Use of slc25a1 as a drug target in the preparation of a medicament for preventing or treating liver fibrosis

Abstract

The application discloses application of SLC25A1 as a drug target in preparation of a drug for preventing or treating liver fibrosis, and belongs to the technical field of biological medicine. The molecule involved in the application is SLC25A1, expression of which is significantly up-regulated in activated hepatic stellate cells of liver fibrosis patients and various liver fibrosis animal models, and the expression level is positively correlated with fibrosis stages and negatively correlated with lipid droplet content, so that the molecule can be used as a biomarker for screening, diagnosis, progress monitoring and prognosis evaluation of liver fibrosis. Inhibition of expression of the SLC25A1 protein molecule can significantly restore the lipid droplet content of hepatic stellate cells, block lipophagy and reduce liver fibrosis, and the molecular marker can be used as a new target of a drug for preventing and treating liver fibrosis.

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and nanomedicine, specifically relating to the application of SLC25A1 as a drug target in the preparation of drugs for the prevention or treatment of liver fibrosis. Background Technology

[0002] Hepatic stellate cell activation is a central event in liver fibrosis. In a healthy liver, the cytoplasm of resting hepatic stellate cells is rich in lipid droplets, which store vitamin A and lipids. When the liver is damaged, hepatic stellate cells rapidly activate, transforming into proliferative, contractile, and extracellular matrix-producing myofibroblasts—a process accompanied by rapid lipid droplet loss. Studies have shown that blocking lipid droplet loss or promoting lipid droplet formation can effectively inhibit hepatic stellate cell activation. Therefore, regulating lipid droplet homeostasis is an important strategy for antifibrotic therapy, but the molecular switch controlling lipid droplet loss remains unclear.

[0003] Mitochondrial citrate carrier SLC25A1 (also known as CIC) is located on the inner mitochondrial membrane. It is a 311-amino acid mitochondrial carrier protein with three conserved domains. The primary function of SLC25A1 is to retrogradely transport citrate, produced from the tricarboxylic acid cycle, from the mitochondrial matrix to the cytoplasm in a 1:1 ratio, while simultaneously transporting malate into the mitochondrial matrix, thus acting as a mitochondrial electron-neutral retrotransporter. The citrate entering the cytoplasm has important physiological functions: firstly, it can regulate glycolysis through a negative feedback mechanism; secondly, citrate is cleaved by ATP-citrate lyase (ACLY) to produce acetyl-CoA and oxaloacetate. Acetyl-CoA is not only a key substrate for the de novo synthesis of lipids such as fatty acids, sterols, prostaglandins, polyterpenoids, and coenzyme Q, but also an important acetyl donor for protein acetylation and histone acetylation. Furthermore, SLC25A1-mediated citrate transport provides bioenergetic support for hepatocytes, a carbon source for the biosynthesis of fatty acids and sterols, and NAD for the glycolytic pathway. + .

[0004] Current academic opinion holds that the biological functions of SLC25A1 involve multiple aspects: ① SLC25A1 participates in lipid metabolism reprogramming by regulating cytoplasmic citrate and acetyl-CoA levels—in the livers of patients with hyperlipidemia and type 2 diabetes, SLC25A1-mediated de novo lipid synthesis is abnormally elevated, contributing significantly to the pathogenesis and development of hepatic steatosis and hyperlipidemia; ② SLC25A1 participates in the regulation of protein post-translational modifications by regulating acetyl-CoA production—SLC25A1, in synergy with ACLY, regulates the acetylation modification of downstream proteins (such as FSP1) by maintaining cytoplasmic acetyl-CoA levels, thereby affecting protein stability and cell function; ③ SLC25A1 participates in multiple biological pathways such as inflammatory signaling pathways, fatty acid acyl-CoA biosynthesis, and gluconeogenesis, and interacts with more than 300 molecules. Previous research by the inventors of this patent revealed that SLC25A1 is significantly upregulated in activated stem cells and promotes the ubiquitination and degradation of PPARγ through acetyl-CoA-mediated NEDD4 acetylation, thereby inhibiting PLIN2 transcription, activating lipophage, and accelerating lipid droplet loss, thus driving hepatic stellate cell activation and the progression of liver fibrosis. These studies suggest that SLC25A1 plays an important role in the pathogenesis of liver fibrosis; however, the specific regulatory mechanism of SLC25A1 in liver fibrosis is still in the early stages of research and requires further elucidation.

[0005] Liver fibrosis is a common pathological stage in the progression of many chronic liver diseases. Currently, there is a lack of highly effective and specific diagnostic markers and direct-acting anti-fibrotic drugs in clinical practice. Specifically, it manifests as follows: There is a lack of reliable diagnostic biomarkers for liver fibrosis: Currently used clinical serological indicators (such as ALT, AST, hyaluronic acid, etc.) have insufficient sensitivity and specificity, making it difficult to accurately assess the degree and progression of liver fibrosis; although liver biopsy is the gold standard, it is invasive, has sampling errors and complications, and is not suitable for dynamic monitoring and early screening.

[0006] Lack of etiology-independent antifibrotic drugs: Current treatments mainly target the primary cause (such as antiviral therapy, alcohol abstinence, and metabolic control). For patients with significant fibrosis or poor response to etiological treatment, there are currently no drugs that directly target the activation process of hepatic stellate cells. The molecular switch of the core event in liver fibrosis—hepatic stellate cell activation accompanied by rapid lipid droplet loss—has long remained unclear, resulting in a lack of effective drug intervention targets.

[0007] The link between mitochondrial metabolism and hepatic stellate cell activation remains a blank: existing studies have suggested that metabolic reprogramming plays an important role in hepatic stellate cell activation, but the function of the mitochondrial citrate transporter SLC25A1 in hepatic stellate cell activation and liver fibrosis has never been explored, and its value as a diagnostic biomarker and therapeutic target is completely unknown. Summary of the Invention

[0008] The technical problem to be solved by this invention is how to propose the application of SLC25A1 as a drug target in the preparation of drugs for the prevention or treatment of liver fibrosis.

[0009] The present invention solves the above-mentioned technical problems through the following technical means: This invention proposes the application of SLC25A1 as a drug target in the preparation of drugs for the prevention or treatment of liver fibrosis.

[0010] The application of SLC25A1 as a target for the treatment or improvement of liver fibrosis is proposed. That is, any form of inhibition, silencing, knockout, or reduction of its expression can be used in the prevention, treatment, or improvement of liver fibrosis or in the preparation of related drugs.

[0011] This invention also proposes the application of SLC25A1 inhibitors in the preparation of drugs for the prevention or treatment of liver fibrosis.

[0012] SLC25A1 includes the SLC25A1 gene and the SLC25A1 protein; the gene number of the SLC25A1 gene on NCBI is GeneID: 6576.

[0013] Preferably, the SLC25A1 inhibitor includes, but is not limited to, one or more of the following: chemical drugs, peptide / protein drugs, and gene therapy drugs that inhibit SLC25A1.

[0014] Preferably, the gene drug is selected from: siRNA, dsRNA, shRNA, miRNA, SLC25A1 antisense nucleotide or any combination thereof that can reduce the expression level of SLC25A1; or constructs that can express or form the siRNA, dsRNA, shRNA, miRNA, SLC25A1 antisense nucleotide or any combination thereof.

[0015] In the aforementioned polypeptide / protein drugs, polypeptides are compounds formed by α-amino acids linked together by peptide chains. They are intermediate products of protein hydrolysis and do not possess a spatial structure (i.e., the primary structure of a protein). Proteins are macromolecules composed of N polypeptide chains intertwined in a certain spatial structure and possess a certain spatial structure (i.e., the secondary, tertiary, and quaternary structures of proteins). The term "construction" refers to a vector in the field of genetic engineering capable of carrying and expressing nucleotides, including but not limited to at least one of bacterial plasmids, bacteriophages, recombinant viral vectors, and eukaryotic recombinant expression vectors.

[0016] Preferably, the siRNA sequence that can reduce SLC25A1 expression is: GCCAUAGUGUUUGUCAUCUTT. (SEQ ID NO. 1) Preferably, the shRNA sequence that can reduce SLC25A1 expression is: CTGCGGCTTGAAGATCCTAAA (SEQ ID NO. 2). Preferably, the liver fibrosis includes, but is not limited to, that caused by CCl4, BDL, or MCD diet.

[0017] Dual-targeting nanovesicles that target and activate hepatic stellate cells SLC25A1 include: NVs / siSLC25A1 (non-targeted), HA@NVs / siSLC25A1 (CD44-targeted), or HA@JMNVs / siSLC25A1 (dual-targeted).

[0018] The sequence of the short hairpin RNA (AAV-shSLC25A1) of adeno-associated virus SLC25A1 that targets activated hepatic stellate cells is: CTGCGGCTTGAAGATCCTAAA.

[0019] The present invention also proposes a product whose active ingredient is a substance that reduces the expression level of SLC25A1, and the function of the product is to prevent and / or treat liver fibrosis.

[0020] Preferably, the substance that reduces SLC25A1 expression includes one or more of the above-mentioned chemical drugs, peptide / protein drugs, and gene drugs that inhibit SLC25A1.

[0021] Preferably, the product includes, but is not limited to, a drug.

[0022] Preferably, the drug further includes a pharmaceutically acceptable carrier, including but not limited to at least one of solvents, polymers, liposomes, recombinant viral vectors, and eukaryotic recombinant expression vectors.

[0023] Preferably, the drug is formulated into a pharmaceutically acceptable dosage form.

[0024] Preferably, the dosage form includes, but is not limited to, tablets, capsules, granules, pills, syrups, powders, granules, suppositories, drops, emulsions, injections, oral liquids, aerosols, or suspensions.

[0025] This invention also proposes the application of SLC25A1 as a molecular marker in the preparation of detection products for liver fibrosis screening and / or diagnosis.

[0026] The SLC25A1 gene and its encoded protein are significantly upregulated in the liver tissue of patients with liver fibrosis. The expression level is positively correlated with the stage of liver fibrosis and negatively correlated with the lipid droplet content in hepatic stellate cells, suggesting that SLC25A1 can serve as a novel biomarker for the clinical diagnosis and disease assessment of liver fibrosis.

[0027] The present invention also provides a nano-targeted delivery system for SLC25A1 (hyaluronic acid-modified hepatic stellate cell membrane biomimetic nanovesicles), which can specifically deliver SLC25A1 siRNA to activated hepatic stellate cells for precise treatment.

[0028] SLC25A1 siRNA sequence: 5'-3': GCCAUAGUGUUUGUCAUCUTT.

[0029] The beneficial effects of this invention are as follows: 1. This invention provides a novel diagnostic and prognostic biomarker: SLC25A1 expression level is positively correlated with liver fibrosis stage and negatively correlated with lipid droplet content. It can be used for liver fibrosis screening, early diagnosis, progression monitoring, treatment evaluation, and prognosis assessment.

[0030] 2. This invention provides a non-etiology-dependent therapeutic target: In three mouse models with different etiologies (toxic CCl4, cholestatic BDL, and metabolic MCD diet), knocking down SLC25A1 can effectively reduce liver fibrosis, indicating that targeting SLC25A1 is suitable for patients with multiple types of liver fibrosis and overcomes the limitation of existing anti-fibrotic drugs that only target a single etiology.

[0031] 3. A novel function and mechanism of SLC25A1 in liver fibrosis were revealed for the first time: SLC25A1 was discovered as a key molecule driving hepatic stellate cell activation and liposis, elucidating the cascade of mitochondrial metabolism-post-translational modification (SLC25A1 → acetyl-CoA → NEDD4 acetylation → PPARγ K197 site K48 ubiquitination degradation → PLIN2 downregulation → liposis activation). A novel mechanism by which the acetylation modification of the E3 ubiquitin ligase NEDD4 enhances its enzymatic activity was revealed for the first time, and the key ubiquitination site K197 of PPARγ (which is completely conserved in multiple species) was located, providing a structural basis for developing lead compounds that specifically block the NEDD4-PPARγ interaction.

[0032] 4. This invention reveals for the first time that SLC25A1 serves as a biomarker for hepatic stellate cell activation and a target for anti-fibrotic therapy. The molecular mechanisms involved in hepatic stellate cell activation and liver fibrosis are as follows: SLC25A1 downregulation reduces cytoplasmic acetyl-CoA abundance, decreases the acetylation modification of the E3 ubiquitin ligase NEDD4, inhibits its enzyme activity, and consequently inhibits the K48-linked polyubiquitination degradation of the transcription factor PPARγ protein at the K197 site; PPARγ stabilization leads to transcriptional activation of its downstream target gene PLIN2; PLIN2 is a lipid droplet coating protein, and its upregulation protects the lipid droplet surface, blocking the autophagy-lysosomal pathway for recognition and degradation (i.e., lipophage); maintaining lipid droplet homeostasis prevents the provision of energy and substrates for hepatic stellate cell activation, inhibits its transdifferentiation into myofibroblasts, reduces the deposition of extracellular matrix such as collagen, and ultimately achieves an anti-fibrotic effect (e.g., ...). Figure 2 (As shown). In addition, we developed a hyaluronic acid-modified biomimetic nanovesicle for activated hepatic stellate cell membranes that specifically delivers SLC25A1 siRNA to activated hepatic stellate cells. This nanovesicle outperforms AAV6.

[0033] 5. The molecule involved in this invention is SLC25A1, and its nucleotide sequence position diagram is shown below. Figure 1 As shown, its expression was significantly upregulated in activated hepatic stellate cells of patients with liver fibrosis and various animal models of liver fibrosis. The expression level was positively correlated with fibrosis stage and negatively correlated with lipid droplet content, making it a potential biomarker for screening, diagnosis, progression monitoring, and prognostic assessment of liver fibrosis. Inhibiting the expression of SLC25A1 significantly restored lipid droplet content in hepatic stellate cells, blocked lipoplasmosis, and alleviated liver fibrosis. This molecular marker could serve as a novel drug target for the prevention and treatment of liver fibrosis.

[0034] 6. This invention elucidates the molecular mechanism by which SLC25A1 knockdown combats liver fibrosis: SLC25A1 downregulation reduces cytoplasmic acetyl-CoA abundance, decreases NEDD4 acetylation modification, and slows down K48-linked ubiquitination degradation at the PPARγ K197 site, thereby enhancing PLIN2 transcriptional activation, inhibiting lipophage, and ultimately reversing hepatic stellate cell activation and liver fibrosis progression. This mechanism provides a theoretical basis for developing antifibrotic drugs targeting the SLC25A1-NEDD4-PPARγ signaling axis.

[0035] 7. To provide a new biomarker for the diagnosis and prognostic assessment of liver fibrosis: to reveal the expression characteristics of SLC25A1 in activated hepatic stellate cells of liver fibrosis patients and animal models and its correlation with fibrosis stage and lipid droplet content, and to establish a method for screening, diagnosis, progression monitoring and prognostic assessment of liver fibrosis based on SLC25A1 expression level, so as to make up for the shortcomings of existing diagnostic biomarkers in terms of sensitivity and specificity.

[0036] 8. Elucidating the molecular mechanism by which SLC25A1 drives hepatic stellate cell activation and liposis: For the first time, the molecular mechanism by which SLC25A1 drives hepatic stellate cell activation and liver fibrosis progression through a cascade reaction of "increased cytoplasmic acetyl-CoA → NEDD4 acetylation → PPARγ K197 site K48 ubiquitination degradation → PLIN2 transcriptional inhibition → liposis activation" is revealed, providing a novel, etiology-independent drug target for antifibrotic therapy.

[0037] 9. Providing a SLC25A1-targeted anti-liver fibrosis treatment strategy: Developing and validating whether hyaluronic acid (HA)-modified, biomimetic dual-targeting nanovesicles loaded with SLC25A1 siRNA can effectively restore the lipid droplet content of hepatic stellate cells, block lipophagy, and alleviate liver fibrosis.

[0038] 10. This invention discovers that by inhibiting the expression or activity of SLC25A1, the lipid droplet content in hepatic stellate cells can be restored, the lipophagus process can be blocked, and the activation and collagen secretion of hepatic stellate cells can be inhibited, thereby effectively reducing the degree of liver fibrosis. Animal experiments show that AAV6-mediated gene knockdown targeting SLC25A1 or nanovesicle-mediated siRNA delivery significantly improves fibrotic pathological changes in three liver fibrosis models (CCl4, MCD diet, and BDL).

[0039] Of course, implementing any product or method of the present invention does not necessarily require achieving all of the advantages described above at the same time. Attached Figure Description

[0040] Figure 1 This is a schematic diagram showing the nucleotide sequence positions of SLC25A1.

[0041] Figure 2 This is a schematic diagram illustrating the therapeutic mechanism of SLC25A1 in hepatic stellate cell activation and liver fibrosis in Example 1 of the present invention.

[0042] Figure 3 This is an analysis diagram of SLC25A1 as a diagnostic target and biomarker for liver fibrosis in Example 1 of the present invention. A is the expression profile of lipid metabolism-related genes in primary hepatic stellate cells; B is the Spearman correlation analysis of human SLC25A1 expression and liver fibrosis staging; C is the immunofluorescence image of co-localization of SLC25A1 and α-SMA in human fibrotic liver tissue; DE is the analysis of SLC25A1 mRNA and protein levels in primary hepatic stellate cells cultured for 0 days (quiescent) and 5 days (activated); F is the immunofluorescence image of co-localization of SLC25A1 and α-SMA in liver sections of CCl4, MCD diet, HFD diet and BDL mouse fibrosis models.

[0043] Figure 4This is a data analysis diagram of the in vivo liver injury relief caused by AAV6-mediated SLC25A1 knockdown in Example 1 of the present invention, where AC represents the serological markers of the BDL fibrosis model, DE represents the serological markers of the CCl4 fibrosis model, and FI represents the serological markers of the MCD dietary fibrosis model.

[0044] Figure 5 This is a data analysis diagram of the in vivo liver fibrosis relief caused by AAV6-mediated SLC25A1 knockdown in Example 1 of the present invention. In the diagram, AC represents the weight changes during the treatment of BDL, CCl4 and MCD diet fibrosis models, D represents the pathological results after treatment of the BDL model, E represents the pathological results after treatment of the CCl4 model, and F represents the pathological results of the MCD diet model.

[0045] Figure 6 The diagram shows the synthesis route and characterization of nanovesicles in Example 2 of this invention. A is a schematic diagram of nanovesicle synthesis, B is an electron microscope image and particle size of nanovesicles, C is the potential of nanovesicles, D is an analysis diagram of the electrophoretic mobility change of nanovesicles, and EF is the stability assessment of nanovesicles.

[0046] Figure 7 The diagrams show the targeting efficiency, biocompatibility, and toxicity analysis of nanovesicles in Example 2 of this invention. A is an in vitro immunofluorescence uptake diagram, B is a flow cytometry diagram of the in vitro uptake immunofluorescence intensity, CD is the CCK8 toxicity experiment, E is the hemolysis experiment, and F is the toxicity analysis of major organs.

[0047] Figure 8 This is an in vivo distribution map of nanovesicles in Example 2 of the present invention, where A is in vivo fluorescence imaging after different nanovesicle formulations, B is fluorescence imaging quantification, and C is in vitro imaging and quantification of organs collected at the endpoint.

[0048] Figure 9 This is a graph showing the in vitro knockdown efficiency of nanovesicles in Example 2 of the present invention, where A represents the mRNA-level knockdown efficiency and B represents the protein-level knockdown efficiency.

[0049] Figure 10 This is a diagram showing the in vivo anti-fibrotic efficacy analysis of nanovesicles in Example 2 of the present invention, where A represents the anti-fibrotic efficacy of the BDL model, B represents the anti-fibrotic efficacy of the CCl4 model, and C represents the pathological anti-fibrotic efficacy of the MCD diet model.

[0050] Figure 11The diagram shows the SLC25A1 reversal of hepatic stellate cell activation analysis in Example 3 of this invention. In this diagram, A is the immunofluorescence of SLC25A1 and α-SMA in primary hepatic stellate cells cultured for 0 days (quiescent) and 5 days (activated); B is the immunofluorescence of lipid droplets in primary hepatic stellate cells cultured for 0 days (quiescent) and 5 days (activated); C is the correlation analysis of immunofluorescence density between SLC25A1 and α-SMA; D is the immunofluorescence of lipid droplets in the MCD model after AAV6 treatment; and EF are the changes in the mRNA and protein levels of liver fibrosis markers after in vitro knockdown of SLC25A1.

[0051] Figure 12 This is a diagram showing the relationship between SLC25A1 and lipophage in Example 3 of the present invention. A is the KEGG enrichment analysis of RNA-seq data of SLC25A1 knockdown LX-2 cells, B is the analysis of autophagy marker proteins of primary hepatic stellate cells at 0 days (quiescent) and 5 days (activated), C is the autophagy immunoprotein and transmission electron microscopy images of quiescent and activated hepatic stellate cells, D is the fluorescence colocalization of lipid droplets and lysosomal markers, and E is the analysis of autophagy marker proteins after SLC25A1 knockdown in vitro.

[0052] Figure 13 This is a diagram of SLC25A1 blocking lipophage analysis in Example 3 of the present invention. A is an image of autophagy immunoproteins and transmission electron microscopy of hepatic stellate cells after SLC25A1 knockdown; B is the fluorescence colocalization of lipid droplets and lysosomal markers after SLC25A1 knockdown; and C is the analysis of autophagy marker proteins after adding autophagy inhibitors following SLC25A1 knockdown in vitro.

[0053] Figure 14 This is a diagram showing the lipophage blocking effect of PLIN2 protein overexpression in Example 3 of the present invention. A is a heatmap of related proteins after SLC25A1 knockdown, B is the expression of PLIN2 protein in primary hepatic stellate cells cultured for 0 days (quiescent) and 5 days (activated), C is the change in PLIN2 protein expression after SLC25A1 knockdown, D is the immunolocalization of PLIN2 and lysosomes in fibrotic liver tissue, E is the change in the level of autophagy marker proteins after PLIN2 overexpression, and F is the autophagy immunofluorescence image after PLIN2 overexpression.

[0054] Figure 15 The diagrams shown in Example 3 of this invention illustrate the blocking of lipophage by PLIN2 protein after SLC25A1 knockdown. In this diagram, A shows the co-localization of PLIN2 with lysosomal markers after PLIN2 overexpression; B shows the autophagy immunofluorescence image after co-transformation of SLC25A1 and PLIN2; C shows the co-localization of PLIN2 with lysosomal markers after SLC25A1 knockdown; and D shows the co-localization of PLIN2 with lysosomal markers after co-transformation of SLC25A1 and PLIN2.

[0055] Figure 16 This is a diagram showing the restoration of the PPARγ signaling pathway by SLC25A1 knockdown in Example 3 of the present invention. In this diagram, A is a GSEA enrichment analysis diagram, B is the PPARγ protein expression of primary hepatic stellate cells cultured for 0 days (quiescent) and 5 days (activated), C is the PPARγ protein expression after SLC25A1 knockdown, and DE is the immunolocalization and quantification of PPARγ and α-SMA in primary hepatic stellate cells of the MCD model after AAV6 treatment.

[0056] Figure 17 This is an example of SLC25A1 knockdown blocking lipophage via the PPARγ / PLIN2 axis in Example 3 of the present invention. AB represents a dual-luciferase reporter gene assay, C represents the fluorescence staining of lipid droplets after co-transformation of SLC25A1 and PPARγ, D represents the change in expression of fibrosis marker proteins after co-transformation of SLC25A1 and PPARγ, E represents the change in expression of autophagy marker proteins after co-transformation of SLC25A1 and PPARγ, F represents the immunofluorescence protein map of autophagy after co-transformation of SLC25A1 and PPARγ, and F represents the fluorescence co-localization map of PLIN2 and lysosomal markers after co-transformation of SLC25A1 and PPARγ.

[0057] Figure 18 In Embodiment 3 of the present invention Pparγ + / - The image shows the therapeutic effects of gene-modified mouse nanovesicle targeted therapy. In the image, A represents the anti-fibrotic effect of the BDL model, B represents the anti-fibrotic effect of the MCD diet model, and C represents the anti-fibrotic effect of the CCl4 model.

[0058] Figure 19 This is a diagram of SLC25A1-enhanced PPARγ protein ubiquitination analysis in Example 3 of the present invention. AB represents the PPARγ mRNA and protein levels after SLC25A1 overexpression, CD represents the CHX tracking analysis and protein quantification of PPARγ after SLC25A1 knockdown, EF represents the effect of the proteasome inhibitor MG132, and GH represents the effect of the autophagy inhibitor CQ.

[0059] Figure 20 This is a diagram illustrating the K48-linked ubiquitination at K197 of the PPARγ protein enhanced by SLC25A1 in Example 3 of this invention. A is a Co-IP analysis diagram of PPARγ ubiquitination levels after SLC25A1 knockdown; B is the Co-IP ubiquitination assay of the ubiquitin mutant; C is the site-directed mutation for PPARγ ubiquitination detected by Co-IP ubiquitination; D shows the protein levels of fibrosis and autophagy markers in PPARγ WT or K197R mutants; and E shows the immunofluorescence co-localization of PLIN2 and lysosomal markers in PPARγ WT or mutants. Figure 21This is a diagram of NEDD4 as a PPARγ ubiquitination E3 ligase in Example 3 of the present invention. In the diagram, A is the Venn diagram of IP-MS and screening of the PPARγ interacting protein database, B is the mass spectrometry identification of NEDD4 as a PPARγ interacting protein, C is the determination of NEDD4 enzyme activity, D is the determination of cytoplasmic acetyl-CoA level in cells, EF is the Co-IP analysis of NEDD4-PPARγ interaction, and G is the analysis of PPARγ protein level after NEDD4 overexpression with or without MG132 treatment.

[0060] Figure 22 The images show SLC25A1-enhanced NEDD4 acetylation and autophagy in Example 3 of this invention. A represents the ubiquitination assay after co-transformation of SLC25A1 and NEDD4; B represents the immunofluorescence protein image of autophagy after co-transformation of SLC25A1 and NEDD4; C represents the immunofluorescence co-localization map of NEDD4 and ubiquitinated acetylation after SLC25A1 knockdown; D represents the Co-ip map of NEDD4 acetylation after SLC25A1 knockdown; E represents the NEDD4 enzyme activity assay after SLC25A1 knockdown; and F represents the acetyl-CoA level assay after SLC25A1 knockdown.

[0061] Figure 23 This is a diagram showing how SLC25A1 enhances NEDD4 acetylation to drive PPARγ ubiquitination degradation in Example 3 of the present invention. In this diagram, A is the PPARγ ubiquitination level after SLC25A1 knockdown by TSA treatment, B is the autophagy immunofluorescence protein diagram after SLC25A1 knockdown by TSA treatment, and C is the co-localization of PLIN2 and lysosomal markers by immunofluorescence after SLC25A1 knockdown by TSA treatment. Detailed Implementation

[0062] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, the technical terms used below have the same meaning as understood by those skilled in the art.

[0063] Unless otherwise specified, the test materials and reagents used in the following examples are commercially available or prepared by known methods.

[0064] Unless otherwise specified, all techniques or conditions described in the embodiments can be performed in accordance with the techniques or conditions described in the literature in this field or in the product manual. Unless otherwise specified, the quantitative experiments in the following embodiments are all repeated three times or more, and the results are averaged.

[0065] Example 1: SLC25A1 as a diagnostic target and biomarker for liver fibrosis Transcriptome sequencing was performed on primary hepatic stellate cells from normal and CCl4-induced liver fibrosis mice to analyze differentially expressed gene profiles related to lipid metabolism. We integrated transcriptome data on human liver fibrosis from the GEO database (GSE84044) to analyze the association between SLC25A1 expression and liver fibrosis stage.

[0066] Tissues from clinical patients and mouse liver fibrosis induced by CCl4, BDL, MCD, and HFD diets were collected. Immunofluorescence was used to detect the co-localization and expression levels of SLC25A1 and α-SMA. In spontaneously activated primary hepatic stellate cells cultured in vitro for 5 days and in TGF-β1-induced LX-2 cell models, RT-qPCR and Western blot were used to detect the expression of SLC25A1, α-SMA, and COL1A1. BODIPY staining was used to quantify changes in lipid droplet content, and the correlation between SLC25A1 expression and the degree of hepatic stellate cell activation and lipid droplet loss was analyzed.

[0067] Results: SLC25A1 expression was significantly upregulated in activated hepatic stellate cells of patients with liver fibrosis and various animal models of liver fibrosis (e.g., Figure 3 (As shown). To identify the molecular switches controlling lipid droplet loss during hepatic stellate cell activation, transcriptomic analysis was performed on primary hepatic stellate cells isolated from control and CCl4 fibrotic mouse groups. RNA-seq revealed significant changes in the expression profile of lipid metabolism-related genes in activated hepatic stellate cells, with SLC25A1 being one of the most significantly upregulated genes (e.g., ...). Figure 3 (As shown in A).

[0068] Further analysis of the GEO dataset GSE84044 showed that SLC25A1 expression was positively correlated with the progression of liver fibrosis in humans (e.g., Figure 3 (As shown in Figure B). Simultaneously, elevated expression of SLC25A1 was found in the patient's fibrotic liver tissue. (e.g.) Figure 3 (As shown in C). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blot analysis confirmed that SLC25A1 was specifically and significantly upregulated in activated primary hepatic stellate cells (e.g., as shown in C). Figure 3 (As shown in D and E).

[0069] This upregulation was further validated in mouse models of liver fibrosis induced by CCl4, MCD diet, high-fat diet (HFD), and bile duct ligation (BDL), all of which showed significant co-localization of SLC25A1 with α-SMA (e.g., Figure 3(See Figure F). A schematic diagram illustrating the therapeutic mechanism of SLC25A1 in hepatic stellate cell activation and liver fibrosis is shown below. Figure 2 As shown.

[0070] Example 2: SLC25A1 as a therapeutic target for anti-liver fibrosis 2.1 AAV6-mediated SLC25A1 knockdown alleviates liver fibrosis in vivo To evaluate the functional role of SLC25A1 in vivo, adeno-associated virus serotype 6 (AAV6) was used to deliver short hairpin RNA (AAV-shSLC25A1) or control shRNA (AAVshNC) targeting SLC25A1 in three mouse models of liver fibrosis (CCl4, MCD diet, and BDL).

[0071] The sequence of AAV-shSLC25A1 is: CTGCGGCTTGAAGATCCTAAA. (SEQ ID NO. 2) Three weeks after mice were injected with AAV6-shSLC25A1 and control virus via the tail vein, CCl4 was induced (for 6 weeks). Three liver fibrosis models were established: MCD diet (6 weeks), bile duct ligation (BDL) (3 weeks). Serum ALT, AST, TG, TC, and Tbil levels were measured after model establishment; liver tissue H&E, Masson, and Oil Red O staining were used to assess the treatment efficacy for liver fibrosis.

[0072] Results: Administration of AAV-shSLC25A1 led to a decrease in serum markers of liver injury and dysfunction (e.g., Figure 4 The results (as shown in the AI) include alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglycerides (TG), total cholesterol (TC), and total bilirubin (Tbil).

[0073] Furthermore, AAV-shSLC25A1 treatment prevented weight loss in all three models (e.g. Figure 5 (As shown in AC). Histopathological evaluation by H&E, Masson staining, and Oil Red O staining further indicated that liver fibrosis was significantly reduced in all models (e.g., Figure 5 (As shown in the DF). This multimodal evaluation collectively demonstrates that AAV6-mediated SLC25A1 knockdown effectively alleviates liver fibrosis in vivo.

[0074] 2.2 Nanovesicle-mediated SLC25A1 knockdown reduces liver fibrosis in vivo Hyaluronic acid-modified, biomimetic HA@JMNVs / siSLC25A1 nanovesicles for activating hepatic stellate cell membranes were prepared and characterized. The ratio of DOTAP to activated hepatic stellate cell membrane was 10:5, and the mass ratio of siRNA to DOTAP was 0.3:1.

[0075] SLC25A1 siRNA sequence: 5'-3': GCCAUAGUGUUUGUCAUCUTT. (SEQ ID NO. 1) To evaluate the stability and biosafety of nanovesicles, and to verify their in vitro targeted uptake and in vivo distribution. The synthetic pathway, characterization, targeting efficiency, biocompatibility, in vivo distribution, and knockdown efficiency of the nanovesicles are described in [link to relevant documentation]. Figure 6-9 As shown.

[0076] A mouse model of liver fibrosis induced by CCl4 and MCD diets was established. Two weeks after modeling, different nano-formulations were injected via tail vein (once a week for a total of 4 times). A mouse model of liver fibrosis induced by BDL was also established, with different nano-formulations injected via tail vein the day after modeling (once a week for a total of 3 times). The knockdown efficiency of SLC25A1 was detected by isolating primary hepatic stellate cells from mice. The therapeutic effect of liver fibrosis was assessed by H&E, Masson, and Oil Red O staining of liver tissue. Immunofluorescence was used to detect α-SMA expression and the distribution of FAM-labeled siRNA, and the spatial correlation between nanovesicle enrichment areas and activation inhibition was analyzed.

[0077] To evaluate the therapeutic efficacy of the dual-targeted delivery platform, CCl4, BDL, and MCD diet models were treated weekly with one of three formulations (0.75 mg siRNA / kg) via tail vein injection: NVs / siSLC25A1 (non-targeted), HA@NVs / siSLC25A1 (CD44-targeted), or HA@JMNVs / siSLC25A1 (dual-targeted).

[0078] It is worth noting that the knockdown effect of HA@JMNVs / siSLC25A1 is better than that of HA@NVs / siSLC25A1 (e.g. Figure 10 The knockdown efficiency ratio shown in the AC was 62%, which is attributed to additional homologous membrane-mediated targeting. Histopathological evaluation showed that the most significant remission of liver fibrosis and steatosis was observed in treated mice with HA@JMNVs / siSLC25A1. Furthermore, immunofluorescence staining revealed decreased α-SMA expression in regions exhibiting high nanovesicle aggregation (FAM positive), indicating a spatial correlation between targeted delivery and therapeutic efficacy (e.g., Figure 10(As shown in AC). Furthermore, compared to AAV6-mediated SLC25A1 knockdown, this method demonstrated superior therapeutic efficacy, with a significant reduction in fibrotic area (mean Maoon quantification ratio 5.073%: 3.763%, P < 0.05).

[0079] Example 3: Molecular mechanism of SLC25A1 as a therapeutic target for anti-liver fibrosis 3.1 SLC25A1 regulates lipophage through the PPARγ / PLIN2 axis We elucidated the core mechanism by which SLC25A1 regulates lipid droplet metabolism in hepatic stellate cells, screened the key effector molecule PLIN2, clarified its function of affecting lipid droplet homeostasis through lipophage, analyzed the upstream transcriptional regulator PPARγ, and verified the role of this signaling axis through in vitro and in vivo functional complementation.

[0080] (1) Screening and verification that PLIN2 is a key effector molecule of SLC25A1 in regulating lipid droplet homeostasis. To evaluate the role of SLC25A1 in lipid droplet loss and hepatic stellate cell activation, we examined its expression and functional role in primary hepatic stellate cells and LX-2 cells.

[0081] • Screen and validate differentially expressed genes related to metabolism TGF-β1-induced LX-2 cells transfected with siSLC25A1 were subjected to transcriptome sequencing to screen for differentially expressed genes (|log2FC|≥1.5, p<0.05). Heatmap analysis was performed to identify changes in lipid droplet coating protein family genes, focusing on PLIN2.

[0082] Changes in PLIN2 expression were verified by RT-qPCR and Western blot in spontaneously activated primary hepatic stellate cells cultured in vitro for 5 days and in TGF-β1-induced LX-2 cells.

[0083] • Validate the correlation between SLC25A1-PLIN2 and changes in lipid droplet content. SLC25A1 was knocked down in TGF-β1-induced LX-2 cells, and in primary hepatic stellate cells isolated from mice after nanovesicle treatment, lipid droplet changes were observed by BODIPY staining, and PLIN2 expression levels were detected by RT-qPCR and Western blot to analyze the correlation between SLC25A1 and PLIN2.

[0084] Results: Immunofluorescence staining showed that SLC25A1 and α-SMA co-localized in spontaneously activated primary hepatic stellate cells after 5 days of culture (e.g., ...). Figure 11 (As shown in Figure A). Lipid droplet content is negatively correlated with hepatic stellate cell activation (e.g., ...). Figure 11(As shown in BC). Notably, AAV-shSLC25A1 treatment restored lipid droplet content in primary hepatic stellate cells, thus highlighting the crucial role of SLC25A1 in regulating lipid droplet dynamics (e.g., Figure 11 (As shown in D). Simultaneously, this knockdown leads to a decrease in the mRNA and protein levels of α-SMA and COL1A1 (e.g., as shown in D). Figure 11 (As shown in the middle EF). The results indicate that SLC25A1 knockdown can reverse hepatic stellate cell activation and restore lipid droplet homeostasis.

[0085] (2) To reveal the functional mechanism by which PLIN2 affects the lipid droplet homeostasis of hepatic stellate cells by regulating lipophage. To investigate the molecular mechanism by which SLC25A1 regulates lipid droplet homeostasis, RNA-seq analysis was performed on activated LX-2 cells after SLC25A1 knockdown.

[0086] • Identify the dominant pathway by which SLC25A1 promotes lipid droplet degradation KEGG enrichment analysis was performed on the transcriptome data.

[0087] SLC25A1 was overexpressed in TGF-β1-induced LX-2 cells, and the cells were treated with lipolysis inhibitors (Atglistatin) and autophagy inhibitors (chloroquine), respectively. BODIPY staining was used to determine the lipid droplet degradation pathway.

[0088] SLC25A1 was knocked down in TGF-β1-induced LX-2 cells, and ULK1 and ATG7 expression were detected by RT-qPCR. LC3B-II / I and p62 were detected by Western blot. Autophagic flux was observed by mCherry-eGFP-LC3B transfection. The ultrastructure of autophagosomes and lipid droplets was observed by transmission electron microscopy.

[0089] Meanwhile, Western blot analysis was performed on the changes in the above-mentioned autophagy-related indicators in primary hepatic stellate cells isolated from mice after nanovesicle treatment.

[0090] Results: KEGG enrichment analysis showed that pathways related to lipid metabolism and autophagy were significantly affected (e.g., Figure 12 (As shown in Figure A). In activated primary hepatic stellate cells, a decrease in the autophagy substrate p62 was observed, while the LC3B-II / I ratio increased (as shown in Figure A). Figure 12 (As shown in Figure B). Autophagy flux was further analyzed using mCherry-GFP-LC3B fluorescence and transmission electron microscopy, revealing a robust autophagy flux in activated hepatic stellate cells (e.g., ...). Figure 12 (As shown in C). Furthermore, enhanced co-localization of lipid droplets with the lysosomal marker LAMP1 (lysosome-associated membrane protein 1) was detected (e.g., Figure 12(As shown in D). These data indicate that lipophage is enhanced during hepatic stellate cell activation.

[0091] To further explore the effect of SLC25A1 on lipophagy, it was found that knocking down SLC25A1 decreased the LC3B-II / I ratio and increased p62 accumulation. This indicates impaired autophagy flux (e.g., Figure 12 (As shown in E). However, chloroquine interference cannot reverse this effect (e.g. Figure 13 (As shown in C). SLC25A1 knockdown also reduced the number of autophagy spots, autophagy flux, and lipid droplet-lysosome binding (e.g., as shown in C). Figure 13 (As shown in AB). The above studies indicate that SLC25A1 knockdown reverses hepatic stellate cell activation and restores lipid droplet homeostasis through the lipophage pathway.

[0092] • Verify the mediating role of PLIN2 in SLC25A1 regulation of lipophage and lipid droplet homeostasis. To understand how SLC25A1 regulates lipid droplet homeostasis, we analyzed the expression of lipid droplet-related proteins.

[0093] SLC25A1 was knocked down in TGF-β1-induced LX-2 cells, or PLIN2 siRNA was simultaneously transfected for complementation experiments. Lipid droplet content was observed using BODIPY staining; lipophage-related proteins were detected by Western blot; co-localization of PLIN2 and LAMP1 was detected by immunofluorescence; autophagic flux was observed using mCherry-eGFP-LC3B transfection; and the ultrastructure of autophagosomes and lipid droplets was observed by transmission electron microscopy. The co-localization of PLIN2 and LAMP1 in primary mouse hepatic stellate cells after nanovesicle treatment was also detected by immunofluorescence.

[0094] Results: Heatmap analysis showed that after SLC25A1 knockdown, the lipid droplet coating protein PLIN2 (also known as adipocyte differentiation-associated protein, ADRP) was significantly upregulated (e.g., ...). Figure 14 (As shown in Figure A). Reduced PLIN2 levels were observed in activated primary hepatic stellate cells (e.g., ...). Figure 14 (As shown in Figure B). In vitro, SLC25A1 knockdown restored PLIN2 expression (as shown in Figure B). Figure 14 (As shown in C). In liver tissue treated with CCl4, PLIN2 expression was reduced in α-SMA-positive regions (e.g., ...). Figure 14 (As shown in D). Overexpression of PLIN2 leads to p62 accumulation, a decreased LC3B II / I ratio, a reduction in autophagy spots, and a decrease in PLIN2-LAMP1 colocalization (as shown in D). Figure 14 Medium EF, Figure 15 As shown in Figure A), this indicates impaired autophagy flux. Furthermore, it was found that α-SMA expression decreased after PLIN2 overexpression (e.g., ...). Figure 14(As shown in E). Importantly, SLC25A1 knockdown resulted in a reduction in the number of autophagy spots (e.g., ...). Figure 15 As shown in Figure B), LAMP1-PLIN2 colocalization is reduced (e.g., Figure 15 (As shown in C). However, these effects are salvaged by co-knockdown of PLIN2 (if... Figure 15 As shown in Figures B and D, this further supports the role of PLIN2 in blocking lipophagy. In summary, these results indicate that SLC25A1 knockdown blocks lipophagy via PLIN2.

[0095] (3) Reveal the molecular mechanism by which PPARγ, as an upstream transcription factor, regulates PLIN2 expression. • Screening for signaling pathways that are significantly enriched after SLC25A1 knockdown To explore the downstream core molecules affected by SLC25A1 knockdown and lipophagus, GSEA enrichment analysis was performed on transcriptome data. SLC25A1 was knocked down in spontaneously activated primary hepatic stellate cells cultured for 5 days and TGF-β1-induced LX-2 cells. PPARγ mRNA and protein expression were detected. Immunofluorescence was used to detect the co-localization of PPARγ and α-SMA in primary hepatic stellate cells.

[0096] • Verify the direct transactivation effect of PPARγ on the PLIN2 promoter. A PLIN2 promoter luciferase reporter plasmid was constructed and co-transfected with a PPARγ overexpression plasmid into LX-2 cells. Luciferase activity was then detected.

[0097] The results showed that the peroxisome proliferator-activated receptor (PPAR) signaling pathway was significantly affected by SLC25A1 knockdown (e.g., Figure 16 (As shown in Figure A). Subsequent phases of the study focused on PPARγ, a nuclear transcription factor that regulates lipid metabolism. In activated primary hepatic stellate cells, PPARγ levels were decreased (e.g., Figure 16 (As shown in Figure B). In TGF-β1-induced LX In 2 cells, SLC25A1 knockdown led to the restoration of PPARγ expression (e.g., Figure 16 (As shown in C). Furthermore, immunofluorescence staining revealed a negative correlation between PPARγ and α-SMA in primary hepatic stellate cells isolated from MCD diet-induced mice (e.g., ...). Figure 16 (As shown in DE). Dual-luciferase reporter gene assays confirmed that PPARγ directly trans-activates the PLIN2 promoter (as shown in DE). Figure 17 (As shown in AB). Based on a combination of transcriptomics and functional analysis, it is hypothesized that SLC25A1 knockdown blocks lipophage flux through the PPARγ / PLIN2 axis.

[0098] (4) Elucidate the role of PPARγ in SLC25A1-regulated hepatic stellate cell activation and liver fibrosis. • Clarify the regulatory effects of PPARγ on the activation phenotype and lipophage of hepatic stellate cells. TGF-β1-induced LX-2 cells were co-transfected with siSLC25A1 and PPARγ siRNA to detect the expression of α-SMA, COL1A1, and PLIN2; lipid droplets were observed by BODIPY staining; autophagic flux was detected by mCherry-eGFP-LC3B; co-localization of PLIN2 and LAMP1 was detected by immunofluorescence; and the ultrastructure was observed by transmission electron microscopy.

[0099] • Validating targeted delivery of siSLC25A1 Pparγ + / - Anti-hepatic fibrosis efficacy in gene-modified mice Constructing PPARγ heterozygous knockdown mice ( Pparγ + / - (), induced CCl4, MCD, and BDL liver fibrosis models, and compared phenotypic differences with wild-type. In Pparγ + / - A liver fibrosis model was induced in wild-type mice, and nanovesicles were injected via the tail vein for treatment. After treatment, liver tissue was collected and stained with H&E, Masson's stain, and Oil Red O to compare the differences in liver fibrosis improvement between the two groups. Primary hepatic stellate cells from the treated mice were isolated, and BODIPY staining was used to observe the recovery of lipid droplets. Immunofluorescence was used to detect the co-localization of PLIN2 and LAMP1.

[0100] To further evaluate the function dependence of SLC25A1 on PPARγ, co-knockdown experiments were performed in activated LX-2 cells. Although knockdown of SLC25A1 alone increased lipid droplet content, simultaneous knockdown of PPARγ reversed this effect (e.g., Figure 17 (As shown in C). Co-knockdown of PPARγ rescued the expression of fibrosis markers that were suppressed by SLC25A1 knockdown alone (e.g., Figure 17 (As shown in D). Furthermore, the blockage of autophagy flux induced by SLC25A1 knockdown was reversed after PPARγ co-knockdown, LC3B... II / I ratio and p62 level, as Figure 17 As shown in E, mCherry GFP LC3B fluorescence and TEM, etc. Figure 17 As shown in Figure F. Consistent with these observations, the reduced co-localization of PLIN2 and LAMP1 after SLC25A1 knockdown was reversed by PPARγ co-knockdown (as shown in Figure F). Figure 17(As shown in G). In summary, these results indicate that knockdown of SLC25A1 blocks lipophage flux through the PPARγ / PLIN2 axis.

[0101] To investigate the hypothesis that PPARγ mediates the role of SLC25A1 in vivo, we used PPARγ heterozygous knockdown mice ( Pparγ + / - Compared to wild-type (WT) littermates, these mice exhibited more severe liver damage and increased collagen deposition in CCl4-, MCD-diet, and BDL-induced fibrosis models. These findings suggest that decreased PPARγ expression exacerbates liver fibrosis in vivo. In wild-type mice, targeted delivery of HA@JMNVs / siSLC25A1 has been shown to effectively alleviate fibrosis. In contrast, this therapeutic effect was observed in... Pparγ + / - Collagen deposition was largely eliminated in mice, and there was no significant improvement in collagen deposition compared to the fibrotic group (e.g., Figure 18 (As shown in AC). WT and Pparγ + / - The significant differences in treatment response in mice across three different fibrosis models suggest that the antifibrotic efficacy of SLC25A1 knockdown depends on in vivo PPARγ.

[0102] Molecular mechanism by which the SLC25A1-NEDD4-PPARγ axis drives lipopygia in hepatic stellate cells To elucidate the post-translational modification mechanism by which SLC25A1 regulates PPARγ protein stability, identify the key E3 ligase mediating PPARγ ubiquitination, and reveal the regulatory role of SLC25A1-derived Acety1-CoA in the acetylation modification of this E3 ligase.

[0103] (1) Confirmation that SLC25A1 regulates PPARγ protein stability through the ubiquitin-proteasome pathway. Experiment 1: Clarifying the Regulation of PPARγ Protein Stability and Degradation Pathway by SLC25A1 SLC25A1 was overexpressed or knocked down in TGF-β1-induced LX-2 cells, and the levels of PPARγ mRNA and protein were detected. The protein half-life was analyzed by CHX. PPARγ protein levels were detected by Western blot after treatment with MG132 (proteasome inhibitor) and CQ (autophagy inhibitor) to determine the degradation pathway.

[0104] Experiment 2: Identification and verification of the chain type and key modification sites of SLC25A1 promoting PPARγ ubiquitination. Co-IP was used to detect PPARγ ubiquitination levels in LX-2 cells after SLC25A1 knockdown, and the chain type was identified by combining K48 / K63 ubiquitin mutants; mass spectrometry and lysine point mutations were used to identify key ubiquitination sites. Wild-type and site-mutant PPARγ were transfected into activated LX-2 cells, and changes in PLIN2 expression, lipid droplet content, and autophagic flux were detected.

[0105] (2) Identification of NEDD4 as a key E3 ligase mediating PPARγ ubiquitination Experiment 1: Screening for candidate E3 ligases interacting with PPARγ. SLC25A1 was knocked down in TGF-β1-induced LX-2 cells. Immunoprecipitation was performed using PPARγ antibody, and interacting proteins were screened by LC-MS / MS analysis. Candidate E3 ligases (SI / IGG>3.5) were identified by combining the data with a database.

[0106] Experiment 2: Verifying the expression changes, enzyme activity, and binding of NEDD4 to PPARγ in activated hepatic stellate cells. SLC25A1 was knocked down in primary hepatic stellate cells spontaneously activated after 5 days of in vitro culture, after nanovesicle therapy, and in a TGF-β1-induced LX-2 cell model. Western blot was used to detect changes in NEDD4 protein expression. In the TGF-β1-induced LX-2 cell model, SLC25A1 was knocked down, and Co-IP was used to detect the effect of SLC25A1 knockdown on NEDD4-PPARγ binding. Overexpression of NEDD4 was used to detect changes in PPARγ protein levels and ubiquitination. MG132 treatment was used to verify the degradation pathway dependence.

[0107] (3) It was revealed that SLC25A1 enhances its E3 activity through NEDD4 acetylation modification mediated by Acety1-CoA. Experiment 1: Verifying the regulatory effect of SLC25A1 on NEDD4 acetylation levels In primary hepatic stellate cells isolated from SLC25A1-knockdown LX-2 cells and nanovesicle-treated mice, cytoplasmic Acety1-CoA levels and NEDD4 enzyme activity were detected; Co-IP was used to detect changes in NEDD4 acetylation levels; immunofluorescence was used. Observe the changes in NEDD4 acetylation and cellular localization under light.

[0108] Experiment 2: Verifying the regulatory role of NEDD4 acetylation on PPARγ ubiquitination In SLC25A1 knockdown LX-2 cells, treatment with a deacetylase inhibitor (TSA) was performed, and changes in NEDD4 acetylation levels, NEDD4-PPARγ binding, and PPARγ ubiquitination levels were detected to verify the regulation of E3 activity by acetylation.

[0109] Next, we aim to elucidate the mechanism by which SLC25A1 regulates PPARγ degradation. Although SLC25A1 overexpression did not decrease (and even slightly increased) PPARγ mRNA levels (e.g., Figure 19 (As shown in A), but it significantly reduced PPARγ protein levels (as shown in A). Figure 19 As shown in Figure B), this indicates the existence of a post-translational regulatory mechanism. Consistent with these findings, cycloheximide (CHX) tracking analysis showed that SLC25A1 knockdown significantly stabilized PPARγ and prolonged its half-life (as shown in Figure B). Figure 19 (As shown in CD). The reduction of PPARγ induced by SLC25A1 overexpression was reversed by the proteasome inhibitor MG132 (as shown in CD). Figure 19 (as shown in EF), but not reversed by the autophagy inhibitor chloroquine (CQ) (as shown in EF). Figure 19 As shown in GH), the ubiquitin-proteasome system was thus identified as the main degradation pathway. Co-immunoprecipitation (Co-IP) further confirmed that SLC25A1 knockdown reduced PPARγ ubiquitination levels (e.g., Figure 20 (As shown in Figure A). Using ubiquitin mutants that form specific linkages, we found that SLC25A1 specifically enhances the K48 linkage polyubiquitination of PPARγ (as shown in Figure A). Figure 20 (As shown in Figure B). To identify key ubiquitin receptor sites, mass spectrometry analysis of ubiquitinated PPARγ in SLC25A1 knockdown LX-2 cells revealed three potential lysine residues: K197, K382, and K386. Site-directed mutagenesis and ubiquitination assays showed that replacing lysine 197 with arginine (K197R) most effectively eliminated PPARγ ubiquitination (as shown in Figure B). Figure 20 As shown in Figure C), K197 was determined to be the main site of SLC25A1 regulation.

[0110] To assess the functional significance of this modification, the activities of wild-type PPARγ (WT) and the ubiquitination-resistant K197R mutant were compared. In activated hepatic stellate cells, overexpression of WT inhibited lipoplasty and reduced fibrosis markers (such as...). Figure 20 (As shown in D). Notably, compared to WT, the K197R mutant exhibits a more significant inhibitory effect on these processes. The K197R mutation leads to PLIN2-LAMP1 co-localization (as shown in D). Figure 20 (As shown in E) is significantly reduced, thereby decoupling lipid droplets from the degradation mechanism.

[0111] In summary, these findings establish a precise post-translational regulatory mechanism: SLC25A1 enhances K48-linked ubiquitination at K197 of the PPARγ protein, thereby targeting it for proteasome degradation.

[0112] SLC25A1 enhances NEDD4 acetylation to drive K48-linked ubiquitination and PPARγ degradation. The above findings indicate that SLC25A1 reduces PPARγ stability via the ubiquitin-proteasome pathway. However, the exact mechanism by which mitochondrial metabolic signaling is transmitted to PPARγ remains to be elucidated. We hypothesize that cytoplasmic acetyl-CoA regulated by SLC25A1 may directly acetylate PPARγ, thereby affecting its ubiquitination. This hypothesis contradicts earlier findings, which showed that acetylation typically enhances PPARγ stability. Given that E3 ubiquitin ligases are key determinants of substrate specificity in the ubiquitin-proteasome system, we hypothesize that SLC25A1 may indirectly affect PPARγ ubiquitination by regulating the activity or modification state of E3 ligases via acetyl-CoA. Therefore, identifying the upstream E3 ligases responsible for PPARγ ubiquitination and determining whether their activity is regulated by SLC25A1 / acetyl-CoA is a crucial step in resolving this paradox.

[0113] Through comprehensive database mining and immunoprecipitation-mass spectrometry (IP-MS, SI / IGG ratio > 3.5), NEDD4 was identified as the primary candidate (e.g., Figure 21 (As shown in Figure AB). It is noteworthy that SLC25A1 knockdown resulted in decreased NEDD4 enzyme activity (e.g., ...). Figure 21 (As shown in C). Co-IP analysis further showed that SLC25A1 knockdown weakened the interaction between NEDD4 and PPARγ (as shown in C). Figure 21 (As shown in EF). The function of NEDD4 as a proteasome-dependent PPARγ degradation mediator was confirmed using MG132 assays (e.g., Figure 21 (As shown in G). Crucially, overexpression of NEDD4 reversed SLC25A1 knockdown-induced PPARγ ubiquitination and lipophagy. This effect was blocked by MG132, thus confirming that NEDD4 is a key E3 ubiquitin ligase (e.g., as shown in G). Figure 22 (As shown in AB).

[0114] We then investigated how SLC25A1 regulates NEDD4. Given that SLC25A1 acts as a citrate transporter to regulate cytoplasmic acetyl-CoA levels (e.g., ... Figure 21(Middle D), we hypothesized that it regulates NEDD4 through acetylation. Indeed, as Co-IP and immunofluorescence staining showed, SLC25A1 knockdown significantly reduced NEDD4 acetylation levels (e.g., Figure 22 (As shown in CD). Furthermore, treatment with the histone deacetylase inhibitor trichostatin A (TSA) can comprehensively enhance NEDD4 acetylation and its enzyme activity (e.g., Figure 22 As shown in EF), thereby rescuing SLC25A1 knockdown-induced PPARγ ubiquitination (as shown in EF). Figure 23 As shown in Figure A), autophagy flux (as shown in Figure A) Figure 23 (as shown in B) and co-localization of PLIN2-LAMP1 (as shown in B) Figure 23 The decrease (as shown in C).

[0115] In summary, these results define a novel metabolic regulatory signaling pathway. SLC25A1 induces NEDD4 acetylation by promoting the production of acetyl-CoA. Acetylated NEDD4 then catalyzes the K48-linked polyubiquitination of PPARγ at K197, labeling its proteasomal degradation and thereby promoting lipophage.

[0116] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of SLC25A1 inhibitors in the preparation of drugs for the prevention or treatment of liver fibrosis.

2. The application according to claim 1, characterized in that, The SLC25A1 inhibitors include one or more of the following: chemical drugs, peptide / protein drugs, and gene therapy drugs that inhibit SLC25A1.

3. The application according to claim 2, characterized in that, The gene drug is selected from: siRNA, dsRNA, shRNA, miRNA, SLC25A1 antisense nucleotide or any combination thereof that can reduce the expression level of SLC25A1; or constructs that can express or form the siRNA, dsRNA, shRNA, miRNA, SLC25A1 antisense nucleotide or any combination thereof.

4. According to claim 3, the siRNA sequence that can reduce SLC25A1 expression is: GCCAUAGUGUUUGUCAUCUTT; the shRNA sequence that can reduce SLC25A1 expression is: CTGCGGCTTGAAGATCCTAAA.

5. A product characterized in that, Its active ingredient is a substance that reduces the expression level of SLC25A1, and the function of the product is to prevent and / or treat liver fibrosis.

6. The product according to claim 5, characterized in that, The products include pharmaceuticals.

7. The product according to claim 6, characterized in that, The drug also includes a pharmaceutically acceptable carrier, including at least one of a solvent, polymer, liposome, recombinant viral vector, and eukaryotic recombinant expression vector.

8. The product according to claim 6, characterized in that, The drug is formulated into a pharmaceutically acceptable dosage form.

9. The product according to claim 8, characterized in that, The dosage forms include tablets, capsules, granules, pills, syrups, powders, granules, suppositories, drops, emulsions, injections, oral liquids, aerosols, or suspensions.

10. Application of SLC25A1 as a molecular marker in the preparation of diagnostic products for liver fibrosis screening and / or diagnosis.

Images