Clostridium tyrobutyricum with enhanced nitrogen fixation ability under low nitrogen condition, construction method and application thereof

Abstract

The application discloses Clostridium tyrobutyricum with enhanced nitrogen fixation capacity under low-nitrogen conditions and a construction method and application thereof. The Clostridium tyrobutyricum comprises at least one genetic modification as follows: (1) the genetic modification comprises down-regulating or knocking out an encoding gene abrB of a global transcriptional regulator AbrB in the strain; and (2) the genetic modification comprises introducing an exogenous or enhancing endogenous expression of a nucleic acid construct encoding a functional nitrogenase. The application can enhance the nitrogen fixation capacity of the Clostridium tyrobutyricum, significantly reduce the dependence of the Clostridium tyrobutyricum fermentation process on an exogenous nitrogen source, and simultaneously endow the strain with the ability of excreting ammonia nitrogen into the extracellular, thus having important industrial application value and environmental protection significance.

Description

Technical Field

[0001] This invention relates to the fields of microbial genetic engineering and industrial biotechnology, specifically to a genetically engineered Clostridium butyricum chassis cell with enhanced nitrogen fixation capacity under low-nitrogen conditions, its construction method, and its application in the fermentation production of chemicals under low-nitrogen conditions. Background Technology

[0002] Nitrogen sources are among the most expensive components in microbial fermentation media. In industrial anaerobic fermentation, exogenous nitrogen sources such as yeast extract, peptone, and ammonium sulfate are typically added to maintain cell growth and product synthesis, with nitrogen source costs accounting for 20%-40% of the total media cost. Furthermore, excessive nitrogen sources lead to increased ammonia nitrogen content in fermentation wastewater, increasing the burden on environmental treatment. Biological nitrogen fixation is the process of reducing atmospheric molecular nitrogen (N2) to ammonia (NH3), catalyzed by the nitrogenase complex. Nitrogenase is composed of molybdenum-iron protein (component I, encoded by nifD and nifK) and ferritin (component II, encoded by nifH), and its maturation and function also require the participation of a series of auxiliary genes such as nifE, nifB, nifV, and nifI. To date, research on biological nitrogen fixation has mainly focused on rhizobia and a few model nitrogen-fixing bacteria; reports on achieving functional nitrogen fixation in industrial anaerobic fermentation strains and using it to reduce the addition of exogenous nitrogen sources are extremely limited.

[0003] *Clostridium tyrobutyricum* is a Gram-positive, strictly anaerobic, spore-forming *Clostridium* strain widely used in the fermentation production of chemicals such as butyric acid, lactic acid, 1,3-butanediol, butanol, and γ-aminobutyric acid (GABA). Its genome naturally contains a nitrogenase gene cluster, but its nitrogen-fixing activity is low under conventional fermentation conditions, making it difficult to meet the nitrogen requirements of industrial fermentation. AbrB is a conserved global transcriptional regulator in Bacillus and Clostridium, involved in the regulation of various physiological processes such as carbon metabolism, nitrogen metabolism, and sporulation. However, the transcriptional regulatory role of AbrB on the nitrogenase gene cluster in *Clostridium tyrobutyricum* has not been previously reported.

[0004] Therefore, developing a Clostridium butyricum chassis cell that can effectively fix atmospheric nitrogen and reduce dependence on exogenous nitrogen sources under low nitrogen conditions has important industrial application value for reducing fermentation costs and environmental burden. Summary of the Invention

[0005] The purpose of this invention is to provide a genetically engineered Clostridium butyricum chassis cell that, through genetic modification, endows or enhances its ability to fix atmospheric nitrogen under low-nitrogen conditions, thereby reducing the dependence on exogenous nitrogen sources during fermentation. In low-nitrogen culture media, the strain exhibits increased nitrogenase activity, increased extracellular ammonia nitrogen accumulation, increased carbon source consumption rate, increased biomass accumulation, and / or increased metabolite synthesis capacity.

[0006] Another object of the present invention is to provide a method for constructing the aforementioned chassis cells.

[0007] Another object of the present invention is to provide the application of the above-mentioned chassis cells in the fermentation production of chemicals under low nitrogen conditions.

[0008] The technical solution of the present invention is as follows:

[0009] A *Clostridium tyrobutyricum* strain with enhanced nitrogen-fixing capacity under low-nitrogen conditions, comprising at least one of the following genetic modifications:

[0010] (1) The genetic modification includes downregulating or knocking out the gene encoding abrB, which is the endogenous global transcriptional regulator of the strain.

[0011] (2) The genetic modification includes the introduction of exogenous or enhanced endogenous nucleic acid constructs encoding functional nitrogenases.

[0012] Furthermore, the abrB gene can be downregulated or knocked out through homologous recombination, CRISPR-Cas9 gene editing, antisense RNA interference, or CRISPRi interference.

[0013] Furthermore, the nucleic acid construct is located on a recombinant plasmid or integrated into the genome of the strain.

[0014] Preferably, the nucleotide sequence of the abrB gene is as shown in SEQ ID NO: 1, or a sequence having at least 85% identity with it.

[0015] Preferably, the nucleic acid construct encoding the functional nitrogenase comprises a set of nitrogenase gene clusters, wherein the nitrogenase gene clusters include nifH, nifI, nifD, nifK, nifE and nifB genes.

[0016] Preferably, the nitrogenase gene cluster further includes nifV.

[0017] Preferably, the nitrogen fixation gene cluster comprises a nucleotide sequence as shown in SEQ ID NO: 2-10, or a sequence having at least 90% identity with it and encoding a functional nitrogenase.

[0018] Preferably, the Clostridium tyrobutyricum is Clostridium tyrobutyricum ATCC25755.

[0019] A method for constructing the Clostridium butyricum includes the following steps:

[0020] (1) Knock out the abrB gene in the Clostridium butyricum genome, and / or amplify the nitrogenase gene cluster using Clostridium butyricum genomic DNA as a template.

[0021] (2) The gene fragment obtained in step (1) is operatively linked to the promoter to construct a recombinant expression vector;

[0022] (3) The recombinant expression vector was introduced into Clostridium butyricum via conjugation transfer or electroporation;

[0023] (4) Screening to obtain recombinant strains with enhanced nitrogen fixation capacity under low nitrogen conditions.

[0024] The application of Clostridium butyricum in the fermentation production of chemicals under low nitrogen conditions.

[0025] Preferably, the chemical is one or more of butyric acid, lactic acid, 1,3-butanediol, butanol, and γ-aminobutyric acid (GABA).

[0026] Preferably, the low-nitrogen condition is that the culture medium contains only exogenous nitrogen sources of no more than 0.5 g / L.

[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0028] (1) This invention is the first to discover that the global transcriptional regulator AbrB has a negative regulatory effect on the nitrogenase gene cluster of Clostridium butyricum, and proves that genetic engineering (knockout of abrB) can indeed enhance the nitrogen fixation capacity of Clostridium butyricum under low nitrogen conditions. Acetylene reduction assay showed that the nitrogenase activity of wild-type strain Ct was 16.22 ± 0.31 nmol / mL / h; the nitrogenase activity of strain CtΔabrB with knockout of abrB reached 18.89 ± 0.23 nmol / mL / h, which was 16.5% higher than that of wild-type; while the nitrogenase activity of strain Ct-Pcat1-abrB with overexpression of abrB decreased to 15.52 ± 0.19 nmol / mL / h, which was 4.3% lower than that of wild-type. Transcriptional analysis showed that the relative transcriptional levels of nitrogen-fixing-related genes (nifH, nifI1, nifI2, nifD, nifK, nifE, nifB, nifVω, and nifVα) in CtΔabrB all showed an increasing trend. Growth curve analysis in nitrogen-deficient medium further revealed that CtΔabrB gradually exhibited growth dominance from 12 h, reaching an OD value of 4.09 ± 0.15 by 18 h, significantly higher than the wild type (3.27 ± 0.23) and the abrB overexpression strain (3.16 ± 0.11); while the abrB overexpression strain consistently showed the weakest growth trend throughout the entire culture process. These two opposing pieces of evidence, from both enzyme activity and transcriptional levels, jointly confirm the negative regulatory function of AbrB on nitrogen fixation and demonstrate that the genetic engineering modification of this invention can indeed enhance the nitrogen-fixing capacity of Clostridium butyricum.

[0029] (2) This invention achieves constitutive overexpression of the nitrogenase gene cluster (nifHIDKEBV) in Clostridium butyricum for the first time, obtaining the engineered strain Ct-Pcat1-nifHIDKEBV. Under low nitrogen conditions (containing only 0.5 g / L yeast extract), the nitrogen fixation capacity of this engineered strain is enhanced, the extracellular ammonia nitrogen accumulation is increased by 50.4%, and the glucose consumption and butyrate production are increased by 23.1% and 30.4% respectively compared with the wild type.

[0030] (3) The engineered bacteria of this invention can accumulate extracellular ammonia nitrogen under low nitrogen conditions. The extracellular ammonia nitrogen accumulation of strains CtΔabrB, Ct-Pcat1-nifHIDKEBV, and CtΔabrB-Pcat1-nifHIDKEBV reached 39.56 ± 2.56, 44.69 ± 2.42, and 47.79 ± 0.22 nmol / mL, respectively, which were 33.2%, 50.4%, and 60.9% higher than those of the wild type (29.71 ± 1.64 nmol / mL). Among them, the combined strain CtΔabrB-Pcat1-nifHIDKEBV, which simultaneously knocked out abrB and overexpressed the nitrogenase gene cluster, showed the highest extracellular ammonia nitrogen accumulation, indicating that the two genetic modifications had a synergistic enhancing effect on nitrogen fixation ability. This characteristic enables engineered bacteria not only to meet their own nitrogen requirements, but also to have the potential to be co-cultured with other non-nitrogen-fixing bacteria in anaerobic fermentation systems as "nitrogen donors", or to use their fermentation products (ammonia-containing fermentation broth) for nitrogen supplementation in plants.

[0031] (4) Overexpression validation of the nitrogen fixation gene module showed that overexpression of the nifHIDKEB gene module (lacking the nifV gene) in wild-type Clostridium butyricum still improved the nitrogen fixation capacity and fermentation performance of the strain under low nitrogen conditions, suggesting that nifV is not an absolutely essential gene for nitrogen fixation. Functional complementation experiments demonstrated that the complete nifHIDKEBV gene cluster could restore the nitrogen fixation function and fermentation performance of the nitrogen fixation gene cluster knockout strain (CtΔnifHIDK) under low nitrogen conditions, confirming that this gene cluster is a necessary genetic element for nitrogen fixation function in Clostridium butyricum. The above results provide experimental basis for the reasonable minimization of the nitrogen fixation gene module and also provide a theoretical basis for the inter-strain transfer of the nitrogen fixation module.

[0032] (5) Butyric acid is an exemplary fermentation product of the chassis cells of the present invention. Since the genetic modifications of the present invention improve the basal nitrogen and carbon metabolism levels of the strain, this improvement does not depend on a specific product synthesis pathway. Those skilled in the art can reasonably expect that when the chassis cells of the present invention are applied to other chemicals known to be produced using Clostridium butyricum as a host (such as lactic acid, 1,3-butanediol, butanol, γ-aminobutyric acid, etc.), the improved production performance under low nitrogen conditions can also be obtained. Attached Figure Description

[0033] Figure 1 This is a schematic diagram of the gene structure of the nitrogenase gene cluster nifHIDKEBV.

[0034] Figure 2This is a map of the recombinant plasmid pMTL82151-Pcat1-nifHIDKEBV for the nitrogenase gene cluster. pMTL82151-Pcat1-nifHIDKEB is the plasmid after deleting the nifV fragment, and pMTL82151-Pcat1-abrB is the plasmid corresponding to the nitrogenase gene cluster with the abrB gene replaced.

[0035] Figure 3 The nitrogenase activity curves (A) and growth diagram (B) of different strains under low nitrogen conditions are shown.

[0036] Figure 4 This figure shows the effect of abrB gene knockout on the relative transcriptional levels of nitrogen-fixing related genes under low-nitrogen conditions. Detailed Implementation

[0037] The technical solution of the present invention will be described in detail below through specific embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional molecular biology and microbiology methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0038] In this invention, "low nitrogen conditions" are defined as follows: "Low nitrogen conditions" refer to culture conditions in which no inorganic nitrogen sources such as ammonium sulfate are added to the culture medium, and yeast powder with a concentration not exceeding 0.5 g / L is used as the sole exogenous nitrogen source.

[0039] In this invention, "operable linking" is defined as follows: "operable linking" means that the promoter sequence and the coding sequence of the nitrogenase gene cluster are arranged on the same nucleic acid molecule in the following manner: the promoter is located upstream of the start codon of the nitrogenase gene cluster, there is no transcription terminator between them, and the transcription direction of the promoter is consistent with the coding direction of the nitrogenase gene cluster, so that the promoter can initiate the transcription of the nitrogenase gene cluster.

[0040] The seed activation medium used was Reinforced Clostridium Medium (RCM) (1 L system): 10 g tryptone, 10 g beef extract (powder), 3 g yeast extract, 5 g glucose, 1 g soluble starch, 5 g sodium chloride, 3 g sodium acetate, 0.5 g L-cysteine ​​hydrochloride, pH 6.8 ± 0.1, with 1.5% (m / v) agar powder added to the solid medium.

[0041] LB (Luria-Bertani) medium (1 L system): 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, solid medium supplemented with 1.5% (m / v) agar powder.

[0042] Low-nitrogen medium (1 L system): 20.0 g glucose, 0.5 g yeast extract, 1 g K2HPO4·3H2O, 0.5 g KH2PO4, trace elements added to the medium at a ratio of 1:1000 (v / v); Trace element A (1 L): 20 g CoCl2‧6H2O, 15 g CaCl2‧2H2O; Trace element B (1 L): 15 g FeSO4‧7H2O, 15 g ZnSO4‧7H2O, 10 g MnSO4‧H2O, 100 g MgSO4‧7H2O; An additional 2.5 g / L Na2MoO4·2H2O stock solution was prepared and added to the medium at a ratio of 1:1000, pH 6.8 ± 0.1. Glucose was sterilized separately from other components of the medium. This medium, without added CaCO3, is used for experiments such as nitrogenase activity assay, ammonia nitrogen accumulation assay, and transcriptional level analysis.

[0043] Low-nitrogen fermentation medium (1 L system): Based on the low-nitrogen medium, the glucose concentration is increased to 60.0 g / L, and 40.0 g / L CaCO3 is added. The remaining components and sterilization conditions are the same as the low-nitrogen medium. This medium is used for butyric acid fermentation experiments, and CaCO3 is used to neutralize the organic acids produced during fermentation.

[0044] Clostridium butyricum ATCC 25755 (American Type Culture Collection), its genome sequence can be found in the NCBI database accession number GCF_001642655.1.

[0045] The pMTL83153 and pMTL82151 media editing media were purchased from Shenzhen Bosai Technology Co., Ltd.

[0046] Escherichia coli CA434 was purchased from Guangzhou Cyclone Biotechnology Co., Ltd.

[0047] Example 1: Construction of abrB / nifHIDK gene knockout strain

[0048] A *Clostridium butyricum* endogenous CRISPR gene editing system was used to construct the abrB / nifHIDK gene knockout strain CtΔabrB / CtΔnifHIDK. A specific spacer sequence was designed based on the continuous gene region of abrB / nifHIDK (nucleotide sequence shown in SEQ ID NO: 1 / 2), and the upstream and downstream homologous arms of the target region were amplified. The repeat-spacer-repeat expression unit, homologous arms, and linearized pMTL83153 editing vector were seamlessly ligated to obtain the abrB / nifHIDK knockout plasmid. The knockout plasmid was transformed into *Clostridium butyricum* ATCC 25755 via *E. coli* CA434 conjugation. Conjugates were screened on RCM plates containing thiamphenicol and D-cyclic serine. The plasmid was eliminated by lactose-induced editing and 5-fluorouracil reverse selection. The candidate strain was validated by cross-deletion PCR and sequencing to obtain CtΔabrB / CtΔnifHIDK.

[0049] Example 2: Effects of abrB gene knockout on the transcriptional level of nitrogen fixation genes

[0050] To analyze the effect of abrB gene knockout on the transcriptional levels of nitrogen-fixing-related genes in Clostridium butyricum, wild-type strain Ct and abrB gene knockout strain CtΔabrB were selected for RT-qPCR detection. Ct and CtΔabrB were inoculated into low-nitrogen medium containing 20 g / L glucose and cultured anaerobically at 37 °C. Cells were collected after 12 h of culture, with three independent biological replicates for each strain. Total RNA was extracted from the cells using the Nanjing Novizan Total RNA Extractor (Trizol) kit. After removing genomic DNA, an equal amount of RNA was reverse transcribed into cDNA. Using cDNA as a template, the relative transcriptional levels of nifH, nifI1, nifI2, nifD, nifK, nifE, nifB, nifVω, and nifVα were detected by real-time quantitative PCR. typA was used as an internal control gene, and Ct was used as a calibration group. -ΔΔCt The method calculates the relative transcription level of each target gene.

[0051] The results showed that the relative transcription levels of all tested nitrogen fixation-related genes in CtΔabrB were increasing, indicating that abrB gene knockout could increase the transcription level of Clostridium butyricum nitrogen fixation-related genes, and that AbrB had a negative regulatory effect on the transcription of the tested nitrogen fixation-related genes.

[0052] Example 3: Construction and identification of strains overexpressing the nifHIDKEBV / nifHIDKEB gene

[0053] Using *Clostridium butyricum* ATCC 25755 genomic DNA as a template, the Pcat1 promoter (nucleotide sequence shown in SEQ ID NO: 11), nifHIDKEBV, and nifHIDKEB fragments (nucleotide sequences shown in SEQ ID NO: 2-10) were amplified by PCR. Using a seamless cloning method, the Pcat1 promoter was ligated with the abrB, nifHIDKEBV, and nifHIDKEB gene fragments and then cloned into the pMTL82151 vector to obtain the recombinant plasmid pMTL82151-Pcat1-nifHIDKEBV / nifHIDKEB. The recombinant plasmid pMTL82151-Pcat1-nifHIDKEBV / nifHIDKEB, verified by sequencing, was transformed into *Escherichia coli* CA434 to obtain the conjugation donor strain CA434 / pMTL82151-Pcat1-nifHIDKEBV / nifHIDKEB. Using *Clostridium butyricum* ATCC 25755 (wild-type Ct) or CtΔnifHIDK strain (nifHIDK gene knockout strain) as recipient bacteria, pMTL82151-Pcat1-nifHIDKEBV / nifHIDKEB was introduced into the recipient bacteria via bacterial conjugation transfer. After conjugation culture, the bacterial cells were plated on RCM solid selection medium containing 25 μg / mL thiamphenicol and 250 μg / mL D-cyclic serine and cultured anaerobically at 37 ℃ for 36–48 h. Single colonies were picked and identified by PCR using expression plasmid-specific primers and linker primers, and the specific amplification products were sequenced. The correctly identified strains were named Ct-Pcat1-nifHIDKEBV / nifHIDKEB and CtΔnifHIDK-Pcat1-nifHIDKEBV.

[0054] Example 4: Nitrogenase Activity Assay (Acetylene Reduction Method)

[0055] Using a 100 mL syringe (pre-filled with a small piece of rigid PTFE) or a 1 L gas bag as a container, dilute ethylene standard gas stepwise with standard nitrogen gas at a 1:1 volume ratio to prepare a calibration series with six concentration gradients: 0.50, 1.00, 2.00, 2.50, 5.00, and 10.0 mg / m³. Inject 0.5 mL of each calibration series sequentially from low to high concentration into the gas chromatograph. The concentration of ethylene (mg / m³) is then used as the calibration standard. 3 Plot the calibration curve of ethylene with the x-axis as the horizontal axis and the corresponding peak area as the vertical axis.

[0056] Take 2.5 mL of activated RCM culture medium into a 125 mL headspace vial (containing 50 mL of low-nitrogen culture medium), seal the vial, inject 1.0 mL of acetylene, and then incubate at 37 ℃ for 24 h. Inject ethylene at multiples of its volume into a nitrogen-filled culture vial to prepare a standard curve. Finally, extract 0.5 mL of gas from the culture vial and inject it into a gas chromatograph (ThermoTrace1300) to prepare a standard curve and determine the nitrogenase activity of the samples.

[0057] The amount of ethylene produced by the sample, C mg / m³, was calculated based on the peak area S measured by the gas chromatograph. 3 Next, calculate the amount of ethylene in the 72.5 mL culture flask, which is 72.5 × C mL. Calculate the molar mass of ethylene, which is 72.5 × C × 10⁻⁶. -3 Finally, the nitrogenase activity was calculated based on the culture time t and the bacterial volume V.

[0058] Calculation formula: Nitrogenase activity (nmol C2H4×mL / h) = 72.5×C×100028.05×V×t.

[0059] The results showed that the nitrogenase activity of wild-type Ct was 16.22 ± 0.31 nmol / mL. -1 h -1 The nitrogenase activity of CtΔabrB was 18.89 ± 0.23 nmol / mL. -1 h -1 The nitrogenase activity of Ct-Pcat1-abrB was 15.52 ± 0.19 nmol / mL, which was 16.5% higher than that of the wild type. -1 h -1 This represents a 4.3% decrease compared to the wild type.

[0060] Example 5: Determination of extracellular ammonia nitrogen accumulation

[0061] Ct, CtΔabrB, Ct-Pcat1-nifHIDKEBV, and CtΔabrB-Pcat1-nifHIDKEBV were inoculated into a low-nitrogen medium containing 20 g / L glucose and cultured at 37°C. After 12 h of culture, the fermentation broth was collected and centrifuged at 12,000 rpm for 1 min, and the supernatant was collected. The ammonia nitrogen / ammonium ion content kit from Shanghai Enzyme-Linked Biotechnology Co., Ltd. was used to determine the ammonia nitrogen concentration. A standard curve was established according to the kit's instructions, and the extracellular ammonia nitrogen concentration in each sample was calculated. Three independent culture replicates were set up for each strain, and the results are expressed as mean ± standard deviation. The extracellular ammonia nitrogen accumulation of strains CtΔabrB, Ct-Pcat1-nifHIDKEBV, and CtΔabrB-Pcat1-nifHIDKEBV reached 39.56 ± 2.56, 44.69 ± 2.42, and 47.79 ± 0.22 nmol / mL, respectively, representing increases of 33.2%, 50.4%, and 60.9% compared to the wild type (29.71 ± 1.64 nmol / mL). Notably, the extracellular ammonia nitrogen accumulation of strain CtΔnifHIDK, which had its nitrogen fixation gene cluster knocked out, decreased to 3.84 ± 1.27 nmol / mL. These results indicate that the engineered bacteria of this invention can accumulate extracellular ammonia nitrogen through biological nitrogen fixation under low-nitrogen conditions, and that this ammonia nitrogen originates from the function of the nitrogenase gene cluster. The patented genetic modification method can enhance nitrogen fixation capacity and extracellular ammonia nitrogen accumulation.

[0062] Table 1. Extracellular ammonia nitrogen concentration of each strain after 12 h of culture.

[0063]

[0064] Example 6: Butyric acid fermentation under low nitrogen conditions

[0065] 125 mL serum bottles were used, each containing 50 mL of low-nitrogen fermentation medium with 60 g / L glucose and 40 g / L CaCO3 added. Ct, CtΔabrB, CtΔnifHIDK, Ct-Pcat1-abrB, Ct-Pcat1-nifHIDKEBV / nifHIDKEB, CtΔabrB-Pcat1-nifHIDKEBV, and CtΔnifHIDK-Pcat1-nifHIDKEBV were activated and seed cultures were prepared. These were inoculated into the fermentation medium at a 5% (v / v) inoculum and anaerobic fermentation was carried out at 37 ℃ and 150 rpm. The concentrations of glucose, butyric acid, and acetic acid in the fermentation broth were measured after fermentation. High-performance liquid chromatography (HPLC) analysis was performed using an Aminex 87H organic acid column. The detection conditions were: column temperature 60 ℃, mobile phase 2.5 mM H2SO4, flow rate 0.6 mL / min, and differential refractive index detector temperature 40 ℃.

[0066] The fermentation results of different strains under nitrogen-deficient conditions for glucose, butyric acid, and acetic acid are shown in Table 2. Compared with Ct, the glucose consumption of Ct-Pcat1-nifHIDKEBV increased from 21.99 ± 0.73 g / L to 27.06 ± 1.20 g / L, an increase of approximately 23.1%; the butyric acid production increased from 6.68 ± 0.57 g / L to 8.71 ± 0.09 g / L, an increase of approximately 30.4%; and the acetic acid production increased from 2.24 ± 0.30 g / L to 2.58 ± 0.04 g / L, an increase of approximately 15.2%. Similarly, the glucose consumption and butyric acid production of Ct-Pcat1-nifHIDKEBV significantly increased to 26.99 ± 1.90 g / L and 9.22 ± 0.03 g / L, respectively. The results indicate that, under the experimental conditions, constitutive overexpression of the complete nitrogenase gene cluster can improve the glucose utilization and final butyrate yield of Clostridium butyricum under nitrogen-deficient conditions.

[0067] Compared with CtΔnifHIDK, the glucose consumption of CtΔnifHIDK-Pcat1-nifHIDKEBV increased from 21.55 ± 0.64 g / L to 28.34 ± 0.51 g / L, an increase of approximately 31.5%; butyric acid production increased from 6.09 ± 0.30 g / L to 7.58 ± 0.34 g / L, an increase of approximately 24.5%; and acetic acid production increased from 2.07 ± 0.01 g / L to 2.33 ± 0.04 g / L, an increase of approximately 12.6%. These results indicate that the introduction of the complete nifHIDKEBV gene cluster into CtΔnifHIDK improved the strain's glucose utilization and butyric acid accumulation under nitrogen-deficient conditions, suggesting that the complete nifHIDKEBV gene cluster can functionally compensate for the low-nitrogen fermentation phenotype resulting from the deletion of the core gene segment of nifHIDK.

[0068] Table 2 Fermentation data of each strain under nitrogen-deficient conditions

[0069]

[0070] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

[0071] sequence list

[0072] SEQ ID NO: 1 (abrB gene nucleotide sequence)

[0073] atgaaatcaacaggtgttgtaagaagagtggacgagctaggaagaattgtaattcctatagaattaagaaggactttagacattgctgaaaaagatgctttagaaatatacgtggatggtgaacaaatcatattaaagaaatatgaaccagcatgtatcttctgtggtgatgcaagagatgttgtaaattacaaaggaaaaaatatatgcaagaattgtttaaatgaattaaaagaaggaagataa

[0074] SEQ ID NO: 2 (nifH nucleotide sequence)

[0075] atgagacaagtagctatttatggaaaaggtggaattggaaaatctacaacaacacaaaatcttacttcaggattggctgaaatgggtaaacacataatggtggtaggttgcgatccaaaagcagactcaacaagattacttttaggtggactagctcaaaagacagttctggatacactaagagaagaaggagacgatgtagatctagattcaatattaaaagcaggatatggcaacataaaatgtgttgaatcaggtggtccagaacctggagtcggatgtgcaggaagaggtataattacttcaattaatatgctggaacaattaggagcttatactgatgacttggattatgttttctatgatgtattaggtgatgttgtttgtggtggttttgctatgccaatacgtgaaggtaaagcccaggagatatatatagtagccagcggagaaatgatggcaatgtatgcagcaaacaatatatcaaaaggtatatacaaatttgctagctcaggtggagttagattaggtggtattatatgtaacagcagaaaggttgacaatgaatatgaattacttgattcatttgctaaaaaattaggcagtcagttaatatactttgtaccaagaagtccagaggttacaaaggcagaaataaataaacagactgttatacaatatgatccaaaagctaaacaggcagatgaatatagggcattagctaaggctatagatggaaatgatatgtttgtagtaccaaaacctatggctcaagaggagttagaagccatattaatggaacatggtcttatggatgcttaa

[0076] SEQ ID NO: 3 (nifI1 nucleotide sequence)

[0077] atgttgatgataaaggctattataagaccagataaaacagctactgttctttctgaattatgtgatgcaggatttccagcagttactaaacttgatgtagtgggcagaggtaaacagagaggtgtaaaagtaggagatatattttatgatgaaattccaaaacagatgcttttagtagtaataagagatgaggataaagatgacatagtaaaaataattaccaaaaatgcgaaaactggaaccaagggagcatttggagatggaaaaatatttataactcctgtagaagaagcatatacgataagttcaggagcaaataaattatag

[0078] SEQ ID NO: 4 (nifI2 nucleotide sequence)

[0079] atgaaagaaattatggctattattagaatggacatgataggtaagactaaagaggctcttgctgaaattggatttccttctataacatgtaaaagagttcttggacgtggcaagaaaaagattgatttttctttaattaaagattatatgacaggggaagacatatcagctatacaagataaaaaaattgcagaacagatatctgaagtacacagacttatttctaaaagattagttattatattatcaaaagatgaagatgtaaaaaagatcgtggatactataatagaaacaaatagaacgggaaatcctggagacgggaaaatttttgtaataccagttactgattcaataaggataagaacagaagaaattggagatgcggctatttaa

[0080] SEQ ID NO: 5 (nifD nucleotide sequence)

[0081]

[0082] SEQ ID NO: 6 (nifK nucleotide sequence)

[0083]

[0084] SEQ ID NO: 7 (nifE nucleotide sequence)

[0085]

[0086] SEQ ID NO: 8 (nifB nucleotide sequence)

[0087]

[0088] SEQ ID NO: 9 (nifVω nucleotide sequence)

[0089]

[0090] SEQ ID NO: 10 (nifVα nucleotide sequence)

[0091] atggatatcaatattgtagatactacattgagagatggtgaacagaaagcctgtatagctttagatatggatcaaaaagttaaaattgctaaaattttagacaaaatgggagttggtcagatagaagctggagtggcagctatggatggagaagaaaaagagagcattaaaaagataatgaatcttgggctaaatagtaaaatatcatcatggaatagaatgaatattcaagatatagatgattctatggattgtggtgtagacatagttcatatatccattccttcatccgatttacagattaaatcaaaattaagaaaggatagagattgggttataaataatgcaaggaaatgtattgcatatacattagataaaggctatgaggtaaccatagggttggaggatgccagtagagctgatataaattttttgattgaattatgtataactgtgtctgaaatgggagtaaagagagttagatatgcagatacagttggaatcttatatccaagaaaaattttctatcatctaaaaaaattgattcaggaggttccattagaaatagaaattcatgcacataatgattttggaatggcacttgcaaattctttaggagccattgaagcgggagccaaatatgtgaactgcactgttacaggtattggcgaacgtgctggcaattgtgatttcttaaaatttgtaaaaatattagatggagtaactggagagaaggcctctaatagaagttttgataatttagtaggtatggaacaacaaattagggaaataattaattatgcataa

[0092] SEQ ID NO: 11 (Pcat1 promoter nucleotide sequence)

[0093] Agagcccaaatctttgaaaataatgttctttctttgtatagaaaggacattatttttttatagttgttttgtaaaccatagcattgtttaagttattttcagctacagctattattttaataataacattgatgtaattatgttattttaaccaaaagaaaatcatattaattttgaataaatggatatattattaatataatattaaaaggaagttcaggttgtatattatacaacatctattttttactcataattgtagttttttttaacaatcataatggaagttaattattaaattttatataatttatgaaagggtggttttt。

Claims

1. A Clostridium butyricum strain with enhanced nitrogen-fixing capacity under low-nitrogen conditions, characterized in that, Clostridium tyrobutyricum contains at least one of the following genetic modifications: (1) The genetic modification includes downregulating or knocking out the gene encoding abrB, which is the endogenous global transcriptional regulator of the strain. (2) The genetic modification includes the introduction of exogenous or enhanced endogenous nucleic acid constructs encoding functional nitrogenases.

2. The Clostridium butyricum according to claim 1, characterized in that, The nucleotide sequence of the abrB gene is shown in SEQ ID NO: 1, or a sequence having at least 85% identity with it.

3. The Clostridium butyricum according to claim 1 or 2, characterized in that, The nucleic acid construct encoding the functional nitrogenase contains a cluster of nitrogenase genes, which includes the nifH, nifI, nifD, nifK, nifE, and nifB genes.

4. The Clostridium butyricum according to claim 3, characterized in that, The nitrogenase gene cluster also includes nifV.

5. The genetically engineered Clostridium butyricum according to claim 4, characterized in that, The nitrogen fixation gene cluster contains nucleotide sequences as shown in SEQ ID NO: 2-10, or sequences that have at least 90% identity with it and encode functional nitrogenases.

6. The Clostridium butyricum according to claim 1 or 2, characterized in that, The Clostridium tyrobutyricum is ATCC 25755.

7. A method for constructing Clostridium butyricum according to any one of claims 1-6, characterized in that, Includes the following steps: (1) Knock out the abrB gene in the Clostridium butyricum genome, and / or amplify the nitrogenase gene cluster using Clostridium butyricum genomic DNA as a template; (2) The gene fragment obtained in step (1) is operatively linked to the promoter to construct a recombinant expression vector; (3) The recombinant expression vector was introduced into Clostridium butyricum via conjugation transfer or electroporation; (4) Screening to obtain recombinant strains with enhanced nitrogen fixation capacity under low nitrogen conditions.

8. The use of Clostridium butyricum as described in any one of claims 1-6 in the fermentation production of chemicals under low nitrogen conditions.

9. The application according to claim 8, characterized in that, The chemical is one or more of butyric acid, lactic acid, 1,3-butanediol, butanol, and γ-aminobutyric acid (GABA).

10. The application according to claim 8 or 9, characterized in that, The low-nitrogen condition is that the culture medium contains only exogenous nitrogen sources of no more than 0.5 g / L.

Images