An ipomoea nil endophytic fungus and a fermentation optimization method for improving flavonoid production capacity of the endophytic fungus by using ipomoea nil straw

Abstract

The present application belongs to the field of microbial technology, and relates to a Ipomoea nil endophytic fungus and a fermentation optimization method for improving the flavonoid production capacity of the endophytic fungus by using Ipomoea nil straw. Alternaria The Ipomoea nil endophytic fungus is Alternaria sp.YZ43, which has been preserved in the China Center for Type Culture Collection on July 13, 2026, and the preservation number is CCTCC NO:M 20261631. In the present application, the Ipomoea nil straw is used as an induced carbon source, and six flavonoid-producing endophytic fungi (JZ12, JZ28, YZ7, YZ13, YZ43 and HZ30) are subjected to fermentation screening, and YZ43 is determined as a high-yield strain. By optimizing the straw addition amount of the seed liquid and the fermentation liquid and the fermentation time, the total flavonoid yield is increased by 36% compared with that before optimization, and the fermentation supernatant has an obvious bacteriostatic effect on Staphylococcus aureus. The strategy provides a new resource for flavonoid drugs, realizes the high-value utilization of straw, and establishes a feasible technical path for the microbial fermentation production of natural active substances.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology and relates to an endophytic fungus of Abelmoschus mandshuriensis and a fermentation optimization method for improving the flavonoid production capacity of the endophytic fungus using Abelmoschus mandshuriensis straw. Background Technology

[0002] Okra, a common medicinal plant belonging to the Malvaceae family and the genus Abelmoschus, has core active components, flavonoids, which possess antioxidant, anti-inflammatory, antibacterial, and nephroprotective pharmacological effects, making it an important raw material for various traditional Chinese medicines and health products. Traditional production uses the corolla as the medicinal part, often leaving large quantities of stems, leaves, and other byproducts unused, resulting in resource waste. Endophytic fungi can colonize healthy plant tissues without causing disease in the host and can synthesize natural products identical or similar to those of the host. Fermentation production of flavonoids using endophytic fungi offers advantages such as a short production cycle, no seasonal limitations, and ease of industrial scaling.

[0003] Currently, the conventional fermentation method for flavonoid production by endophytic fungi in Abelmoschus manihot is as follows: Flavonoid-producing endophytic fungi isolated from healthy Abelmoschus manihot tissue are inoculated into potato dextrose (PDB) liquid medium and cultured at 28℃ and 120 r / min for 5–7 days with shaking. After fermentation, the mycelium and supernatant are separated by centrifugation, and the total flavonoid content is determined (Du Lele, Chemical and Biotransformation Research on Non-Medicinal Parts of Abelmoschus manihot, Nanjing: Nanjing University of Chinese Medicine, 2016).

[0004] Other studies have attempted to utilize agricultural waste as a carbon source for microbial fermentation. For example, pulverized citrus peel pomace was directly added to a Bacillus fermentation medium and cultured at 28°C and 180 r / min for 48 hours, which enhanced the antibacterial activity of the fermentation products (Qian Cheng, Screening of Lemon Endophytic Bacteria and Their Transformation into Antimicrobial Compounds from Citrus Peel Pomace, Wuhu: Anhui University of Technology, 2024). This technology mainly promotes bacterial growth by providing a carbon source from waste, thereby increasing the synthesis level of common antimicrobial substances. However, it did not optimize the induction effect of okra straw on flavonoid-producing endophytic fungi fermentation, nor did it verify the content and functional activity of flavonoids in the fermentation products.

[0005] Current fermentation processes for flavonoid production by endophytic fungi in Abelmoschus mandshurica mainly rely on fully synthetic culture media, failing to utilize inexpensive agricultural byproducts such as Abelmoschus mandshurica straw. This results in high raw material costs and hinders the high-value utilization of straw. Large-scale cultivation of Abelmoschus mandshurica generates a large amount of stem byproducts, which are often discarded or burned, causing resource waste and environmental pollution. Existing fermentation cycles and process parameters lack systematic optimization, leading to low flavonoid yields and high costs, making it difficult to meet industrialization needs. Although some studies have attempted to use agricultural waste such as citrus peel pomace for microbial fermentation, their optimization targets are not flavonoid compounds, nor do they consider the regulation of flavonoid synthesis pathways by specific components of Abelmoschus mandshurica straw, making them unsuitable for direct application in flavonoid production by endophytic fungi in Abelmoschus mandshurica. Agricultural waste is rich in cellulose, hemicellulose, and active precursors, and can serve as an inexpensive carbon source and natural inducer to promote flavonoid synthesis. However, research on the systematic optimization of flavonoid production by endophytic fungi using okra straw as a substrate is currently lacking. The mechanisms by which key conditions such as straw addition, fermentation time, and culture medium ratio affect flavonoid yield and antibacterial activity are still unclear. There are shortcomings in resource utilization efficiency, yield stability, functional development, and industrial adaptability. It is urgent to develop a fermentation method for optimizing flavonoid production by endophytic fungi using okra straw to achieve high-value utilization of waste, reduce costs, increase yield, and support the green and sustainable development of the okra industry. Summary of the Invention

[0006] The purpose of this invention is to overcome the technical shortcomings of existing processes for producing flavonoids through fermentation with endophytic fungi from Abelmoschus manihot, addressing issues such as high raw material costs, significant waste of straw resources, low flavonoid yield, and limited product functionality. Specifically, this invention aims to screen and obtain a dominant endophytic fungal strain that exhibits a significant response to Abelmoschus manihot straw and stable flavonoid production performance. Through systematic optimization of key process parameters such as fermentation time, fermentation broth, and the amount of straw added to the seed liquid, a fermentation optimization method is constructed to enhance the flavonoid production capacity of endophytic fungi using Abelmoschus manihot straw. This invention aims to significantly increase the total flavonoid yield and antibacterial activity against Staphylococcus aureus in the fermentation products while achieving high-value utilization of Abelmoschus manihot straw and reducing fermentation production costs, thus providing an efficient, economical, and stable technical path for the green industrial production of natural flavonoid active ingredients.

[0007] The technical solution of this invention to solve the technical problem is as follows: In a first aspect of the invention, a dominant endophytic fungal strain that exhibits a significant response to okra straw and stable flavonoid production is provided; this endophytic fungal strain is a fungus belonging to the genus *Alternaria*. Alternaria sp. YZ43 has been deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, Hubei Province, China, on July 13, 2026, with accession number CCTCC NO: M 20261631.

[0008] In a second aspect of the invention, a fermentation optimization method is provided to enhance the flavonoid production capacity of endophytic fungi using okra straw. This method is applicable to fermentation processes where flavonoids mainly accumulate in the fungal cells, and can significantly increase the total flavonoid yield while shortening the fermentation cycle.

[0009] The steps of the method are as follows: (1) Activation and seed culture preparation: The YZ43 strain preserved on PDA slant medium as described in the first aspect was inoculated onto fresh PDA plates and activated in a constant temperature incubator at 28℃ for 7 days; the mycelium was inoculated into a modified PDB seed culture medium containing 5 g / L okra straw powder and cultured at 28℃ and 120 r / min for 2 days to prepare the seed culture; (2) Fermentation culture: The seed liquid was filtered with sterile gauze and the wet mycelium was collected; the inoculation amount was 5.3 g wet mycelium / 100 mL medium, and it was transferred to the modified PDB fermentation medium containing 1 g / L okra straw powder and cultured at 28℃ and 120 r / min for 2 days. (3) Product detection: The fermentation broth was centrifuged at 8000 r / min for 10 min to separate the cells and supernatant. The content was determined using a total plant flavonoid detection kit with rutin as the standard.

[0010] Furthermore, the PDA slant culture medium contains 4 g / L potato extract powder, 20 g / L glucose, and 15 g / L agar, with a pH of 5.6 ± 0.2. Preparation method: Weigh 4 g of potato extract powder, 20 g of glucose, and 15 g of agar, add distilled water to 1000 mL, autoclave at 115℃ for 20 min, cool, and then arrange on slant for later use.

[0011] Furthermore, the PDA plate culture medium contains 4 g / L potato extract powder, 20 g / L glucose, and 15 g / L agar, with a pH of 5.6 ± 0.2. Preparation method: Weigh 4 g of potato extract powder, 20 g of glucose, and 15 g of agar, add distilled water to 1000 mL, autoclave at 115°C for 20 min, cool, and pour into sterile plastic petri dishes for later use.

[0012] Furthermore, the modified PDB seed culture medium contains 6 g / L potato extract powder, 20 g / L glucose, and 5 g / L okra straw powder. Preparation method: Weigh 6 g of potato extract powder, 20 g of glucose, and 5 g of okra straw powder, add distilled water to 1000 mL, autoclave at 121℃ for 15 minutes, and set aside.

[0013] Furthermore, the modified PDB fermentation medium contains 6 g / L potato extract powder, 20 g / L glucose, and 1 g / L okra straw powder. The preparation method is as follows: Weigh 6 g of potato extract powder, 20 g of glucose, and 1 g of okra straw powder, add distilled water to 1000 mL, and autoclave at 121℃ for 15 minutes.

[0014] In a third aspect of the invention, another fermentation optimization method is provided to enhance the flavonoid production capacity of endophytic fungi using okra straw. The conditions in this method are most favorable for the secretion of flavonoids into the supernatant, and it is suitable for flavonoid extraction scenarios where the supernatant is the product. It can significantly increase the proportion of flavonoids secreted extracellularly, which is convenient for downstream extraction.

[0015] The steps of the method are as follows: (1) Activation and seed liquid preparation: The YZ43 strain preserved on PDA slant medium as described in the first aspect was inoculated onto a fresh PDA plate and activated in a constant temperature incubator at 28℃ for 7 days; then the mycelium was inoculated into a modified PDB seed medium containing no okra straw powder and cultured at 28℃ and 120 r / min for 2 days to prepare the seed liquid; (2) Fermentation culture: The seed liquid was filtered with sterile gauze and the wet mycelium was collected; the inoculation amount was 5.3 g wet mycelium / 100 mL medium, and it was transferred to the modified PDB fermentation medium containing 1 g / L okra straw powder and cultured at 28℃ and 120 r / min for 2 days. (3) Product detection: The fermentation broth was centrifuged at 8000 r / min for 10 min to separate the cells and supernatant. The content was determined using a total plant flavonoid detection kit with rutin as the standard.

[0016] Furthermore, the modified PDB seed culture medium, which does not contain okra straw powder, contains 6 g / L potato extract powder and 20 g / L glucose. Preparation method: Weigh 6 g of potato extract powder and 20 g of glucose, add distilled water to 1000 mL, autoclave at 121℃ for 15 minutes, and set aside.

[0017] The PDA slant culture medium, the PDA plate culture medium, and the modified PDB fermentation culture medium are the same as those described in the second aspect.

[0018] In a fourth aspect of the invention, the use of fermentation products obtained by the method described in the second or third aspect is provided in the preparation of antibacterial products.

[0019] Furthermore, the aforementioned antibacterial effect refers to the inhibition of Escherichia coli culture or Staphylococcus aureus.

[0020] This invention includes the following technological innovations: 1. Strain innovation: For the first time, a strain of Alternaria, YZ43, was screened from endophytic fungi of Abelmoschus manihot and showed a significant response to Abelmoschus manihot straw and stable flavonoid production. This strain can tolerate inhibitory components such as terpenes in straw and can still maintain a high flavonoid synthesis efficiency in straw matrix.

[0021] 2. Process Innovation: The three core parameters of seed liquid straw addition, fermentation liquid straw addition, and fermentation time were optimized simultaneously, breaking through the limitations of single-factor optimization and clarifying the "low-promotion, high-inhibition" law of straw addition: 5g / L of straw addition in seed liquid is most conducive to the accumulation of flavonoids in the microbial cells, 1g / L of straw addition in fermentation liquid is most conducive to the secretion of flavonoids in the supernatant, and the optimal fermentation time is 2 days.

[0022] 3. Application Innovation: While increasing flavonoid production, this study is the first to demonstrate that straw induction can confer antibacterial activity against Staphylococcus aureus on fermentation products, providing a new pathway for the development of natural antibacterial agents.

[0023] 4. Resource-based innovation: The originally discarded okra straw is transformed into a natural carbon source and inducer for endophytic fungal fermentation, replacing some components of synthetic culture medium. Compared with fully synthetic culture medium, the fermentation cost is reduced by more than 30%, realizing the green transformation of "waste into high-value products".

[0024] This invention, by introducing okra straw as an inducer and systematically optimizing fermentation parameters, has achieved the following significant effects: 1. Increased output and shortened cycle time Compared with conventional fermentation methods that only use synthetic culture media, this invention shortens the fermentation cycle from the conventional 5-7 days to 2 days, increasing production efficiency by more than 60%; the total flavonoid yield increases from 0.95 mg / g to 1.29 mg / g, an increase of about 36%; and the distribution of flavonoids in the cells and supernatant is more even, which is beneficial for subsequent separation.

[0025] 2. To endow the product with new antibacterial functions Conventional fermentation products contain only flavonoids and have no antibacterial activity. The optimized fermentation supernatant of this invention exhibits a minimum inhibitory concentration (MIC) of 0.062 μg / mL against Staphylococcus aureus, demonstrating extremely strong specific antibacterial function and providing a new approach for the development of natural antibacterial drugs.

[0026] 3. The strain has strong tolerance, reducing costs. The selected dominant strain YZ43 exhibits extremely high tolerance to inhibitory components in straw, with a flavonoid reduction of only 24% after straw addition (compared to >80% for other strains). Simultaneously, utilizing inexpensive straw to replace part of the synthetic carbon source reduces fermentation raw material costs by over 30%, achieving high-value utilization of agricultural waste.

[0027] The preservation information of the microorganisms involved in this invention is as follows: Depository Institution: China Center for Type Culture Collection Address of the depository: Wuhan University, Wuhan, Hubei Province, China Category Naming: Alternaria sp. YZ43 Accession number: CCTCC NO: M 20261631 Preservation date: July 13, 2026. Attached Figure Description

[0028] Figure 1 This describes the specific technical approach of the present invention.

[0029] Figure 2 The images show the physical samples of six high-flavonoid-producing strains and the comparison of total flavonoid content before and after fermentation optimization. (A) shows the culture medium after fermentation of the six high-flavonoid-producing strains with added straw; (B) shows the comparison of total flavonoid content before and after fermentation optimization of the six high-flavonoid-producing strains; -FJY indicates the fermentation broth group with added straw; those without -FJY are the group without added straw.

[0030] Figure 3 The characteristics of flavonoid secretion and total flavonoid content of six high-flavonoid-producing strains before and after fermentation optimization are compared. (A) Total flavonoid secretion (mg / g) of the six endophytic fungi before fermentation optimization; (B) Total flavonoid secretion (mg / g) of the six endophytic fungi after fermentation optimization. In the figures, red indicates high concentration, blue indicates low concentration, and darker colors indicate higher concentrations.

[0031] Figure 4 The results show the fermentation time optimization of YZ43 with different fermentation days. Among them, (A) the culture medium after YZ43 fermentation for different days; (B) the comparison of total flavonoid content after YZ43 fermentation for different days.

[0032] Figure 5 The results of optimizing the fermentation broth with different straw addition amounts for YZ43 are shown. Among them, (A) YZ43 with different straw addition amounts for fermentation broth; (B) comparison of total flavonoid content with different straw addition amounts for fermentation broth.

[0033] Figure 6 The results of optimizing the addition of straw to different amounts of seed liquid for YZ43 are presented. (A) YZ43 with different amounts of straw added to seed liquid; (B) Comparison of total flavonoid content with different amounts of straw added to seed liquid.

[0034] Figure 7 The image shows a comparison of the antibacterial activity of YZ43 aseptic supernatant before and after fermentation optimization. (A) Resazurin colorimetric method reaction begins at 0 h; (B) Resazurin colorimetric method reaction ends at 9 h. Detailed Implementation

[0035] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments.

[0036] The main reagents involved in the embodiments of this invention are shown in Table 1: Table 1: Main Reagents

[0037] Example 1

[0038] This invention provides a fermentation optimization method for enhancing the flavonoid production capacity of endophytic fungi using okra straw, the specific technical route of which is as follows: Figure 1 .

[0039] 1. Materials (1) Strain In the initial stage, 12, 36, 131, and 39 endophytic fungi were isolated from the roots, stems, leaves, and flowers of healthy okra plants at the end of their flowering period from the Chinese Medicinal Herb Resource Nursery of Jiangsu Vocational College of Agriculture and Animal Husbandry, Taizhou City, Jiangsu Province. Based on the total flavonoid content analysis, a total of 192 flavonoid-producing strains were screened, of which 87 were high-yielding strains (total flavonoid yield >0.9 mg / g).

[0040] The indicator bacteria Escherichia coli (ATCC 25922) and Staphylococcus aureus (ATCC 25923) were preserved by the Jiangsu Provincial Key Laboratory of High Technology Research on Veterinary Biopharmaceuticals at Jiangsu Vocational College of Agriculture and Animal Husbandry.

[0041] The six bacterial strains used in this invention (JZ12, JZ28, YZ7, YZ13, YZ43, and HZ30) were all isolated from different parts (stems, leaves, and flowers) of the aforementioned healthy okra plants. These strains were high-flavonoid-producing endophytic fungi (yield > 0.9 mg / g) obtained through prior screening. The fermentation strain was a fungus of the genus *Alternaria* (…). Alternaria sp . YZ43, after ITS sequence amplification and phylogenetic analysis, is related to... Alternaria destruens (NR_137143.1) has a 100% similarity. This strain has been submitted to the China Center for Type Culture Collection (CCTCC, address: Wuhan University, Wuhan, Hubei Province, China) for international deposit in patent proceedings, with accession number CCTCCNO: M 20261631 and deposit date of July 13, 2026.

[0042] Their characteristics are as follows: Morphological characteristics: On PDA medium, the colonies are grayish-black on the front and light brown on the back; the hyphae are septate, the conidiophores are erect, and the conidia are obpie-shaped with beaks.

[0043] Physiological characteristics: The optimal growth temperature is 28℃, the optimal shaking speed is 120 r / min, it can utilize cellulose and hemicellulose as carbon sources, and it has a strong tolerance to terpenoid inhibitory components in straw.

[0044] Functional characteristics: The total flavonoid yield increased by 36% under straw induction compared with the previous method, and the minimum inhibitory concentration (MIC) of the fermentation supernatant against Staphylococcus aureus was 0.062 μg / mL.

[0045] Total flavonoids refer to the flavonoid content detected by the kit in bacterial cells or supernatant. Because flavonoids are abundant, they are called total flavonoids. However, the detection of total flavonoid content after optimizing fermentation conditions with added straw involves detecting the total flavonoid content in the bacterial fermentation broth and the total flavonoid content in the control fermentation broth without added straw. Finally, the total flavonoid content of the bacterial strain after optimized fermentation conditions (i.e., net total flavonoid content) is calculated as follows: Total flavonoid content in bacterial fermentation broth - Total flavonoid content in the control fermentation broth without added straw.

[0046] (2) Okra stalks Collect fresh, disease-free okra stems, remove soil and impurities, rinse with tap water, and air dry in a ventilated place. Grind the okra stems using a herbal medicine grinder, pass through a 65-mesh sieve, and obtain okra stalk powder. Seal the powder and store it in a dry, dark environment for later use.

[0047] (3) Main reagents See Table 1 for details.

[0048] The following are the raw materials and preparation methods for the three culture media: PDA solid medium (HB0233-1): Contains 4 g / L potato extract powder, 20 g / L glucose, and 15 g / L agar, with a pH of 5.6 ± 0.2. Preparation method: Weigh 4 g of potato extract powder, 20 g of glucose, and 15 g of agar, add distilled water to 1000 mL, autoclave at 115℃ for 20 min, cool, and then plate or pour onto slant agar plates for later use.

[0049] Improved PDB seed culture medium: Contains 6 g / L potato extract powder, 20 g / L glucose, and 5 g / L okra straw powder. Preparation method: Weigh 6 g of potato extract powder, 20 g of glucose, and 5 g of okra straw powder, add distilled water to 1000 mL, autoclave at 121℃ for 15 minutes, and set aside.

[0050] Modified PDB fermentation medium: Contains 6 g / L potato extract powder, 20 g / L glucose, and 1 g / L okra straw powder. Preparation method: Weigh 6 g of potato extract powder, 20 g of glucose, and 1 g of okra straw powder, add distilled water to 1000 mL, autoclave at 121℃ for 15 minutes, and set aside.

[0051] (4) Strain numbering rules The strain numbering rules used in this experiment are as follows. For example, strain number YZ43-FJY-SQ indicates the supernatant isolated after fermentation of an endophytic fungus isolated from okra leaves. See Table 2 for details.

[0052] Table 2: Strain Numbering Rules

[0053] 2. Methods (1) Detection of total flavonoid content 1) Preparation of rutin standard: Transfer 20 μL of 10 mg / mL rutin standard solution into a 1.5 mL centrifuge tube, and prepare a series of concentration gradients (1.25, 0.625, 0.3125, 0.156, 0.078, 0.039, 0.02 mg / mL) using 60% anhydrous ethanol as solvent by serial dilution. Mix well and set aside for use in constructing a standard curve.

[0054] 2) Sample color development and determination: Endophytic strains that showed positive flavonoid color development reaction were selected, and the total plant flavonoids detection kit was used for color development reaction; 3 parallel experiments were set up for each group, and the absorbance value of each reaction system was measured at a wavelength of 510 nm using an enzyme-linked immunosorbent assay (ELISA) reader. Each sample solution was measured 3 times consecutively, and the results were recorded.

[0055] 3) Data Processing: A standard curve was plotted with the concentration of rutin standard as the x-axis and the corresponding absorbance value as the y-axis to establish a linear regression equation. The absorbance value measured in the sample was substituted into the equation to calculate the mass concentration of flavonoids in the sample solution. The total flavonoid content in the sample was calculated using the following formula: Total flavonoid content (mg / g dry weight) = X×V / W, where V is the volume of the sample extract (mL); W is the dry weight of the sample (g).

[0056] (2) DNA extraction and ITS sequence amplification 1) Extraction of endophytic fungal DNA: Take 20 mg of ground and dried mycelial powder, add 200 μL of solution A, mix thoroughly with a vortex mixer, add 2 μL of RNase A, then add 100 mg of glass beads, and vortex for 30 min. Then follow the instructions of the fungal genomic DNA extraction kit to complete the subsequent operations. The obtained DNA sample should be stored at 4℃ for later use.

[0057] 2) PCR amplification system: The extracted endophytic fungal DNA was amplified using a PCR instrument. A 50 μL reaction system was used: 2 μL of DNA diluted 1000-fold was added, 1 μL each of ITS1F and ITS4R were added as pre- and post-primers, 25 μL of 2×Rapid Taq Plus Master Mix, and 21 μL of ddH2O. See Table 3.

[0058] Table 3: PCR reaction system and conditions for endophytic fungi

[0059] The ITS1F primer sequence is: CTTGGTCATTTAGAGGAAGTAA (SEQ ID NO:1).

[0060] The ITS4R primer sequence is: TCCTCCGCTTATTGATATGC (SEQ ID NO:2).

[0061] Primers were synthesized by Shanghai Sangon Biotech, and PCR reaction reagents were purchased from Novizan (2 × Rapid Taq Plus Master Mix (Dye Plus) P223).

[0062] 3. Steps (1) Screening of strains with significant straw response Using a basal medium without added okra straw powder as a control, six tested endophytic fungi were cultured for 2 days in seed culture medium containing 5 g / L okra straw powder, and then transferred to fermentation medium containing 10 g / L okra straw powder for further culture. The total flavonoid content of the fermentation products of each strain was detected and compared. The results are shown in […]. Figure 2 .Depend on Figure 2 As shown in Figure B, different endophytic fungal strains exhibited significant differences in their response to okra straw and their flavonoid production capacity. In the control group without straw, all strains demonstrated a certain flavonoid synthesis capacity, with HZ30, JZ12, YZ7, and YZ13 showing higher supernatant flavonoid content, while JZ28 and YZ43 showed relatively higher cell flavonoid content. After straw was added, the total flavonoid production of all six strains decreased to varying degrees. Among them, strain YZ43 showed the smallest decrease (approximately 24%), and its cell and supernatant flavonoid distribution changed from a storage-type pattern to a more balanced distribution pattern. In contrast, the decreases of other strains all exceeded 80%. Therefore, YZ43 was identified as the dominant strain with the strongest response to straw and the best tolerance. Figure 3The heatmaps show the total flavonoid content of the six strains before and after fermentation optimization. It can be seen that the total flavonoid secretion characteristics of strain YZ43 changed after the addition of straw for fermentation optimization. Before optimization, total flavonoids were only produced in the cell, while after optimization, they were produced in both the supernatant and the cell and were basically evenly distributed.

[0063] (2) Fermentation time optimization The activated YZ43 strain was inoculated into a modified PDB seed medium containing 5 g / L okra straw powder and cultured at 28℃ and 120 r / min for 2 days to prepare seed culture. The seed culture was filtered through sterile gauze to collect wet mycelium, and then transferred to a modified PDB fermentation medium containing 5 g / L okra straw powder at an inoculation rate of 5.3 g wet mycelium / 100 mL medium.

[0064] They were cultured continuously for 2, 3, 4, 5, 6, 7, and 8 days at 28℃ and 120 r / min, respectively. Figure 4 In step A), a blank control group without inoculation was also set up. Mycelia and supernatant were separated, and the total flavonoid content was determined separately. Using the total flavonoid content as the evaluation index, the optimal fermentation time for flavonoid production by strain YZ43 was determined, and the results are as follows: Figure 4 As shown in Figure B, the cell flavonoids peaked on day 2 of fermentation (0.92 mg / g), the supernatant flavonoids peaked on day 5 (0.39 mg / g), while the total flavonoid yield was highest on day 2 (1.24 mg / g) and then declined. Therefore, the optimal fermentation time was determined to be 2 days.

[0065] (3) Optimization of the amount of straw added to the fermentation liquid Based on the optimal fermentation time (2 days), the addition amounts of okra straw powder in the fermentation broth were set to 0, 1, 2, 3, and 4 g / L respectively. Figure 5 (A) Prepare a series of modified PDB fermentation media.

[0066] YZ43 was inoculated into a seed culture medium containing 5 g / L straw powder and cultured at 28℃ and 120 r / min for 2 days to prepare seed liquid. After filtering and collecting the wet mycelium, it was transferred to the above fermentation culture medium with different straw addition amounts and cultured at 28℃ and 120 r / min for 2 days.

[0067] The total flavonoid content was determined and the background flavonoid value of straw was subtracted. The results are as follows: Figure 5 The results from Figure B show that the net flavonoid yield is highest (1.48 mg) when the straw addition amount in the fermentation broth is 1 g / L. When the addition amount is ≥2 g / L, the net yield after deduction is significantly reduced or even becomes negative due to the flavonoids contained in the straw itself. Therefore, the optimal straw addition amount in the fermentation broth is determined to be 1 g / L.

[0068] (4) Optimization of straw addition amount in seed liquid Based on the optimal fermentation time and optimal straw addition amount in the fermentation broth, the addition amounts of okra straw powder in the seed liquid were set to 0, 1, 2, 3, 4, and 5 g / L respectively. Figure 6 (A) Prepare a series of improved PDB seed culture media.

[0069] YZ43 was inoculated into the above-mentioned series of seed culture media and cultured at 28℃ and 120 r / min for 2 days to prepare seed liquid. After filtering and collecting the wet mycelium, it was transferred to a modified PDB fermentation medium containing 1 g / L straw powder and cultured at 28℃ and 120 r / min for 2 days.

[0070] The results are as follows Figure 6 The results from Figure B show that the highest accumulation of mycelial flavonoids (1.11 mg / g) was observed when the straw addition to the seed liquid was 5 g / L; while the highest flavonoid secretion in the supernatant (0.42 mg / g) was observed when the addition was 0 g / L. Therefore, if the focus is on mycelial flavonoid accumulation, the optimal addition of straw to the seed liquid is 5 g / L; if the focus is on supernatant flavonoid collection, the optimal addition is 0 g / L.

[0071] (5) Detection of antibacterial activity of strain metabolites after optimization of fermentation conditions Using Escherichia coli (ATCC 25922) and Staphylococcus aureus (ATCC 25923) as indicator bacteria, the inhibition rate was determined by the resplenoid staining method combined with the 96-well plate gradient dilution method.

[0072] 1) Indicator bacteria culture: Activate the indicator bacteria (glycerol strain) by streaking on LB agar plates and incubate upside down at 37°C for 18–24 h. After activation, store the strain at 4°C and use within one week. Pick single clones and inoculate them into 15 mL centrifuge tubes containing 6 mL and 8 mL of LB liquid medium, respectively. Incubate at 37°C and 180 r / min for 14 h with shaking to obtain the logarithmic growth phase bacterial suspension.

[0073] 2) Reagent preparation: ① Rezazon working solution: final concentration is 1 mg / mL, prepare and use immediately.

[0074] ②Streptomycin working solution: final concentration 1.28 mg / mL, used as a positive control for Escherichia coli.

[0075] ③ Vancomycin working solution: final concentration 0.512 mg / mL, used as a positive control for Staphylococcus aureus.

[0076] ④ Indicator bacteria dilution: Dilute the bacterial solution to 0.5 McFarland turbidity (OD600 = 0.08–0.13); then dilute 200 times and set aside.

[0077] ⑤ Resazurin-bacterial solution mixture: Take 10 mL of indicator bacterial solution diluted 200 times, add 2 mL of resazurin working solution, mix gently, and use for sample loading in 96-well plates.

[0078] 3) 96-well plate loading and gradient dilution: ① Plate preparation: Add 80 μL of LB liquid medium to each well in columns 1–11 of a 96-well plate, and add 180 μL of LB liquid medium to each well in column 12.

[0079] ② Sample addition: Add 80 μL of the sample to be tested to wells A1-G1 in column 1, and add the corresponding antibiotic working solution to well H1 as a positive control.

[0080] ③ Gradient dilution: Take 80 μL of liquid from column 1 to column 2, mix thoroughly by pipetting, and then dilute sequentially up to column 10. After mixing in column 10, discard 80 μL to ensure that the volume of each well is consistent.

[0081] 4) Inoculation and culture conditions: Add 120 μL of Resveratrol-bacterial solution to each well in columns 1-11, and add 20 μL of Resveratrol working solution to each well in column 12 as a blank control. Incubate the 96-well plate in a 37℃ incubator in the dark.

[0082] 5) Results Observation and Calculation: After culturing Escherichia coli for 5 h and Staphylococcus aureus for 8.5 h, the absorbance at 570 nm and 600 nm was measured using an ELISA reader. The inhibition rate was calculated using the following formula: Inhibition rate (%) = (OD value of negative drug-free wells - OD value of drug-treated wells) / (OD value of negative drug-free wells - OD value of positive blank wells) × 100%.

[0083] Experimental results are as follows Figure 7 As shown in Table 4: Table 4: Antibacterial activity parameters (MIC, IC50) and total flavonoid content of YZ43 after optimization .

[0084] The color development principle of azurlan is as follows: oxidized azurlan is blue; during bacterial growth, it is reduced to pink halogenated azurlan. The intensity of the color development is positively correlated with the activity of the indicator bacteria; the deeper the blue, the more significant the inhibition of bacterial growth and the stronger the antibacterial activity. Figure 7It can be seen that in this experiment, the positive control group (vancomycin) showed a distinct blue color in the wells, indicating that the growth of indicator bacteria was significantly inhibited; the LB blank control group showed a deep pink color in the wells, indicating normal growth of indicator bacteria, and the experimental system showed no obvious contamination, thus the results were valid. Comparison of fermentation product groups from different strains showed that: the YZ43 strain fermentation product group: at serial dilutions, the color in the wells was deep pink, indicating that the YZ43 strain fermentation product had no inhibitory activity on the growth of the tested indicator bacteria. The optimized YZ43 strain fermentation product group: at a 4-fold dilution, it showed a blue color, indicating certain antibacterial activity. The PDB and 1 g / CK blank control groups: remained deep pink throughout the process, with no obvious color change, indicating that the basal medium itself had no antibacterial activity, and the antibacterial effect came from the metabolites produced by the strain fermentation. The above confirms that fermentation optimization endowed the product with significant antibacterial function.

[0085] (6) Data statistical analysis Experimental data were organized and calculated using Excel. The average absorbance values ​​measured by the microplate reader were calculated, and the corresponding control group absorbance was subtracted to obtain the corrected absorbance. A standard curve was plotted with rutin concentration on the x-axis and corrected absorbance ΔA' on the y-axis, and a regression equation y = kx + b was fitted. The sample's corrected absorbance ΔA was substituted into the equation to calculate the concentration. The total flavonoid content of the sample was calculated using the formula: Total flavonoid content (mg / g) = x × 10. The inhibition rate was calculated using the formula: Inhibition rate = (OD value of negative drug-free wells - OD value of drug-treated wells) / (OD value of negative drug-free wells - OD value of positive blank wells). GraphPad Prism 8 software was used to calculate the standard deviation (SD) based on absorbance values, and stacked bar charts of bacterial cell and supernatant dry weight, total flavonoid content, and related experimental graphs were plotted.

[0086] Example 2 Fermentation production under optimal process conditions 1. Experimental Materials and Instruments Strains: Alternaria spp. fungi Alternaria sp YZ43 (Collection No.: CCTCC NO: M 20261631).

[0087] Raw material: Okra straw powder (passed through a 65-mesh sieve, prepared as before).

[0088] Culture medium: The raw materials and preparation methods for the three culture media are the same as in Example 1.

[0089] Instruments: 250 mL shake flask, ultra-clean workbench, constant temperature shaker (set to 28℃, 120 r / min), high-speed refrigerated centrifuge.

[0090] 2. Experimental Methods (1) Activation and seed culture preparation: The YZ43 strain preserved on PDA slant medium was inoculated onto fresh PDA plates and activated in a constant temperature incubator at 28℃ for 7 days. Three pieces of mycelial cake with a diameter of 1 cm were taken with a punch and inoculated into a 250 mL shake flask containing 70 mL of modified PDB seed medium (containing 5 g / L straw). The flask was placed in a constant temperature shaker and cultured at 28℃ and 120 r / min for 2 days.

[0091] (2) Fermentation culture: The seed liquid was filtered through sterile gauze and the wet mycelium was collected. 5.3 g of wet mycelium was weighed and inoculated into a 250 mL shake flask containing 100 mL of modified PDB fermentation medium (containing 1 g / L straw) and cultured at 28℃ and 120 r / min for 2 days.

[0092] (3) Product detection: The fermentation broth was centrifuged at 8000 r / min for 10 min to separate the bacterial cells from the supernatant. The content was determined using a total plant flavonoid detection kit.

[0093] 3. Experimental Results Experimental results are as follows Figure 6 As shown in Figure B, under these optimal process conditions, the total flavonoid content in the bacterial cells is 1.11 mg / g, the total flavonoid content in the supernatant is 0.18 mg / g, and the total flavonoid yield is 1.29 mg / g. These conditions are most conducive to the accumulation of flavonoids within the bacterial cells.

[0094] Example 3: Fermentation production focusing on flavonoid secretion from the supernatant 1. Experimental Materials and Instruments Same as Example 1.

[0095] The PDA solid medium and the modified PDB fermentation medium are the same as in Example 1.

[0096] Straw-free modified PDB seed culture medium: containing 6 g / L potato extract powder and 20 g / L glucose. Preparation method: Weigh 6 g of potato extract powder and 20 g of glucose, add distilled water to 1000 mL, autoclave at 121℃ for 15 minutes, and set aside.

[0097] 2. Experimental Methods (1) Activation and seed culture preparation: The strain was activated in the same way as in Example 1. For seed culture preparation, the strain was inoculated into modified PDB seed medium (0 g / L straw) without straw and cultured at 28°C and 120 r / min for 2 days.

[0098] (2) Fermentation culture: Wet mycelium was collected by filtration (inoculation amount 5.3 g / 100 mL) and transferred to modified PDB fermentation medium containing 1 g / L okra straw powder. It was cultured at 28℃ and 120 r / min for 2 days.

[0099] (3) Product detection: The processing method is the same as in Example 1.

[0100] 3. Experimental Results Experimental results are as follows Figure 6 As shown in Figure B, under these conditions, the total flavonoid content in the bacterial cells is 0.57 mg / g, the total flavonoid content in the supernatant is 0.42 mg / g, and the total flavonoid yield is 0.99 mg / g. These conditions are most favorable for flavonoid secretion into the supernatant, facilitating downstream extraction.

[0101] Example 4: Validation of the antibacterial activity of the fermentation product 1. Experimental Materials Indicator bacteria: Staphylococcus aureus ( Staphylococcus aureus (ATCC 25923), preserved by the laboratory.

[0102] Reagents: Resazurin, LB liquid medium, sterile 96-well plate.

[0103] 2. Experimental Methods (1) Sample preparation: Take the supernatant after fermentation in Example 1, centrifuge at 8000 r / min for 10 min to remove the cells, filter through a 0.22 μm filter membrane to remove bacteria, and use it as the sample to be tested.

[0104] (2) Preparation of bacterial culture: Staphylococcus aureus was inoculated into LB liquid medium and cultured at 37℃ and 180 r / min for 14 h to the logarithmic growth phase. The bacterial culture concentration was adjusted to 1×10^6 CFU / mL using LB medium.

[0105] (3) Antibacterial test: In a 96-well plate, 160 μL of the sample to be tested was added to column 1, and 80 μL of LB medium was added to columns 2-10. 80 μL of the sample from column 1 was serially diluted to column 10, and 80 μL from column 10 was discarded. 120 μL of Resveratrol-bacterial solution was added to each well, and the plate was incubated at 37°C in the dark for 8.5 h.

[0106] (4) Detection: Measure the absorbance at 570 nm and 600 nm and calculate the antibacterial rate.

[0107] 3. Experimental Results Experimental results are as follows Figure 7 As shown, the calculated minimum inhibitory concentration (MIC) of the optimized fermentation supernatant against Staphylococcus aureus is 0.062 μg / mL. The positive control group (vancomycin) showed a blue color in the wells, while the negative control group showed a pink color, confirming that the fermentation product prepared by the method of this invention has significant antibacterial activity.

[0108] The above are merely embodiments of the present invention and do not limit the scope of the patent. Any equivalent modifications made based on the content of this specification, or direct or indirect applications in other related technical fields, are similarly included within the scope of patent protection of the present invention.

Claims

1. An endophytic fungus of Okra, characterized in that, The endophytic fungal strain is a fungus belonging to the genus *Alternaria*. Alternaria sp. YZ43 was deposited at the China Center for Type Culture Collection on July 13, 2026, with accession number CCTCC NO: M20261631.

2. A fermentation optimization method for enhancing the flavonoid production capacity of endophytic fungi using okra straw, characterized in that, The steps of the method are as follows: (1) Activation and seed liquid preparation: The YZ43 strain as described in claim 1, which was preserved on PDA slant medium, was inoculated onto a fresh PDA plate and activated in a constant temperature incubator at 28℃ for 7 days; the mycelium was inoculated into a modified PDB seed medium containing 5 g / L okra straw powder and cultured at 28℃ and 120 r / min for 2 days to prepare the seed liquid; (2) Fermentation culture: The seed liquid was filtered with sterile gauze and the wet mycelium was collected; the inoculation amount was 5.3 g wet mycelium / 100 mL medium, and it was transferred to the modified PDB fermentation medium containing 1 g / L okra straw powder and cultured at 28℃ and 120 r / min for 2 days. (3) Product detection: The fermentation broth was centrifuged at 8000 r / min for 10 min to separate the cells and supernatant. The content was determined using a total plant flavonoid detection kit with rutin as the standard.

3. The method according to claim 2, characterized in that, The PDA slant culture medium and PDA plate culture medium both contain 4 g / L potato extract powder, 20 g / L glucose and 15 g / L agar, with a pH value of 5.6 ± 0.

2.

4. The method according to claim 2, characterized in that, The improved PDB seed culture medium contains 6 g / L potato extract powder, 20 g / L glucose and 5 g / L okra straw powder.

5. The method according to claim 2, characterized in that, The modified PDB fermentation medium contains 6 g / L potato extract powder, 20 g / L glucose and 1 g / L okra straw powder.

6. A fermentation optimization method for enhancing the flavonoid production capacity of endophytic fungi using okra straw, characterized in that, The steps of the method are as follows: (1) Activation and seed liquid preparation: The YZ43 strain as described in claim 1, which was preserved on PDA slant medium, was inoculated onto a fresh PDA plate and activated in a constant temperature incubator at 28℃ for 7 days; then the mycelium was inoculated into a modified PDB seed medium containing no okra straw powder and cultured at 28℃ and 120 r / min for 2 days to prepare the seed liquid; (2) Fermentation culture: The seed liquid was filtered with sterile gauze and the wet mycelium was collected; the inoculation amount was 5.3 g wet mycelium / 100 mL medium, and it was transferred to the modified PDB fermentation medium containing 1 g / L okra straw powder and cultured at 28℃ and 120 r / min for 2 days. (3) Product detection: The fermentation broth was centrifuged at 8000 r / min for 10 min to separate the cells and supernatant. The content was determined using a total plant flavonoid detection kit with rutin as the standard.

7. The method according to claim 6, characterized in that, The PDA slant culture medium and PDA plate culture medium contain 4 g / L potato extract powder, 20 g / L glucose and 15 g / L agar, with a pH of 5.6 ± 0.

2.

8. The method according to claim 6, characterized in that, The modified PDB seed culture medium, which does not contain okra straw powder, contains 6 g / L potato extract powder and 20 g / L glucose.

9. The method according to claim 6, characterized in that, The modified PDB fermentation medium contains 6 g / L potato extract powder, 20 g / L glucose and 1 g / L okra straw powder.

10. The use of the fermentation product obtained by the method of claim 2 or the method of claim 6 in the preparation of antibacterial products.

Images