directly adapted to existing industrial bioreactor production lines, significantly shortening production time and reducing vaccine production costs. It also facilitates large-scale industrial production and improves product stability, overcoming the technical pain points of low efficiency, difficulty in scale-up, and high cost associated with traditional adherent cell production.

[0025] 3. The adjuvant combination significantly enhances vaccine immunogenicity and reduces the antigen dose required for antibody seroconversion. To optimize the immune response of recombinant hepatitis B vaccine, this invention innovatively improves the adjuvant formulation, significantly enhancing the immunogenicity of the vaccine, and particularly solving the technical problem of the high required dose for preS1 antigen-antibody seroconversion. Experimental verification (n=5) shows that with only aluminum adjuvant added, a 30ng antigen dose is required to achieve 100% seroconversion of preS2 antibody, a 90ng antigen dose is required to achieve 100% seroconversion of S antibody, while a 10μg antigen dose is required for 100% seroconversion of preS1 antibody. After adding CpG adjuvant (whether CpG1018 or CpG7909) to the aluminum adjuvant, only a 2.5μg HBV-3A-SVP antigen dose is needed to achieve 100% seroconversion of preS1 antibody, significantly reducing the amount of antigen required for preS1 antibody seroconversion, thereby improving the broad-spectrum protective efficacy of the vaccine. Considering the physiological characteristic that the human immune response to HBV-SVP is weaker than that of rats, a protein concentration of 10-20 μg / dose is selected to ensure the immunization effect in clinical applications, taking into account both immunogenicity and safety.

[0026] 4. CpG adjuvants can effectively improve the stability of the preS1 antigen and prolong the vaccine's shelf life. Addressing the technical challenge of poor stability of the preS1 antigen in HBV-3A-SVP, this invention reveals that CpG adjuvant can significantly improve the stability of the preS1 antigen, effectively preventing potency degradation during storage and transportation, and extending the vaccine's shelf life. Experiments show that after HBV-3A-SVP antigen was stored in solution at room temperature for one month at a concentration of 40 μg / ml, the S antigen potency showed no significant change, while the preS1 antigen potency decreased significantly by 80%. Adding 750 μg of CpG adjuvant maintained the preS1 antigen potency at over 50% of its initial level. When the CpG adjuvant concentration was increased to 1.5 mg or higher, the preS1 antigen potency in HBV-3A-SVP remained stable for a long period, effectively solving the technical problem of preS1 antigen instability and ensuring the uniformity and effectiveness of the vaccine quality.

[0027] 5. Optimal adjuvant formulation achieves synergistic enhancement of humoral and cellular immunity. This invention, through orthogonal experimental analysis (based on a dose of 20 μg HBV-3A-SVP antigen), clarified the optimal ratio of aluminum adjuvant to CpG adjuvant, achieving synergistic optimization of humoral and cellular immunity in vaccines and further enhancing the immunoprotective effect. Experimental results (Tables 2 and 3) show that the addition of CpG adjuvant significantly increased Th1 cell immunity and preS1 antibody levels, and the CpG adjuvant concentration was positively correlated with the intensity of the Th1 cell immune response; while the addition of aluminum adjuvant decreased Th1 cell immunity levels, it significantly increased preS1 antibody levels. Based on the above animal experimental results and clinical human characteristics, the adjuvant ratio was determined to be: CpG adjuvant content 500-4000 μg / dose, aluminum adjuvant content (based on Al... 3+ (Calculated) 0-1000μg / dose. This ratio can achieve a balanced enhancement of cellular immunity and humoral immunity, maximizing the immune protection efficacy of the vaccine.

[0028] 6. Expanding the clinical application scenarios of vaccines, possessing dual value in prevention and adjuvant therapy. Through innovative improvements to the adjuvant formulation, the immunogenicity of the recombinant triantigen hepatitis B vaccine of this invention has been significantly enhanced. It not only meets the needs of routine immunization but also expands its clinical application scenarios, possessing dual clinical value in prevention and adjuvant therapy. On the one hand, this vaccine can effectively improve the low / no-response phenomenon observed in adults after traditional hepatitis B vaccination, prolonging the duration of immune protection and improving the coverage and effectiveness of hepatitis B prevention. On the other hand, the enhanced cellular immune response to the three antigens (preS1, preS2, and S) provided by the vaccine can be used in combination with antiviral drugs such as nucleoside (acid) analogs, interferon, and small nucleic acids. Through the synergistic effect of cellular immunity and drugs, the functional cure efficiency of chronic hepatitis B is improved, breaking the limitation of traditional hepatitis B vaccines being used only for prevention, expanding the clinical application scope of hepatitis B vaccines, and possessing higher clinical practical value.

[0029] In summary, the vaccine formulation and supporting production system of this invention effectively solve the technical pain points of existing recombinant triantigen hepatitis B vaccines, such as low production efficiency, poor stability of preS1 antigen, insufficient immunogenicity of preS1, safety risks of production cell lines, and limited clinical application scenarios. It has significant advantages in terms of safety, efficacy, production applicability, and clinical value, and is suitable for large-scale industrial production and widespread clinical application. Attached Figure Description

[0030] Figure 1 This is a diagram of the expressed gene and recombinant plasmid structure in this invention. Figure A is a schematic diagram of the HBV genome structure and the sequence used to express HBV-3A-SVP, and Figure B is a schematic diagram of the pPIG-HBV3A plasmid structure after the X gene expression knockout of pPIG-HBV3AX. Figure 2 These are electron microscope images (A) and particle size distribution diagrams (B) of the HBV-3A-SVP particles in this invention. Figure 3 This is a diagram (BD) showing the expression of S, preS1, and preS2 proteins of HBV SVP in triantigen (3A) and single antigen (1A) using silver staining (A) and Western blot in this invention. Figure 4 This is a bar chart showing the effect of different doses of CpG1018 on the stability of preS1 antigen titer in HBV-3A-SVP (room temperature, 30 days). Figure 5 This is a dose-response evaluation diagram of the induction of three HBV membrane protein antibodies in mice by different doses of HBV-3A-SVP antigen protein in this invention. Figure 6This is a bar chart showing the seroconversion rate of preS1 antibodies induced by HBV-3A-SVP adsorbed aluminum adjuvant (AH) or added compound adjuvant (AH+CpG) in this invention. Detailed Implementation

[0031] The present invention will be described in detail below with reference to the embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0032] In this invention, HBV-3A-SVP refers to hepatitis B virus-triantigen-subviral particles, specifically hepatitis B virus-triantigen-subviral particles.

[0033] Example 1: Preparation and Identification of HBV-3A-SVP 1. Antigen sequence screening and expression vector construction: Through comparative analysis of HBV membrane protein sequences in the NCBI gene database and the GenBank viral gene database, HBV membrane protein gene sequences with high prevalence and relatively conserved sequences among strains were selected. For example, the gene sequence of genotype C JQ688404 virus with good sequence conservation was selected, and its 2412-0 / 3215-2038 sequence was synthesized de novo. Then, it was inserted into the pPIGG plasmid through XbaI and EcoRI restriction sites to construct the pPIG-HBA3AX recombinant plasmid. Figure 1 (Figure A in the middle). Due to the overlap of HBV viral gene expression ( Figure 1 The inserted sequence (pPIG-HBA3AX and pPIG-HBV3A) can simultaneously transcribe three RNAs (2.4kJ, 2.1kJ, and 0.7kJ) to express four proteins: LS, MS, SS, and X. They all use the same transcription termination and polyA tailing signal. Since the X protein is a non-structural protein that performs gene regulation and has potential oncogenicity, and its coding sequence contains cis-acting elements such as enhancers that regulate S protein expression, it cannot be completely knocked out. Therefore, this invention uses NcoI partial digestion and BamHI complete digestion, followed by treatment with mung bean nuclease, and then re-ligation with T4 DNA ligase to form a closed circular plasmid, removing 32 bases from the ORF translation start codon of the X gene. The pPIG-HBA3AX and pPIG-HBV3A recombinant plasmids before and after X protein knockout expression (…) are then compared. Figure 1 (B) Transfected cells, parallel experimental results showed that knocking out the X gene expression cassette did not affect the expression of the triantigen subviral particle (HBV-3A-SVP), but removing the X gene residue and protein expression could improve the tumorigenic safety of the recombinant antigen.

[0034] HBV X gene coding sequence (underlined is the HBV X protein ORF, bolded sequence is the NcoI and BamHI restriction sites) SEQ ID NO.1: cc atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccg accacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgctt cacctctgcacgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactctt ggactctcagcaatgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgg gggaggagattaggttaaaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaa ctttttcacctctgcctaa .

[0035] The HBV X gene knockout sequence (after double digestion, nuclease treatment, and ligation) SEQ ID NO.2: c(∆32bp) ctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtc tcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctctctttac gcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac caccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgacc gaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtct ttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa .

[0036] 2. Preparation of engineered cell lines: Chinese hamster ovary (CHO) cells, cultured in a chemically defined medium free of animal-derived components and exhibiting stable growth characteristics in suspension culture, were selected as host cells. Recombinant plasmid pPIG-HBV3A and CHO-K1 cells were mixed and placed in an electroporation vessel. The recombinant plasmid was transfected into the CHO cells using electroporation. After a 48-hour recovery culture, the cells were seeded into 96-well cell culture plates. A glutamine synthase (GS) screening process was initiated using a glutamine-free selective medium to obtain a pool of over 200 well-growing, well-tolerated mixed clonal cells capable of withstanding the screening pressure.

[0037] Cell supernatants from the above cell pools were collected, and the expression levels of preS1, preS2, and S antigens in the cell supernatants were detected by ELISA. Ten cell pools with the highest expression efficiency were obtained and further cultured using a fed-batch culture process. By monitoring cell proliferation and antigen expression capacity, three mixed clonal cell pools were finally identified as having the strongest antigen expression capacity and good cell proliferation status.

[0038] Three mixed clonal cell pools with the strongest antigen expression capacity were individually distributed into the wells of 96-well plates containing cloning medium using the CYTENAC.SIGHT 2.0 single-cell printing system. Solentim cell imaging was used for continuous image tracking to ensure the monoclonal origin of the cell wells. The cells were sorted using a monoclonal cell sorting device, and the expression levels of preS1, preS2, and S antigens in the cell supernatant were detected by ELISA. Western blotting was used to verify the correctness of the antigen proteins, and five monoclonal cell lines highly expressing HBV-3A-SVP were obtained. The selected monoclonal cells were inoculated into nude mice to evaluate tumorigenesis efficiency and metastasis after tumorigenesis, obtaining monoclonal cells with low tumorigenesis and no metastasis. The stability of the low-tumorigenic monoclonal cells was verified by continuous passage for more than 60 generations, ensuring that the expression levels of the three antigens did not significantly decrease during passage (coefficient of variation ≤10%). Ultimately, engineered cell lines with low tumorigenicity, high expression, and good stability were obtained. A three-tiered cell bank (original cell bank, master cell bank, and working cell bank) was established for the engineered cell lines. After testing in accordance with the material control requirements for biological products, the cell lines met the safety requirements for vaccine production.

[0039] 3. Expression and purification of HBV-3A-SVP (Hepatitis B virus-triantigen-subviral particles): A three-tiered cell bank (primary cell bank, master cell bank, and working cell bank) for engineered cell lines was established, and cell bank cryopreservation and resuscitation management were strictly carried out in accordance with GMP standards. Chemically defined culture media without animal-derived components were used for stepwise expansion culture of cells in the working cell bank: seed cells were first cultured in shake flasks, and when the cell culture volume reached 3L, they were transferred to a bioreactor for further large-scale and stepwise expansion. Suspension expansion and fed-batch culture were performed in the final stage of the bioreactor.

[0040] The optimized bioreactor culture conditions for fed-batch culture were as follows: temperature 37±1℃, pH 7.0±0.4, dissolved oxygen (DO) maintained at 30%-50%, stirring speed dynamically adjusted according to cell density, and culture period 7-12 days. During this period, a fed-batch strategy was used to supplement nutrients to maintain cell growth and antigen expression. After culture, cell debris was removed by centrifugation, and the cell culture supernatant was collected. The supernatant was then passed through a depth filter with a pore size of 0.02-0.2 μm. Before filtration, any system residues were washed with PBS buffer, and the supernatant was combined to form the filtered clear liquid.

[0041] HBV-3A-SVP was purified using a multi-step chromatographic purification process: The first step involved hydrophobic interaction chromatography: approximately 0.6 M ammonium sulfate was added to the clarified solution, and the solution was loaded onto a Butyl-SSepharose 6 Fast Flow chromatography column. The binding elution mode was used, and the solution was washed with 0.6 M ammonium sulfate phosphate buffer (pH 7.0) and eluted with 20 mM phosphate buffer (pH 7.0) to obtain the initial pure solution. The second step uses anion exchange chromatography: after the initial pure solution is desalted by ultrafiltration through a 300kDa ultrafiltration membrane, it is loaded onto a Unigel 80 DEAE chromatography column and the binding elution mode is used. Impurities are removed by 20mM phosphate buffer and elution with phosphate buffer containing about 200mM sodium chloride to obtain the intermediate pure solution. The third step uses size exclusion chromatography: the intermediate-pure solution is concentrated by ultrafiltration through a 300kDa ultrafiltration membrane, then loaded onto a Sepharose 4 FF chromatography column. Phosphate buffer with 170 mM NaCl is used as the mobile phase, and the largest protein peak is collected to obtain the purified solution.

[0042] The purified solution was inactivated by adding formaldehyde to a final concentration of 200 μg / ml, and incubated at 37°C for 24-72 hours. Finally, it was filtered through a 0.22 μm filter for sterilization to obtain HBV-3A-SVP stock solution with a purity ≥95.0% and a particle size of 18-38 nm. Three proteins, LS (0.1-5%), MS (10-30%), and SS (70-90%), could be detected simultaneously.

[0043] Electron microscopy revealed that HBV-3A-SVP consisted of subviral particles with a diameter of 18–38 nm. Figure 2 ).

[0044] Compared to HBV-1A-SVP subviral particles containing only one S single antigen, this one contains not only protein bands that can be specifically recognized by the specific S antibody, but also protein bands that can be specifically recognized by the preS1 and preS2 antibodies. Figure 3 ).

[0045] Example 2: Preparation of the vaccine composition 1. Reagent preparation: HBV-3A-SVP stock solution (purity ≥95.0%, concentration 160 μg / mL), CpG1018 adjuvant (concentration 50 mg / mL), aluminum hydroxide adjuvant (calculated as Al³⁺, concentration 10 mg / mL), PBS buffer (pH 7.2).

[0046] 2. Antigen dilution: Equilibrate the HBV-3A-SVP stock solution at 4°C for 30 min. Add aluminum hydroxide adjuvant to the antigen dilution solution and incubate at 4°C with stirring for 10 min to ensure sufficient adsorption of the antigen and aluminum adjuvant. Then add CpG1018 adjuvant and PBS dilution solution and continue stirring and incubating for 30 min to ensure uniform mixing of the adjuvant and antigen. For example, achieve a final Al³⁺ concentration of 1000 μg / mL (500 μg Al³⁺ per 0.5 mL) and a final CpG1018 concentration of 6000 μg / mL (3000 μg CpG1018 per 0.5 mL). Dispense the mixture into pre-filled syringes (0.5 mL per syringe), label each syringe, and store at 2–8°C to obtain the vaccine composition of this invention.

[0047] Example 3: Stability Verification of the Vaccine Composition 1. Take the HBV-3A-SVP stock solution from Example 1, add different concentrations of CpG1018, divide into 5 groups, 3 portions in each group; the control group is the vaccine composition without CpG1018 adjuvant.

[0048] 2. Storage conditions: Store at room temperature (25±2℃) for 1 month.

[0049] 3. Detection indicators and methods: The titers of preS1 and S antigens before and after storage were detected by ELISA.

[0050] 4. Experimental results: such as Figure 4 As shown, the S antigen titer did not change significantly. Figure 4 A) The antigenic titer of preS1 without CpG adjuvant was only 22%, while with the addition of 750 μg of CpG1018, the antigenic titer of preS1 significantly increased to over 50%. When the CpG content increased to over 1500 μg, the antigenic titer of preS1 could be stably retained to over 85%. Figure 4 B).

[0051] 5. Conclusion: The vaccine composition (containing compound adjuvant) of the present invention can be stably stored at room temperature for more than one month. The stability of the preS1 antigen is significantly better than that of the control group without CpG, effectively solving the technical problem of preS1 antigen instability.

[0052] Example 4: Immunogenicity Validation of the Vaccine Composition 1. Experimental animals: SPF-grade BALB / c mice, 6-8 weeks old, weighing 18-22g, were randomly divided into 8 groups of 10 mice each.

[0053] Detection indicators and methods: The titers of preS1 antibody, preS2 antibody and S antibody in serum were detected by ELISA. Experimental results: as attached Figure 5 As shown, preS1 exhibits the worst antibody induction effect; Experimental verification (n=10) showed that with only aluminum adjuvant, a dose of 30 ng of antigen was required to achieve 100% seroconversion of preS2 antibody, and a dose of 90 ng of antigen was required to achieve 100% seroconversion of S antibody, while a dose as high as 10 μg of antigen was required for 100% seroconversion of preS1 antibody. However, by adding CpG adjuvant (whether CpG1018 or CpG7909) to the aluminum adjuvant, only a dose of 2.5 μg of HBV-3A-SVP antigen was needed to achieve 100% seroconversion of preS1 antibody, significantly reducing the amount of antigen required for antibody seroconversion and improving the immunogenicity of the vaccine. Considering the physiological characteristic that the human immune response to HBV-SVP is weaker than that of mice, an optimal protein concentration of 10-20 μg / dose was selected to ensure the immunizing effect in clinical applications, balancing immunogenicity and safety.

[0054] Example 5: Immunogenicity Validation of the Vaccine Composition Experimental animals: SPF-grade BALB / c mice, 6-8 weeks old, weighing 18-22g, were randomly divided into 6 groups of 5 mice each.

[0055] Detection indicators and methods: The preS1 antibody in serum was detected by ELISA.

[0056] Results: See attached. Figure 6 As shown, CpG can increase the seroconversion rate of preS1; The nucleotide sequences of CpG1018 (SEQ ID NO.3) and CpG7909 (SEQ ID NO.4) are shown in Table 1 below. To improve adjuvant stability, a thiolation process was performed. Table 1 Nucleotide sequence listing of CpG1018 and CpG7909

[0057] Example 6: Immunogenicity Validation of the Vaccine Composition Experimental animals: SPF-grade SD rats, 50 in total, 2 in each group.

[0058] Detection indicators and methods: The serum preS1 antibody titer was detected by ELISA; the number of IFN-γ secretory cells against preS protein in spleen cells was detected by ELISPOT method to evaluate the level of cellular immunity.

[0059] Experimental results: As shown in Tables 2 and 3, the antigen combination with CpG1018 at a concentration of 3000 μg or more showed the best effect.

[0060] Table 2. PreS cell immune levels (number of IFN-γ secretory cells per million epidermal cells) in rats after two immunizations (0 and 1 month) with 20 μg HBV-3A-SVP antigen combined with different doses of aluminum hydroxide (AH) and CpG1018 (CpG).

[0061] Table 3. Geometric mean titer of preS1 antibody in rats after two immunizations (0 and 1 month) with 20 μg HBV-3A-SVP antigen combined with different doses of aluminum hydroxide (AH) and CpG1018 (CpG).

[0062] The above description is merely a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the forms disclosed herein and should not be construed as excluding other embodiments. It can be used in various other combinations, modifications, and environments, and can be altered within the scope of the concept described herein through the above teachings or related technologies or knowledge. Modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the present invention should be within the protection scope of the appended claims.

Claims

1. A recombinant hepatitis B vaccine composition, characterized in that: The formulation comprises hepatitis B virus triantigen subviral particles and a pharmaceutically acceptable adjuvant; the hepatitis B virus triantigen subviral particles comprise hepatitis B virus large S virus membrane protein, medium S virus membrane protein, and small S virus membrane protein; the adjuvant is CpG, or a combination of aluminum adjuvant and CpG; in the combination adjuvant, the hepatitis B virus triantigen subviral particles are completely adsorbed onto the surface of the aluminum adjuvant, a portion of the CpG adjuvant is adsorbed onto the surface of the aluminum adjuvant, and the other portion is free in the buffer solution.

2. The recombinant hepatitis B vaccine composition according to claim 1, characterized in that: The large S virus membrane protein contains three antigens: preS1, preS2, and S; the medium S virus membrane protein contains two antigens: preS2 and S; and the small S virus membrane protein contains only the S antigen.

3. The recombinant hepatitis B vaccine composition according to claim 1, characterized in that: The composition contains 500-6000 μg of CpG adjuvant and 0-1000 μg of aluminum adjuvant (calculated as Al³⁺) per 5-100 μg of hepatitis B virus triantigen subviral particles.

4. The recombinant hepatitis B vaccine composition according to claim 1, characterized in that: The hepatitis B virus triantigen subviral particles are spherical particles composed of three viral membrane proteins and lipids. The lipid components include phospholipids, glycerides, sphingolipids, and cholesterol esters.

5. The method for preparing the recombinant hepatitis B vaccine composition according to any one of claims 1-4, characterized in that, Includes the following steps: S1. Construction of HBV Triantigen Expression Vector: The JQ688404 viral gene sequence was obtained from NCBI, and its 2412-0 / 3215-2038 sequence was synthesized de novo. This sequence was then inserted into the pPIGG plasmid via XbaI and EcoRI restriction sites to construct the pPIG-HBA3AX recombinant plasmid. pPIG-HBA3AX underwent partial NotI digestion and complete BamHI digestion, followed by treatment with mung bean nuclease to remove 32 bases from the ORF translation start codon of the X gene. The plasmid was then re-ligated and circularized using T4 DNA ligase to construct the X gene expression-deficient recombinant plasmid pPIG-HBV3A. The nucleotide sequence encoding the HBV triantigen, which disrupts the X gene ORF, is shown in SEQ ID NO.

2. S2, Preparation of engineered cell lines: The recombinant expression vector from step S1 was transfected into hamster ovary cell line CHO cells. After selection from a mixed clonal cell pool, screening of single clonal cells and verification of cell stability, an engineered cell line that can stably express hepatitis B virus triantigen subviral particles was obtained, and a cell bank was established. S3, Antigen Expression and Harvesting: The engineered cell line from step S2 was cultured in a chemically defined culture medium via suspension culture, and the cell culture supernatant was collected. S4, Antigen Purification: The supernatant from step S3 is subjected to hydrophobic chromatography, anion exchange chromatography, size exclusion chromatography, ultrafiltration concentration, and virus inactivation steps to obtain hepatitis B virus triantigen subviral particles with a purity ≥90%. The virus inactivation method is as follows: formaldehyde is added to a final concentration of 200 μg / ml for virus inactivation, and the mixture is kept at 37℃ for 24-72 hours. Finally, the mixture is filtered through a 0.22 μm filter membrane for sterilization. S5, Adjuvant compounding and formulation preparation: First, mix the hepatitis B virus triantigen subviral particles from step S4 with aluminum adjuvant and incubate at room temperature for 1-30 minutes to allow the antigen to be completely adsorbed onto the surface of the aluminum adjuvant; then add CpG adjuvant and continue incubation for 1-60 minutes, adjusting the pH of the system to 6.0-8.

0.

6. The preparation method according to claim 5, characterized in that: In step S3, the suspension culture conditions are: temperature 25-39℃, CO2 concentration 5%, dissolved oxygen maintained at 10%-50%, pH 6.5-7.5, rotation / stirring speed 50-200rpm, cell culture volume is gradually scaled up, and finally fed culture is carried out in a bioreactor. Chemically defined culture medium is used throughout the process, with no animal-derived components and no antibiotics added.

7. The use of the recombinant hepatitis B vaccine composition according to any one of claims 1-4 in the preparation of a vaccine for the prevention of hepatitis B virus infection, and / or in the preparation of a vaccine for the combined treatment of chronic hepatitis B with an antiviral drug.

8. The application according to claim 7, characterized in that: The antiviral drugs include interferon, nucleotide analogs, and small nucleic acid drugs; the nucleotide analogs include lamivudine, telbivudine, entecavir, adefovir dipivoxil, tenofovir disoproxil fumarate, and tenofovir alafenamide fumarate; the small nucleic acid drugs include antisense oligonucleotides, small interfering RNA, and microRNA.

Images