A composite fermentation microbial agent, a preparation method, application in improving quality of steamed buns and prolonging shelf life of steamed buns and a fermentation method

Abstract

The application discloses a composite fermentation microbial agent, a preparation method, application in improving quality of steamed buns and prolonging shelf life of steamed buns and a fermentation method, and belongs to the technical field of microbial fermentation. 7 CFU / mL 8 CFU / mL, under the condition of not adding chemical preservatives, by using the synergistic metabolism of the three strains, the texture of the steamed buns is significantly improved, and the types of flavor substances in the steamed buns are enriched; the shelf life of the steamed buns prepared by the microbial agent at 4 DEG C is 15 days longer than that of the steamed buns fermented by single Saccharomyces cerevisiae W1, the microbial agent is suitable for industrialized green production of steamed buns, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation technology, and in particular to a compound fermentation agent, its preparation method, its application in improving the quality of steamed buns and extending their shelf life, and the fermentation method thereof. Background Technology

[0002] Steamed buns are a core staple food in my country, with pre-made vacuum-packed buns being the mainstream product in the market. Steamed buns are high in moisture, carbohydrates, and free amino acids, making them highly susceptible to oxidation. Fusarium oxysporum ( Fusarium oxysporum Monilinia fructicola (Peach brown rot fungus) Aspergillus flavus Infection by harmful molds such as Aspergillus flavus leads to quality deterioration, including mold growth, sourness, hardening during refrigeration, and rapid loss of fermentation aroma. Mycotoxins also pose food safety risks, severely restricting the large-scale distribution of Chinese staple foods.

[0003] Existing steamed bun preservation and fermentation technologies have four inherent flaws: 1. Single brewing yeast fermentation: Relying solely on yeast to produce gas results in a limited variety of flavor compounds and no endogenous antibacterial ability; it only lasts 6 days in a 4°C vacuum refrigeration shelf, requiring the addition of chemical preservatives such as sodium dehydroacetate and potassium sorbate, which does not align with the trend of clean label consumption.

[0004] 2. Physical preservation: High-temperature sterilization damages gluten, resulting in dry and hard steamed buns; the entire process of quick-freezing cold chain significantly increases the distribution costs for small and medium-sized enterprises, making it difficult to popularize.

[0005] 3. Chemical preservatives: Control over additives such as sodium dehydroacetate and potassium sorbate has been tightening year by year, leading to strong consumer resistance. At the same time, there are compliance barriers for additives in exported food.

[0006] 4. Single / Yeast Compound System A single strain of *Saccharomyces cerevisiae* has outstanding anti-mold ability, but its dough gas production is extremely weak, resulting in small-volume and hard-textured steamed buns. A single strain of *Cercospora lucida* has the best ester production and aroma enhancement effect, but its fermentation power is insufficient, resulting in low specific volume of steamed buns. Any combination of two strains can only achieve two types of functions: leavening / aroma enhancement, leavening / antibacterial, and aroma enhancement / antibacterial. It cannot simultaneously achieve the triple effects of leavening, rich fruity aroma, and long-lasting preservative-free antibacterial properties.

[0007] Existing literature and patents lack a complete set of processes for simultaneously addressing the taste, flavor, and storage period of steamed buns by combining high-fermentation-capacity Saccharomyces cerevisiae, high-chitinase-producing Saccharomyces guildrums, and high-ester-producing Corynebacterium tumefaciens in a specific live bacteria ratio. Therefore, developing this synergistic compound microbial agent of the three strains has significant industrial value. Summary of the Invention

[0008] The purpose of this invention is to address the shortcomings of existing single-yeast steamed buns, such as bland flavor, short shelf life under refrigeration, reliance on chemical preservatives, and the inability of dual-strain compounding to achieve multiple performance benefits. This invention provides a compound fermentation agent and its preparation method, and its application in improving steamed bun quality and extending shelf life. It relies on the unexpected synergistic effect of the metabolism of three strains to achieve a soft texture, multi-layered fermented fruity aroma, and long-lasting mold inhibition and preservation without adding exogenous chemical preservatives.

[0009] To solve the above-mentioned technical problems, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a compound fermentation agent, comprising brewing yeast ( Saccharomyces cerevisiae W1, Gynostemma pentaphyllum ( Meyerozyma guilliermondii MZ30 and Portuguese yeast ( Clavispora lusitaniae MZ29 was prepared by mixing live bacteria at a ratio of 5-7:1:1. The yeast mentioned (Jieye Mengmaieri) Meyerozyma guilliermondii MZ30 was deposited on November 20, 2025 at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, China General Microbiological Culture Collection Center, with accession number CGMCC NO.39059; The Portuguese yeast ( Clavispora lusitaniae MZ29 was deposited on November 20, 2025 at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, China General Microbiological Culture Collection Center, with accession number CGMCC NO.39058. The total viable bacteria concentration of the compound fermentation agent is 10. 7 CFU / mL-10 8 CFU / mL.

[0010] Furthermore, the brewing yeast ( Saccharomyces cerevisiae W1, Gynostemma pentaphyllum ( Meyerozyma guilliermondii MZ30 and Portuguese yeast ( Clavispora lusitaniae The live bacteria ratio of MZ29 is 7:1:1.

[0011] Furthermore, the total viable bacteria concentration of the compound fermentation agent is 10. 7 CFU / mL.

[0012] Secondly, the present invention provides a method for preparing the above-mentioned compound fermentation agent, comprising the following steps: brewing yeast ( Saccharomyces cerevisiae W1, Gynostemma pentaphyllum ( Meyerozyma guilliermondii MZ30 and Portuguese yeast ( Clavispora lusitaniaeMZ29 was inoculated into PDB liquid medium and cultured with shaking at 28℃ and 160r / min for 24h to obtain fresh bacterial solutions of each strain. The three bacterial solutions were mixed according to the live bacteria ratio to prepare a compound yeast starter.

[0013] Thirdly, the present invention provides the application of the above-mentioned compound fermentation agent in improving the quality of steamed buns and extending their shelf life.

[0014] Fourthly, the present invention provides a fermentation method for improving the quality of steamed buns and extending their shelf life using the above-mentioned compound fermentation agent, characterized by comprising the following steps: Step S1, Kneading the dough: Mix the compound fermentation agent, flour, and sterile water in a mass ratio of 1:100:40-50 and knead thoroughly to form a dough; Step S2, first proofing: Place the dough in a constant temperature of 20-30℃ for 1-3 hours to proof; Step S3, Shaping and Second Proofing: Divide and shape the proofed dough, and proof it again for 15-20 minutes. Step S4, Steaming: Steam the dough with atmospheric pressure steam for 18-20 minutes; Step S5, Storage: After steaming the buns, cool them to room temperature, vacuum seal them in PA / PE composite bags, and store them at 4℃ or 18-38℃.

[0015] Furthermore, the proofing temperature is 30°C.

[0016] Furthermore, the wake-up time is 1.8 hours.

[0017] The present invention adopts the above technical solution and has the following advantages compared with the prior art: 1. The three strains have a synergistic effect and are innovative: a single strain has only a single function, and a combination of two strains can only add up to two types of functions; after the three strains of this invention are combined, the gas production capacity of dough fermentation, the total ester production, and the anti-mold performance of steamed buns during long-term storage are all significantly better than the single strain and the simple combination system of any two yeast strains, producing an unexpected synergistic effect.

[0018] 2. Significantly optimizes the texture of steamed buns and alleviates hardening during refrigeration: Steamed buns prepared using the optimal live bacteria ratio of 7:1:1 have a TPA hardness of only 121.76 gf; steamed buns fermented with only Guillain-Marie-Maylor yeast MZ30 have a hardness of 545.08 gf, and steamed buns fermented with only Corynebacterium tumefaciens MZ29 have a hardness of 689.44 gf; the finished steamed buns have an intact surface without collapse, uniform and delicate internal pores, and a soft texture with good resilience.

[0019] 3. Significantly enriched volatile flavor compounds: A total of 45 volatile flavor components were detected in the entire fermentation system, of which 32 were detected in the three-strain compound fermentation group of this invention; relying on the amino acid degradation and complementary sugar metabolism pathways of the three strains, the complete flavor precursor synthesis pathway is opened up, significantly increasing the accumulation of various flavor products. The content of floral and fruity characteristic substances such as phenylethanol and 3-methyl-1-butanol is significantly increased, and the finished steamed buns have the aroma of grains, fermentation alcohol and multi-layered fruit aroma.

[0020] 4. No need to add exogenous chemical preservatives, significantly extending shelf life: (1) 4℃ vacuum refrigeration environment: Commercially fermented steamed buns with single yeast reach the end of spoilage on the 6th day. The steamed buns made with the compound microbial agent of this invention can have a shelf life of up to 21 days, and the shelf life is extended by at least 15 days. (2) 18–38℃ ambient temperature circulation environment: Commercial single yeast steamed buns will develop mold spots and spoilage after 3 days of storage. The product of this invention can be stably stored for 18 days; it can significantly reduce the cost of purchasing chemical preservatives and low-temperature cold chain transportation for enterprises.

[0021] 5. All safety indicators of the finished product meet the standards: No pathogenic bacteria were detected in the finished steamed buns, and the total organic acid and biogenic amine content was far below the national food safety limit standards. There were no exogenous chemical preservative residues, which meet the requirements of green staple food and clean label products, and also meet the compliance standards for exported food. Attached Figure Description

[0022] Figure 1 This is a bar chart showing the activity of chitinase-producing enzymes in yeast screened in this invention. Figure 2 This is a diagram showing the characteristics of yeast culture in WL medium used in this invention. Figure 3 The yeast of this invention is *Saccharomyces cerevisiae* (Jieyemene). Meyerozyma guilliermondii A phylogenetic tree of MZ30 constructed based on the ITS gene sequence; Figure 4 The Portuguese yeast ( ) in this invention Clavispora lusitaniae A phylogenetic tree of MZ29 constructed based on the ITS gene sequence; Figure 5 The yeast of this invention is *Saccharomyces cerevisiae* (Jieyemene). Meyerozyma guilliermondii (A) Bar chart showing the inhibitory effect of MZ30 on the growth of different mold colonies and the inhibition rate; (B) Bar chart showing the relationship between colony diameter and inhibition rate. Figure 6 The curves showing the changes in dough fermentation power of different yeast strains in this invention are shown. Figure 7 This is a bar chart showing the total ester content of different yeast strains in this invention; Figure 8The following is a diagram showing the results of single-factor experiments in this invention: (A) Effect of inoculum size on sensory properties and ester production; (B) Effect of strain ratio on sensory properties and ester production; (C) Effect of fermentation time; (D) Effect of fermentation temperature on steamed bun quality; black dots represent sensory scores, and triangles represent total ester production capacity. Figure 9 The response surface, contour lines, and three-dimensional surface represent the influence of various factors on sensory scores in this invention. Figure 10 The images show the appearance and cross-sectional view of steamed buns prepared using different yeasts in this invention. Detailed Implementation

[0023] The embodiments of the present invention are described in detail below. These embodiments are intended to explain the present invention and should not be construed as limiting the present invention. Specific techniques or conditions not specified in the embodiments are performed according to techniques or conditions described in the literature in the art or according to product instructions. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0024] The strains were cultured using chitin medium, PDA medium, and WL medium. Chitin solid medium was used for strain screening, PDA medium was used for colony morphology observation, and WL medium was used to assist in strain phenotypic identification.

[0025] The components of each culture medium are as follows: 1. Chitin Solid Culture Medium (Initial Screening of Strains): 20 mL colloidal chitin, 0.5 g magnesium sulfate, 0.1 g sodium chloride, 0.1 g ammonium chloride, 0.3 g potassium dihydrogen phosphate, 0.7 g dipotassium hydrogen phosphate, 0.01 g ferrous sulfate, 3 mL 1% streptomycin, 2.5% agar, bring the volume to 1000 mL with deionized water, adjust the pH to 7 with 1 mol / L sodium hydroxide, and autoclave at 121℃ for 15 min. Purpose: To screen yeast strains that secrete chitinase, based on the D / d ratio of the clear zone.

[0026] 2. PDB liquid culture medium (for strain expansion culture) Ingredients: 200g potatoes, peeled and boiled for 30 minutes, filtered to obtain juice, 20g glucose; deionized water to a final volume of 1000mL; sterilized at 115℃ for 20 minutes.

[0027] Application: To prepare single-strain cultures from three yeast strains using independent shake flask culture.

[0028] 3. PDA solid culture medium (colony morphology observation): 200g potato, 20g glucose, 25g agar, diluted to 1000mL with deionized water, sterilized at 115℃ for 20min.

[0029] 4. WL medium (for differentiating yeast strain phenotypes): Solution A: 5.5g dipotassium hydrogen phosphate, 4.25g potassium chloride, 1.25g calcium chloride, 1.25g magnesium sulfate, diluted to 400mL with deionized water; Solution B: 0.25g ferric chloride, 0.25g manganese sulfate, diluted to 100mL with deionized water; Solution C: 0.44g bromocresol green, 10mL water, 10mL alcohol.

[0030] Take 4g yeast extract, 5g peptone, 50g glucose, 40mL of A solution, and 1mL of B solution, adjust the pH to 6.5, bring the volume to 1000mL with deionized water, sterilize at 121℃ for 15min, add 1mL of C solution after sterilization, mix well and set aside.

[0031] Example 1: Screening, identification, preservation, and antibacterial verification of functional yeast strains 1.1 Strain source and initial screening: Soil samples were collected in Qingdao, China on March 25, 2024, for microbial enrichment culture.

[0032] Screening method: The enriched bacterial solution was spread on a chitin solid medium screening plate with colloidal chitin as the sole carbon source and incubated at a constant temperature of 28°C. Yeast strains with chitinase secretion ability were initially screened based on colony growth status and the ratio of clear zone diameter to colony diameter (D / d). A total of 40 yeast strains were able to grow on the colloidal chitin plate, and 16 yeast strains that could produce clear zones were obtained. The D / d ratio is shown in Table 1.

[0033] Table 1

[0034] As shown in Table 1, strain MZ30 has the highest D / d value, which is 18.12±1.22; strain MZ29 has the second highest D / d value, which is 17.21±2.18. Both strains have the best potential for producing chitinase.

[0035] 1.2 Chitinase Activity Rescreening The chitinase activity of the strains was determined by the DNS method for secondary screening, and several high-chitinase-producing yeast strains were obtained, such as... Figure 1 As shown, the vertical axis represents enzyme activity in U / mL, and the horizontal axis represents the strain number. Strain MZ30 exhibited the best enzyme activity at 2.686 U / mL. W2-2, MZ29, W4-4, and P8-6 also showed relatively good chitinase activity, with enzyme activities of 1.354 U / mL, 2.408 U / mL, 1.352 U / mL, and 1.353 U / mL, respectively. Based on the data of the clear zone and enzyme activity, strains with weak enzyme production and antibacterial ability were eliminated, and five strains—W2-2, MZ30, MZ29, W4-4, and P8-6—were retained for further identification.

[0036] 1.3 Identification of colony and liquid culture morphology Colony morphology, liquid culture characteristics, and cell micromorphology were observed for the five strains. All strains exhibited typical yeast colony characteristics on PDA medium, but there were some differences in their specific morphology. See Table 2.

[0037] Table 2

[0038] 1.4 Phenotypic determination after 7 days of culture in WL medium The colony characteristics of each strain after culturing in WL medium at 28°C for 7 days are shown in Table 3. Figure 2 As shown.

[0039] Table 3

[0040] According to Table 3, strain W2-2 was preliminarily identified as *Cytomyces delavayi*; strain MZ30 as *Saccharomyces giardi*; strain MZ29 as *C. lucida*; strain W4-4 as *Candida*; and strain P8-6 as *Rhodotorula*.

[0041] 1.5 Carbon and nitrogen source assimilation test The results of physiological and biochemical carbon and nitrogen source assimilation detection are shown in Table 4. Assimilation judgment criteria: ++ strong assimilation; + relatively strong assimilation; w weak assimilation; - unusable.

[0042] Table 4

[0043] Of the six carbon sources selected for carbon source assimilation, five yeast strains showed strong assimilation of glucose. However, the utilization of galactose, lactose, raffinose, maltose, and sucrose by the strains exhibited specificity: W2-2 showed only weak assimilation of lactose and galactose, W4-4 showed strong assimilation of lactose, and MZ29 could not utilize lactose and only showed weak assimilation of raffinose. Using nitrate as a nitrogen source, W2-2, MZ30, and P8-6 showed strong assimilation, while MZ29 and W4-4 showed relatively strong assimilation.

[0044] 1.6 ITS Molecular Identification and Strain Preservation ITS molecular biological identification showed that the ITS gene sequence length of MZ30 was 579 bp, while that of MZ29 was 378 bp. Comparison using the NCBI BLASTN program revealed that the ITS gene sequence of strain MZ30 showed the highest homology to the gene sequence of the standard strain of *Saccharomyces cerevisiae*. Combined with physiological and biochemical carbon and nitrogen source assimilation characteristics and phylogenetic tree analysis (…),… Figure 3 The strain was identified as *Saccharomyces gijmonmeier* and named *Saccharomyces gijmonmeier*. Meyerozyma guilliermondii MZ30.

[0045] The ITS gene sequence of strain MZ29 showed the highest homology with the gene sequence of the standard strain of *Corynebacterium tumefaciens*. Combined with physiological and biochemical carbon and nitrogen source assimilation characteristics and phylogenetic tree analysis (…),… Figure 4 The strain was identified as *Corydalis lucida* and named *Corydalis lucida*. Clavispora lusitaniae MZ29.

[0046] On November 20, 2025, this strain was deposited at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, at the China General Microbiological Culture Collection Center, *Saccharomyces cerevisiae*. Meyerozyma guilliermondii The preservation number of MZ30 is: CGMCC NO.39059, *Cercospora lucida* (Portunus lucida). Clavispora lusitaniae The accession number of MZ29 is: CGMCC NO.39058.

[0047] Giemensmayer's yeast ( Meyerozyma guilliermondii The DNA sequence of MZ30 is:

[0048] Portuguese yeast ( Clavispora lusitaniae ) The DNA sequence of MZ29 is: TTCGGTAGGTGACTGCGGAGGTCATTAAAATAATACTTACACACTGTTTTTGCGAACAAAAAAATAAATTTTTTTATTCGAATTTCTTAATATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAGTATGACTTGCAGACGTGAATCA TCGAATCTTTGAACGCACATTGCGCCTCGAGGCATTCCTCGAGGCATGCCTGTTTGAGCGTCGCATCCCCTTCTAACCCCCGGTTAGGCGTTGCTCCGAAATATCAACCGCGCTGTCAAACACGTTTACAGCACGACATTTCGCCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAG.

[0049] 1.7 Antimicrobial activity test of *Saccharomyces cerevisiae* MZ30 on mold plates. Test molds: F.oxy Fusarium oxysporum, M. fructicola Peach brown rot fungus, A.flavus Aspergillus flavus; the inhibitory effect of MZ30 on three molds was tested, and the results are shown in […]. Figure 5 .

[0050] Figure 5 In A, odd-numbered rows: blank control group ( F.oxy / M.Fructicola / A.flavus Without antibacterial treatment, fungi grow freely; even-numbered rows: antibacterial treatment group (MZ30+ corresponding bacteria).

[0051] The antibacterial effect changes over time as follows: F.oxy Treatment group: The inhibitory effect remained stable, and the colonies hardly expanded anymore; M. fructicola Treatment group: Slow recovery of growth, but consistently weaker than the control group; A.flavus Treatment group: The antibacterial effect continued to decline, and the fungi gradually resumed normal growth.

[0052] Figure 5 In section B, the left Y-axis (blue column) represents colony diameter (mm); the right Y-axis (pink triangular line) represents inhibition rate (%); the tall left column in each group represents the blank control group; the short right column in each group represents the antibacterial treatment group. The diameters of the blank control group were 85 mm, 75 mm, and 46 mm, respectively, while the diameters of the antibacterial treatment group were 29 mm, 33 mm, and 38 mm, respectively. The inhibition rates of the antibacterial treatment group against the three molds were 66.1%, 56.6%, and 17.4%, respectively. The results show that MZ30 has an inhibitory effect on the growth of all three tested molds, and the antibacterial activity is selective for fungal species, with outstanding inhibitory effects against Fusarium oxysporum and Prunus cerevisiae.

[0053] Example 2: Comparative Experiment on the Fermentation Performance of Steamed Buns Using a Single Strain Strain 2.1 Test strains This embodiment evaluates the single fermentation performance of each strain individually and verifies the quality effect of each strain when applied alone to steamed bun fermentation. Red yeast P8-6 does not have aroma-producing ability and has pigments, so it was not selected.

[0054] Three strains were selected: Saccharomyces cerevisiae W1 (commercially available Saccharomyces cerevisiae W1 (Shandong Pingao Pharmaceutical Co., Ltd.), or commercial strains such as Angel low-sugar high-activity dry yeast, which meet the requirement of ≥2.1 fermentation power of dough in 3 hours and have efficient gas production and leavening ability), Saccharomyces cerevisiae MZ30, and Saccharomyces cerevisiae MZ29.

[0055] 2.2 Standardized preparation of single-strain culture A bacterial suspension was prepared by shaking culture at 28℃ and 160 r / min for 24 h. With uniform inoculum size, fermentation temperature, and fermentation time, each group was fermented separately to make steamed buns. The fermentation power of the dough, the total ester content of the fermentation broth, and the sensory quality and textural properties of the finished steamed buns were measured for each group.

[0056] 2.3 Fermentation power results Depend on Figure 6 As shown, the fermentation power of the Saccharomyces cerevisiae W1 strain is superior to that of other yeast strains. Its fermentation power is 0.37 at 0.5h, and then shows a rapid upward trend, reaching a peak of 2.16 at 3.0h. 2.4 Total ester content of fermentation broth Figure 7 As shown, the ester production capacity of different yeast strains varies. The MZ29 strain has the best ester production capacity at 0.67 g / L. The total ester contents of W2-2 and MZ30 are similar, at 0.41 g / L and 0.42 g / L, respectively. The total ester content of W4-4 is the lowest, at only 0.29 g / L.

[0057] The experimental results showed that: Brewer's yeast W1, when fermented alone, had a strong gas-producing ability and good leavening effect in dough, resulting in soft steamed buns, but with a single flavor and no antibacterial and preservative effect; Corydalis zeolite MZ29, when fermented alone, produced a high ester content and a rich aroma in steamed buns, but had a weak fermentation ability, resulting in smaller steamed buns with a harder texture; and Gynostemma pentaphyllum MZ30, when fermented alone, had almost no leavening ability and weak aroma-producing ability, but could significantly inhibit the growth of mold during the storage of steamed buns.

[0058] Example 3: Optimization of Inoculum Amount Process for Compound Fermentation Agent This embodiment investigates the effect of the inoculum amount of the compound leavening agent on the quality of steamed buns. The bacterial strain ratio was fixed at 1:1:1, the fermentation time at 2 hours, and the fermentation temperature at 30°C. The live bacteria concentration in the dough, i.e., the inoculum amount, was 10. 5 CFU / mL, 10 6 CFU / mL, 10 7 CFU / mL, 10 8 CFU / mL. Three yeast strains were mixed in proportion and added to flour and sterile water at different inoculation amounts. The dough was then kneaded, proofed, shaped, and steamed to obtain finished steamed buns. The sensory scores of the steamed buns and the total ester content of the fermentation liquid were used as evaluation indicators.

[0059] The experimental results showed that as the inoculum size increased, the sensory quality and ester production capacity of the steamed buns first increased and then decreased. When the inoculum size was too low, the number of microorganisms was insufficient, fermentation was incomplete, and the steamed buns had poor fluffiness and a bland flavor. When the inoculum size was too high, the cell density was too large, competition for nutrients among the microorganisms intensified, and the accumulation of metabolic products became unbalanced, resulting in a slightly sour taste and a coarse texture. Figure 8 As shown in (A), when the inoculation amount is 10 7 At a concentration of CFU / mL, the steamed buns achieved the highest sensory score and the best ester production capacity, representing the optimal inoculum amount for the compound fermentation agent of this invention.

[0060] Example 4: Optimization of the compound fermentation agent strain ratio process This example investigates the effects of the ratio of *Saccharomyces cerevisiae* W1, *Saccharomyces gimmickii* MZ30, and *Corynebacterium tumefaciens* MZ29 on the quality and flavor of steamed buns. The optimal inoculum size was fixed at 10. 7 The experiment was conducted with CFU / mL, fermentation temperature of 30℃, and fermentation time of 2h, and three gradients of strain ratios of 1:1:1, 5.5:1:1, and 10:1:1 were set up.

[0061] The experimental results showed that when the ratio of the microbial strains was 1:1:1, the proportion of brewing yeast was too low, resulting in insufficient gas production during dough fermentation and a large hardness and small specific volume in the steamed buns. When the ratio of the microbial strains was 10:1:1, the proportion of brewing yeast was too high, while the proportions of antibacterial yeast and aroma-producing yeast were too low, resulting in a decrease in the preservative ability of the steamed buns and a single flavor profile. Figure 8As shown in (B), the steamed buns have good overall quality when the ratio is 5.5:1:1. After response surface optimization, the ratio was adjusted to 7:1:1. Combined with the stability of industrial production, the steamed buns achieved the best balance in sensory score, texture characteristics, antibacterial and freshness preservation effect. They have no sour taste, pure aroma, and excellent softness, which is the optimal strain ratio of this invention.

[0062] Example 5: Optimization of Fermentation Time and Process This embodiment investigates the effect of dough fermentation time on the quality of steamed buns. Figure 8 (C) shows a fixed optimal inoculum size, optimal strain ratio, and fermentation temperature of 30℃. Fermentation times for the dough were set to 1 h, 2 h, 3 h, and 4 h. The kneading, proofing, and steaming processes were standardized to produce the finished steamed buns.

[0063] The results showed that if the fermentation time was too short, the dough would not ferment sufficiently, the gluten network would not fully develop, and the synthesis of flavor precursors would be insufficient, resulting in a dense texture and weak aroma in the steamed buns. If the fermentation time was too long, excessive microbial metabolism in the dough would lead to a large accumulation of organic acids, resulting in a sour taste and collapsed texture in the steamed buns. Figure 8 As shown in (C), when the fermentation time is 2 hours, the steamed buns have the highest sensory score, soft and uniform texture, sufficient accumulation of ester flavor substances, and the best overall quality, which is suitable for the needs of rapid industrial production.

[0064] Example 6: Fermentation Temperature Process Optimization This embodiment investigates the effect of fermentation temperature on the metabolism of a compound microbial strain and the quality of steamed buns. Figure 8 (D) shows the above-mentioned optimal inoculum amount, strain ratio, and fermentation time, and steamed bun samples were prepared by setting fermentation temperatures of 20℃, 25℃, 30℃, and 35℃ respectively.

[0065] The experimental results showed that at low temperatures of 20℃ and 25℃, yeast proliferation was slow and metabolic activity was weak, resulting in delayed dough fermentation, small steamed buns, and poor flavor. At 35℃, the yeast strains experienced metabolic disorders, making them prone to bacterial growth, causing the steamed buns to become sour and develop a rough surface. At a fermentation temperature of 30℃, the three functional yeast strains exhibited the best metabolic synergy, stable gas production, sufficient aroma, and good antibacterial properties, resulting in the best sensory quality of the steamed buns; this was considered the optimal fermentation temperature.

[0066] Example 7: Overall process verification and optimization using response surface methodology 7.1 Box-Behnken test matrix and sensory test results of steamed buns Three core process parameters affecting the overall quality of steamed buns were used as independent variables: A was the ratio of live bacteria of Saccharomyces cerevisiae W1, Saccharomyces gimmicks MZ30, and Saccharomyces cerevisiae MZ29 (range 1-10), B was the initial fermentation time of the dough (range 1-3h), and C was the initial fermentation temperature of the dough (range 25-35℃); the overall sensory score of the steamed buns was used as the response value.

[0067] By combining single-factor experiments to determine the factor intervals, 17 groups of experiments were conducted using the Box-Behnken three-factor, three-level method. The process parameters and measured sensory scores of steamed buns for each group are recorded in Table 5. Based on the data in Table 5, a regression model was fitted, and the theoretically optimal fermentation process was obtained through software numerical optimization.

[0068] Table 5

[0069] 7.2 Regression Equation and Analysis of Variance All experimental data from Table 5 were imported into Design Expert 13.0 software for multiple regression fitting, yielding a quadratic polynomial regression equation with sensory scores of steamed buns as the response values: Y = 89.91 + 1.37A - 0.3475B + 0.1937C - 1.31AB - 0.5000AC - 0.1125BC - 2.94A 2 -1.33B 2 -1.86C 2 In the formula, Y represents the sensory score of the steamed bun, A is the strain ratio, B is the fermentation time (h), and C is the fermentation temperature (°C).

[0070] The analysis of variance results of the regression model are shown in Table 6. The constructed model is highly significant (P < 0.01), and the lack-of-fit term is not significant (P > 0.05), indicating that the model has high reliability and there are no factors affecting the model fit. Meanwhile, the R-squared value of the model is... 2 =0.9822、RAdj 2 =0.9593, both values ​​are close to 1, which also confirms that the regression equation has a good fitting effect and can accurately characterize the change pattern between the strain ratio, fermentation time, fermentation temperature and the sensory score of steamed buns.

[0071] The significance analysis results showed that: in the linear term, the ratio of microbial strains (A) had a highly significant effect on the sensory score of the steamed buns (P < 0.01); in the quadratic term A... 2 B 2 C 2 All factors had highly significant effects on the sensory scores of steamed buns (P < 0.01); the P value of the interaction term AB < 0.01, indicating that the interaction between the strain ratio (A) and fermentation time (B) had a highly significant impact on the sensory scores of steamed buns. Based on the F values ​​of each factor, the order of influence of each factor on the sensory scores of steamed buns can be determined as follows: strain ratio > fermentation time > fermentation temperature.

[0072] The conclusions of the analysis of variance are further verified by combining the response surface and contour plot in Figure 9: like Figure 9As shown in (A), at a fixed fermentation temperature, with the gradual increase of the strain ratio and fermentation time, the sensory score of the steamed buns showed a trend of first increasing and then decreasing, and the corresponding contour lines were elliptical. This indicates that the interaction between the strain ratio and fermentation time is significant; Figure 9 (B) It can be seen that when the fermentation time is fixed, the contour lines in the influence of the strain ratio and fermentation temperature on the sensory score of steamed buns are approximately circular, indicating that the interaction effect between the two is not significant. Furthermore, the slope of the sensory score change shows that the strain ratio has a greater impact on the sensory score than the fermentation temperature. Figure 9 As shown in (C), when the strain ratio is fixed, the sensory score of the steamed bun first increases and then decreases with the increase of fermentation time and fermentation temperature, and its contour lines are circular, indicating that the interaction between fermentation time and fermentation temperature is not significant. The above conclusions are consistent with the results of the analysis of variance in Table 6.

[0073] Table 6

[0074] Analysis of variance showed that the regression model was highly significant, with no significant lack-of-fit term, indicating a high model fit. A significant interaction existed between the strain ratio and fermentation time, having the greatest impact on the quality of the steamed buns.

[0075] 7.3 Optimal Process Solution Data analysis of the regression model was performed using Design Expert 13.0 software. The optimal fermentation conditions for the compound starter culture were determined to be: a microbial ratio of 6.818:1:1, a fermentation time of 1.725 h, and a fermentation temperature of 30.104℃. Under these conditions, the predicted sensory score for steamed buns reached 90.16. Considering the convenience of practical production applications, the optimal fermentation conditions were adjusted to: a microbial ratio of 7:1:1, a fermentation time of 1.8 h, and a fermentation temperature of 30℃. Three parallel validation experiments were conducted, and the average sensory score obtained was 90.33, with an error of 0.18% compared to the model's predicted value. This result fully confirms the effectiveness of the constructed regression model.

[0076] Example 8: Effects of compound leavening agents on the texture and sensory quality of steamed buns This embodiment compares the differences in texture, appearance, and taste of steamed buns prepared with commercial single yeast and the compound leavening agent of this invention. Steamed buns were prepared under optimal process conditions, cooled, and then uniformly sampled. Key indicators such as hardness, elasticity, chewiness, cohesion, and resilience of the steamed buns were measured using a texture analyzer in TPA mode. Simultaneously, a comprehensive sensory evaluation was conducted according to national standard scoring criteria. The effects of different yeast strains on the textural properties of the steamed buns are shown in Table 7, and the appearance cross-section is shown in Figure 10.

[0077] Table 7

[0078] Note: SA is for fermented steamed buns with brewer's yeast W1, CA is for fermented steamed buns with yeast of the same name MZ30, LA is for fermented steamed buns with yeast of the same name MZ29, and FA is for fermented steamed buns with the compound leavening agent of this invention.

[0079] Depend on Figure 10 As shown in Table 7, compared with groups CA and LA, the steamed buns prepared by the 7:1:1 three-strain compound fermentation agent of this invention have significantly reduced hardness, chewiness, and adhesiveness, and significantly improved elasticity and internal structure uniformity. The steamed buns have a smooth surface, uniform color, no collapse or wrinkling, fine and dense internal pores, soft and bouncy texture, are not sticky, have a rich wheat aroma and rich fermentation aroma. The overall sensory and textural quality is significantly better than that of groups CA and LA.

[0080] Example 9: Effects of compound leavening agents on the flavor and storage preservation properties of steamed buns All shelf-life comparison tests used the same batch of medium-gluten wheat flour (protein content 10.5%-11.5%), the same amount of water, and the same proofing and steaming process. The only difference was the type of leavening agent used. No chemical preservatives were added to the flour and auxiliary materials used. The extended shelf life was achieved entirely by the fermentation of the compound fermentation agent and its antibacterial metabolites.

[0081] 9.1 Detection of volatile flavor components The volatile flavor components of steamed buns from different fermentation groups were detected using GC-MS technology, and the types and relative contents of flavor substances were statistically analyzed, as shown in Table 8.

[0082] Table 8 Note: SA is for steamed buns fermented with Saccharomyces cerevisiae W1, CA is for steamed buns fermented with Saccharomyces cerevisiae MZ30, LA is for steamed buns fermented with Saccharomyces cerevisiae MZ29, FA is for steamed buns fermented with the compound leavening agent of this invention, SCA is for steamed buns fermented with W1+MZ30, SLA is for steamed buns fermented with W1+MZ29, CLA is for steamed buns fermented with MZ30+MZ29, and no negative results were detected (-).

[0083] As shown in Table 8, a total of 45 volatile flavor compounds were detected in the steamed bun samples from each treatment group, while 32 volatile flavor compounds were detected in the steamed buns from the compound leavening agent (FA) group of this invention. Each of the SA, LA, and FA groups detected more than 30 flavor compounds. From the data on volatile flavor components, the relative content of most characteristic flavor compounds in the FA three-strain compound group was significantly higher than the sum of the contents of single strains and the levels of two-strain compound groups; some substances were only efficiently enriched under the synergistic conditions of the three strains.

[0084] Among alcohols, fruit and wine aroma substances such as 3-methyl-1-butanol, phenylethanol, and 1-octen-3-ol are either detected in low amounts or cannot be synthesized by some strains during single-strain fermentation, and the improvement by dual-strain combination is limited. The three-strain FA group relies on the complementary amino acid degradation and sugar metabolism pathways between strains to open up the complete synthesis pathway, greatly improve the accumulation of products, and endow the steamed buns with banana aroma, rose aroma and mushroom aroma.

[0085] Esters are the core source of fruity aroma in steamed buns. Fruity esters such as ethyl acetate, ethyl hexanoate, and ethyl isobutyrate have weak synthesis capabilities by single bacteria, and the increase in synthesis by two bacteria is insufficient. The FA group, by leveraging the complementary esterification enzyme systems of different bacterial species, promotes alcohol-esterification reactions, thereby adding and enriching a large number of fruity aroma esters.

[0086] Similarly, the content of aldehydes, such as hexanal, heptanal, and (E)-2-octenal, which have grassy and nutty aromas, increases significantly after being metabolized by the three bacteria in a synergistic process.

[0087] In summary, the combination of three yeast strains produces novel flavor components that cannot be adequately generated by single or dual yeast strains through metabolic complementarity, enriching the aroma layers of steamed buns and improving the thin flavor of steamed buns. This is the core technological advantage of this compound leavening agent compared to single / dual yeast fermentation.

[0088] 9.2 Constant Temperature Storage Test After the steamed buns are steamed, they are allowed to cool naturally to room temperature and then vacuum-sealed in PA / PE composite vacuum packaging bags (oxygen permeability ≤50cm³ / m²·24h·atm).

[0089] Experimental conditions: Stored at a constant temperature of 4℃ Experimental groups: Steamed buns fermented with commercial yeast (Angel low-sugar high-activity dry yeast: white packaging, commercial 500g industrial pack); Steamed buns fermented with the compound leavening agent of this invention.

[0090] Regularly test total bacterial count, mold count, and pathogenic bacteria indicators. Indicator 0e: not detected. Compare shelf life differences and judgment criteria (refer to GB / T 35991-2018): the shelf life end is determined when any of the following conditions are met: (1) sensory score is less than 60 points (refer to GB / T 35991-2018 "Sensory Evaluation Method for Steamed Buns in Grain and Oil Inspection"); (2) total bacterial count > 6 lg (CFU / g); (3) mold count > 200 CFU / g.

[0091] Table 9 shows the changes in microorganisms during commercial yeast fermentation of steamed buns. Table 9

[0092] Table 9 shows that the total bacterial count of the steamed buns produced by the commercial yeast group at 8 days was 6.671g (CFU / g), which exceeded 61g (CFU / g). The mold count was within the normal range, and the storage period was 6 days.

[0093] Table 10 shows the changes in microorganisms during the fermentation of steamed buns using the compound fermenting agent of this invention. Table 10

[0094] As shown in Table 10, under a storage environment of 4℃, the total bacterial count of steamed buns prepared with the compound starter culture of this invention exceeded 61g (CFU / g) and the mold count was 228 CFU / g, exceeding 200 CFU / g, with a storage period of 21 days. Compared with the 6-day storage period of the commercial yeast group in Table 9, the compound starter culture of this invention can extend the shelf life of steamed buns by 15 days.

[0095] 9.3 Room temperature storage test Experimental conditions: August 15 - September 15, 2025, Weifang, Shandong, 18-38 degrees Celsius, ambient temperature throughout the day.

[0096] Experimental group: Same as constant temperature storage test.

[0097] The two samples were compared, and the results are as follows: The commercial yeast group showed excessive mold on day 3, with rancidity and mold spots; the compound microbial agent group of this invention reached the shelf life on day 18, with a shelf life extended by 15 days at room temperature, and the total number of colonies and the rate of mold growth were significantly slowed down.

[0098] In summary, compound yeast can effectively slow down the proliferation of microorganisms during the storage of steamed buns, extend the safe shelf life of the product, and help maintain the food safety and sensory quality of the steamed buns. The technical solution of this application uses a compound fermentation system constructed with Saccharomyces cerevisiae, Saccharomyces gimmickensis, and Corynebacterium tumefaciens. The synergistic fermentation of multiple strains continuously generates a large amount of volatile flavor compounds such as alcohols, esters, and aldehydes during the combined action of the microbial complex enzyme system and the dough proofing and high-temperature steaming processes, effectively improving the shortcomings of steamed buns having a single flavor and bland taste. The compound yeast system can fully stimulate the inherent grain aroma of wheat flour, enrich the fermented aroma layers, and give the steamed buns a unique fermented flavor.

[0099] The principle is as follows: During fermentation, brewer's yeast breaks down sugars in the dough, producing carbon dioxide to achieve leavening and improve the texture of the steamed buns; *Corydalis lucida* efficiently synthesizes aromatic esters, enhancing the overall aroma of the steamed buns; and *Saccharomyces cerevisiae* secretes chitinase, which disrupts the cell walls and membranes of molds, inhibiting the proliferation of miscellaneous bacteria and molds during storage and reducing the rancid odor caused by microbial contamination of the dough. These three yeast strains complement and synergistically stabilize the microenvironment of the fermentation system, reduce the loss of flavor compounds through volatilization, and significantly preserve the fermented aroma and original grain flavor of the steamed buns.

[0100] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A compound fermentation agent, characterized in that, From brewing yeast ( Saccharomyces cerevisiae W1, Gynostemma pentaphyllum ( Meyerozyma guilliermondii MZ30 and Portuguese yeast ( Clavispora lusitaniae MZ29 was prepared by mixing live bacteria at a ratio of 5-7:1:

1. The yeast mentioned (Jieye Mengmaieri) Meyerozyma guilliermondii MZ30 was deposited on November 20, 2025 at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, China General Microbiological Culture Collection Center, with accession number CGMCC NO.39059; The Portuguese yeast ( Clavispora lusitaniae MZ29 was deposited on November 20, 2025 at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, China General Microbiological Culture Collection Center, with accession number CGMCC NO.39058. The total viable bacteria concentration of the compound fermentation agent is 10. 7 CFU / mL-10 8 CFU / mL.

2. The compound fermentation agent as described in claim 1, characterized in that, The brewing yeast ( Saccharomyces cerevisiae W1, Gynostemma pentaphyllum ( Meyerozyma guilliermondii MZ30 and Portuguese yeast ( Clavispora lusitaniae The live bacteria ratio of MZ29 is 7:1:

1.

3. The compound fermentation agent as described in claim 1, characterized in that, The total viable bacteria concentration of the compound fermentation agent is 10. 7 CFU / mL.

4. The method for preparing the compound fermentation agent as described in claim 1, 2, or 3, characterized in that, Includes the following steps: brewing yeast ( Saccharomyces cerevisiae W1, Gynostemma pentaphyllum ( Meyerozyma guilliermondii MZ30 and Portuguese yeast ( Clavispora lusitaniae MZ29 was inoculated into PDB liquid medium and cultured with shaking at 28℃ and 160r / min for 24h to obtain fresh single bacterial cultures of three strains. The three single bacterial cultures were mixed according to the live bacteria ratio to prepare a compound yeast starter.

5. The application of the compound fermentation agent as described in any one of claims 1-3 in the fermentation preparation of steamed buns, extending the shelf life of steamed buns, and improving the texture and flavor of steamed buns.

6. A fermentation method for improving the quality and extending the shelf life of steamed buns using the compound fermentation agent according to any one of claims 1-3, characterized in that, Includes the following steps: Step S1, Kneading the dough: Mix the compound fermentation agent, flour, and sterile water in a mass ratio of 1:100:40-50 and knead thoroughly to form a dough; Step S2, first proofing: Place the dough in a constant temperature of 20-30℃ for 1-3 hours to proof; Step S3, Shaping and Second Proofing: Divide and shape the proofed dough, and proof it again for 15-20 minutes. Step S4, Steaming: Steam the dough with atmospheric pressure steam for 18-20 minutes; Step S5, Storage: Cool the steamed buns to room temperature and vacuum seal them in PA / PE composite bags.

7. The fermentation method according to claim 6, characterized in that, Step S2, the proofing temperature is 30℃.

8. The fermentation method according to claim 6, characterized in that, Step S2, the proofing time is 1.8 hours.

Images