A high-efficiency somatic embryogenesis method for pinus koraiensis based on pkbbm gene

Abstract

The application relates to a red pine high-efficiency somatic embryogenesis method based on PkBBMs The application relates to a red pine high-efficiency somatic embryogenesis method based on PkBBMs The application relates to a red pine high-efficiency somatic embryogenesis method based on PkBBMs The application relates to a red pine high-efficiency somatic embryogenesis method based on

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically relating to a method for efficient somatic embryogenesis of Korean pine based on PkBBMs genes. Background Technology

[0002] Korean pine (Pinus koraiensis) is the dominant species in the temperate zonal climax community of broad-leaved Korean pine forests. Its timber is of excellent quality, and both its wood and nuts have significant economic value. It is an extremely important high-quality and precious timber and nut species in my country and East Asia. Currently, it is only distributed globally in the eastern mountainous areas of Northeast my country, the Russian Far East, and the Korean Peninsula. At present, natural Korean pine forest resources are decreasing, and the demand for high-quality seedlings for plantation construction is urgent. Developing efficient and stable asexual propagation techniques is of great significance for accelerating the propagation of improved Korean pine varieties and ensuring the sustainable economic development of forest areas.

[0003] Tissue culture technology is an important means of rapidly propagating superior germplasm resources. Among them, somatic embryogenesis (SEP) has the advantages of genetic stability, rapid reproduction, and high survival rate. Especially for pine species with long reproduction cycles, SEP can quickly form a large number of regenerated plants with stable traits. At the same time, SEP is an effective model system for studying the morphology, physiology, molecular and biochemistry of embryonic development and has great application value.

[0004] Plant somatic embryogenesis is a unique phenomenon in plant development. This process can be artificially controlled under in vitro conditions and is the most complete way of expressing cell totipotency and a classic example. Stasolla's research found that pine species undergo indirect somatic embryogenesis, and therefore their somatic embryogenesis process is divided into three stages: (1) the induction and proliferation stage of embryonic callus (EC); (2) the differentiation and maturation stage of somatic embryos (SEs); and (3) the germination of SEs and plant regeneration stage.

[0005] The somatic embryogenesis system of Korean pine has been basically established, comprising four stages: callus induction, callus proliferation, somatic embryo maturation, and somatic embryo germination (the transformation from embryogenic callus proliferation to somatic embryo maturation is the most challenging and critical step). Existing research has determined the optimized culture medium formulation, hormone ratio, and culture conditions. However, this technology still faces a series of prominent bottlenecks in practical applications: low induction rate of embryogenic callus, strong genotype dependence, asynchronous somatic embryogenesis and high malformation rate due to morphogenesis failure, and easy loss of embryogenesis during long-term subculture. These problems are not unique to Korean pine, but are common problems in somatic embryogenesis technology of conifers and even the entire woody plant industry, which seriously restricts the technology from laboratory to large-scale production application. Summary of the Invention

[0006] The purpose of this invention is to provide a highly efficient somatic embryogenesis method for Korean pine based on PkBBMs genes that can significantly improve the yield and quality of somatic embryos.

[0007] The present invention adopts the following technical solution:

[0008] A highly efficient somatic embryogenesis method for Korean pine based on PkBBMs genes includes the following steps:

[0009] (1) Preparation of embryogenic callus: Immature cones of Korean pine were collected, disinfected with 75% alcohol, and whole kernels were placed on DCR induction medium and cultured in the dark until embryogenic callus grew.

[0010] (2) Preparation of PkBBMs overexpression vector of Korean pine: The PkBBMs gene of Korean pine was ligated to the vector to construct the overexpression vector;

[0011] (3) Preparation and resuspension of Agrobacterium: The overexpression vector was transformed into competent Agrobacterium cells, and the Agrobacterium culture was expanded. The obtained culture was centrifuged at 4°C, the supernatant was discarded, and the cells were resuspended in red pine infection resuspension solution to OD. 600 When the concentration reaches 0.4-0.5, the inoculum is obtained;

[0012] (4) Infection, co-culture and recovery culture: After 7-10 days of proliferation culture of embryogenic callus, the callus was taken in a clean bench and placed in the infection solution for infection. Then, the bacterial solution was filtered using a 100-mesh metal cell sieve. The callus was then transferred to a solid co-culture medium with forceps and co-cultured at 25±2℃ in the dark for 2 days. After co-culture, the callus was washed with sterilization solution, the sterilization solution was dried using a vacuum filter, and the material was placed on recovery culture medium for 7-14 days.

[0013] (5) Screening culture: The callus material that has recovered to the normal growth state is transferred to the screening culture medium. The callus that grows and proliferates well on the screening culture medium is picked and transferred to a new screening culture medium for continued culture. The screening is repeated three times, and the screening subculture cycle is 14 days.

[0014] (6) Maturation culture: Take a well-preserved callus and place it in a tube. Blow and blow to disperse the tissue clumps. Pour the mixture into a Buchner funnel lined with filter paper. Vacuum dry until there are no water droplets. Transfer the filter paper to a solid maturation culture medium and incubate in the dark for 4-8 weeks.

[0015] Further, in step (1), the DCR induction culture medium components include: 400 mg / L NH4NO3, 340 mg / L KNO3, 556 mg / L CaNO3·4H2O, 170 mg / L KH2PO4, 370 mg / L MgSO4·7H2O, 85 mg / L CaCl2·2H2O, 6.2 mg / L KI, 22.3 mg / L H3BO3, 8.6 mg / L MnSO4·H2O, 0.25 mg / L ZnSO4·7H2O, 0.83 mg / L Na2MoO4·2H2O, 0.025 mg / L CuSO4·5H2O, 0.025 mg / L CoCl2·6H2O, 0.25 mg / L NiCl, 1 mg / L inositol, 0.5 mg / L Vitamin B1, 0.5 mg / L Vitamin B6, and 0.2 mg / L... Niacin, 200 mg / L glycine, 37.3 mg / L Na2·EDTA, 27.8 mg / L FeSO4·7H2O, 2 mg / L naphthaleneacetic acid (NAA), 1.5 mg / L 6-benzylaminopurine (6-BA), 30 g / L sucrose, 0.5 g / L acid-hydrolyzed casein (CH), 0.5 g / L glutamine (Gln), 4 g / L gellan gum, pH=5.8.

[0016] Furthermore, in step (2), the nucleotide sequence of the Korean pine PkBBMs gene is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0017] Furthermore, in step (2), the carrier is pCambia1300.

[0018] Furthermore, in step (3), the red pine infection resuspension is: mLV medium (Coolaber, PML1631) with 100 µM acetylsyringone (AS) added, pH=5.8.

[0019] Furthermore, in step (4), the components of the Korean pine co-culture medium are as follows: the basic culture medium is mLV medium, with the addition of 2 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.5 mg / L 6-BA, 30 g / L sucrose, 0.5 g / L CH, 0.5 g / L Gln, 100 µM acetylsyleugenone (AS), 4 g / L gellan gum, and pH=5.2.

[0020] Furthermore, in step (4), the recovery culture medium consists of: the basic culture medium is mLV medium, with the addition of 2 mg / L 2,4-D, 0.5 mg / L 6-BA, 30 g / L sucrose, 0.5 g / L CH, 0.5 g / L Gln, 200 mg / L cephalosporin (Cef), 4 g / L gellan gum, and pH=5.8.

[0021] Furthermore, in step (5), the screening medium components are as follows: the basic medium is mLV medium, with the addition of 2 mg / L 2,4-D, 0.5 mg / L 6-BA, 30 g / L sucrose, 0.5 g / L CH, 0.5 g / L Gln, 200 mg / L Cef, 20 mg / L hygromycin (Hyg), 4 g / L gellan gum, and pH=5.8.

[0022] Furthermore, in step (6), the solid maturation culture medium consists of the following components: the basic culture medium is mLV medium, supplemented with 68.4 g / L sucrose, 80 μmol / L abscisic acid (ABA), 0.5 g / L CH, 1 g / L activated carbon (AC), 0.5 g / L Gln, 0~0.75 mg / L brassinolide (BR), and 12 g / L gellan gum, with a pH of 5.8.

[0023] Preferably, in step (6), the brassinolide BR in the solid maturation medium is 0.75 mg / L.

[0024] The beneficial effects of this invention are as follows:

[0025] This invention significantly improves the yield and quality of somatic embryos in Korean pine by overexpressing the PkBBMs gene, and exhibits a synergistic effect with BR treatment. Using embryogenic callus tissue from Korean pine as material, overexpressing cell lines were obtained via Agrobacterium-mediated transformation. Somatic embryo maturation culture results showed that after 2 weeks of culture, the number of early protoembryos increased by up to 59.06%; after 4 weeks, the number of columnar embryos increased by up to 57.01%; and after 8 weeks, the number of cotyledonary embryos increased by up to 182.81%, and the somatic embryo length increased by up to 45.44%. Exogenous addition of 0.75 mg / L BR further enhanced these promoting effects, indicating that PkBBMs and BR signaling have a significant synergistic effect in regulating somatic embryo development. Furthermore, the intracellular hydrogen peroxide (H2O2) content in the overexpressing lines was significantly reduced, alleviating oxidative stress and contributing to the maintenance of embryogenic cell viability.

[0026] The results of this invention demonstrate that the PkBBMs gene is a positive regulator of somatic embryogenesis in Korean pine, and its synergistic application with an appropriate concentration of BR can significantly improve somatic embryo yield and quality. These findings provide clear gene resources and optimization strategies for overcoming technical bottlenecks such as low somatic embryogenesis efficiency and strong genotype dependence in Korean pine. They hold significant theoretical guiding value and practical application prospects for establishing an efficient and stable rapid propagation technology system for Korean pine clones, accelerating the large-scale propagation of superior germplasm, and promoting the improvement of Korean pine plantations. Attached Figure Description

[0027] Figure 1 Mapping of the conserved AP2 / ERF domains of two repeats of 12 PkAP2s proteins to identify them.

[0028] Figure 2 A diagram illustrating the expression patterns of somatic embryonic growth and development in members of the Korean pine AP2 family.

[0029] Figure 3 The results of CDS sequence cloning for the PkBBM1 and PkBBM2 genes.

[0030] Figure 3 In the diagram, lane M represents the DL2000 DNA molecular weight standard; lane 1 represents the CDS clone of the PkBBM1 gene; and lane 2 represents the CDS clone of the PkBBM2 gene.

[0031] Figure 4 Figure 1 shows the results of PCR identification of pFGC-eGFP-PkBBM1 and pFGC-eGFP-PkBBM2 bacterial cultures.

[0032] Figure 4 In the diagram, lane M represents the DL2000 DNA Marker; lanes 1-4 represent the target bands for pFGC-eGFP-PkBBM1 bacterial culture PCR; and lanes 5-9 represent the target bands for pFGC-eGFP-PkBBM2 bacterial culture PCR.

[0033] Figure 5 This is a diagram showing the subcellular localization analysis of PkBBM1 and PkBBM2 proteins.

[0034] Figure 6 This is a graph showing the transcriptional activation activity analysis of PkBBM1 and PkBBM2 proteins.

[0035] Figure 7 The figure shows the results of verifying the interaction between PkBBM1 and PkBBM2 proteins and the BBS cis-acting element using yeast one-hybrid technology.

[0036] Figure 7In this study, pGADT7-Rec2-53 / pHis2-53 was used as a positive control, and pGADT7-Rec2-PkBBMs / pHis2-53 was used as a negative control.

[0037] Figure 8 This diagram illustrates the expression patterns of PkBBM1 and PkBBM2 during the proliferation process and early maturation stage under different concentrations of BR treatment.

[0038] Figure 8 In the mean squares, * indicates a significant difference at the P<0.05 level; ** indicates a significant difference at the P<0.01 level.

[0039] Figure 9 A diagram illustrating the identification level of DNA overexpressing transgenic callus.

[0040] Figure 9 In Figure A, the OE-PkBBM1 DNA PCR band is shown, with lane M being the DL2000 marker. Figure B shows the OE-PkBBM2 DNA PCR band, with lane M being the DL5000 marker.

[0041] Figure 10 The figure shows the results of detecting the expression levels of PkBBM1 and PkBBM2 in transgenic Korean pine callus cell lines using qRT-PCR technology.

[0042] Figure 10 In this study, the internal reference gene was PkGAPDH, and *: p ≤0.05 vs WT.

[0043] Figure 11 The image shows the green fluorescence detection results for the OE-PkBBM1 and OE-PkBBM2 transgenic cell lines.

[0044] Figure 11 Figure A: Fragment of the genetic transformation vector. Figure B: Green fluorescence detection results of OE-PkBBM1 and OE-PkBBM2 callus tissues.

[0045] Figure 12 This image shows the observation of the somatic embryonic development process of WT, OE-PkBBM1, and OE-PkBBM2.

[0046] Figure 13 The figure shows the statistical results of the number of somatic embryos and the length of somatic embryos at 8 weeks during the somatic embryonic development process of WT, OE-PkBBM1 and OE-PkBBM2.

[0047] Figure 13 In the bar chart, different letters represent different homogeneous subsets.

[0048] Figure 14The graph shows the results of physiological index measurements for wild-type and transgenic cell lines.

[0049] Figure 14 In the figures, Figure AE: DAB staining results of callus tissue after 7 days of proliferation; Figure F: SOD enzyme activity detection results; Figure G: POD enzyme activity detection results; Figure H: CAT enzyme activity detection results; Figure I: H2O2 content detection results. Detailed Implementation

[0050] The technical solution of the present invention will be described in detail below through specific embodiments.

[0051] Example 1: Identification and analysis of the AP2 family genome of Korean pine

[0052] Two methods were used to screen and identify members of the Korean pine AP2 family. Based on the characteristic that AP2 family proteins contain two repetitive AP2 / ERF conserved domains, on the one hand, the Arabidopsis AP2 protein sequence was used as a reference sequence, and the Korean pine AP2 sequence was retrieved from the Korean pine protein database using the Blast P program. On the other hand, the HMM file (PF00847, AP2 / ERF domain) of AP2 was retrieved from the Pfam database (http: / / pfam.xfam.org / ), and the presumed AP2 family members were obtained from the Korean pine protein database using the HMMER v3.1 tool. Using the Batch CD-Search tool on the NCBI online website (https: / / www.ncbi.nlm.nih.gov / Structure / bwrpsb / bwrpsb.cgi), the conserved structural model analysis of the complete sequences of the genes possessing the AP2 / ERF domain was performed. The obtained files were imported into TBtools-II software for visualization, thereby screening out AP2 family members possessing two AP2 / ERF domains. Two methods were used to screen and identify members of the Korean pine AP2 family. Twelve AP2 family members with two AP2 / ERF structural domains were selected, such as... Figure 1 As shown.

[0053] Among the 12 members of the Korean pine AP2 family, the CDS sequence length ranges from 1215 to 2604 bp, and the amino acid length ranges from 404 to 857 aa. The longest is PkAP2-1, and the shortest is PkAP2-5. The isoelectric point (pI) values ​​range from 5.27 to 7.91, with PkAP2-12 having the highest and PkAP2-5 the lowest. The overall isoelectric point of proteins in this family is neutral or weakly acidic.

[0054] Analysis of promoter elements of 12 members of the Korean pine AP2 family showed that PkAP2-1 and PkAP2-9 have auxin-responsive elements, while PkAP2-1 has 24 abiotic stress-responsive elements.

[0055] The results of tissue expression during vegetative growth showed that PkAP2-1 and PkAP2-9 had high expression levels in root hairs, root meristem, and root elongation zone, but extremely low expression levels in other tissues. They were only highly expressed in zygotic embryos and were almost not expressed during the development of megasporophyll and microsporophyll.

[0056] Expression patterns during somatic embryonic development, such as Figure 2 As shown, PkAP2-1 and PkAP2-9 were expressed at high levels in callus cells (EC) and somatic embryos (SE) with high somatic embryogenesis capacity, callus cells (L-EC) and somatic embryos (L-SE) without somatic embryogenesis capacity, and callus cells (N-EC) and somatic embryos (N-SE) without somatic embryogenesis capacity. Furthermore, the expression levels of PkAP2-9 and PkAP2-1 in EC and L-EC were higher than those in N-EC, and the expression levels in SE and L-SE were higher than those in N-SE.

[0057] Multiple sequence alignment of BBM protein sequences with those of Arabidopsis thaliana, pine, Scots pine, and coastal pine revealed that PkAP2-1 and PkAP2-9 possess multiple conserved protein domains in BBM proteins. It is speculated that they have similar biological functions in plant embryogenesis as those in other species, and therefore they were named PkBBM1 and PkBBM2, respectively.

[0058] Example 2 Cloning of PkBBMs

[0059] The Korean pine used in this invention was sourced from the Korean pine seed orchard of Lushuihe Forestry Bureau, Jilin Province, China, and is an excellent clonal grafting mother tree. Immature Korean pine cones (proembryo stage) were collected from the seed orchard and disinfected by soaking in 75% (v / v) ethanol for 1 hour. Subsequently, under sterile conditions in a laminar flow hood, the seed scales and outer seed coat were peeled off, and the disinfected, intact kernels were placed on DCR induction medium. Embryogenic callus tissue grew after approximately 2 months of dark culture. The embryogenic callus tissue was transferred to subculture proliferation medium and subcultured every 14 days on solid proliferation medium. Proliferation culture was carried out in a dark environment at (25±1)℃.

[0060] The DCR induction medium consisted of: 400 mg / L NH4NO3, 340 mg / L KNO3, 556 mg / L CaNO3·4H2O, 170 mg / L KH2PO4, 370 mg / L MgSO4·7H2O, 85 mg / L CaCl2·2H2O, 6.2 mg / L KI, 22.3 mg / L H3BO3, 8.6 mg / L MnSO4·H2O, 0.25 mg / L ZnSO4·7H2O, 0.83 mg / L Na2MoO4·2H2O, 0.025 mg / L CuSO4·5H2O, 0.025 mg / L CoCl2·6H2O, 0.25 mg / L NiCl, 1 mg / L inositol, 0.5 mg / L Vitamin B1, 0.5 mg / L Vitamin B6, 0.2 mg / L niacin, and 200 mg / L... Glycine, 37.3 mg / L Na2·EDTA, 27.8 mg / L FeSO4·7H2O, 2 mg / L naphthaleneacetic acid (NAA), 1.5 mg / L 6-benzylaminopurine (6-BA), 30 g / L sucrose, 0.5 g / L acid-hydrolyzed casein (CH), 0.5 g / L glutamine (Gln), 4 g / L gellan gum, pH=5.8.

[0061] Subculture proliferation medium: The basic medium was mLV medium (Coolaber, PML1631), supplemented with 2 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.5 mg / L 6-BA, 30 g / L sucrose, 0.5 g / L CH, 0.5 g / L Gln, 4 g / L gellan gum, pH=5.8.

[0062] (1) RNA was extracted from red pine embryonic callus according to the method of the OMEG Plant RNA Kit.

[0063] 1) Add 500 μL of RB Buffer and 10 μL of β-mercaptoethanol to the same 2 mL centrifuge tube.

[0064] 2) Place the proliferated red pine embryogenic callus in a pre-cooled mortar and grind it with liquid nitrogen. Take 0.1 g of powder and add it to the centrifuge tube in 1), and vortex mix for 1 min.

[0065] 3) Place the gDNA Filter column from the kit onto the collection tube, transfer the mixture from the centrifuge tube to the filter column, and centrifuge for 5 min.

[0066] 4) Take a new centrifuge tube, add the filtrate, and then add anhydrous ethanol at 0.5 times the volume. Vortex mix for 1 minute.

[0067] 5) Place the HiBind RNA column into the collection tube, add the mixture to the column, centrifuge for 1 minute and discard the effluent.

[0068] 6) Add 400 μL of RWF Buffer to the column, centrifuge for 1 minute, and then discard the waste liquid.

[0069] 7) Add 500 μL RNA Wash Buffer II, centrifuge for 1 minute to remove the liquid, repeat once, and then centrifuge the empty column for 2 minutes.

[0070] 8) Replace the filter column with a new 1.5 mL centrifuge tube, open the cap and let it stand at room temperature for 5 minutes.

[0071] 9) Add 50 μL of DEPC water to the filter column, let it stand at room temperature for 2 min, and then centrifuge for 1 min.

[0072] 10) Add the filtrate back to the filter column for a second elution, and store the eluted RNA at -80 °C.

[0073] (2) Red pine RNA was reverse transcribed into cDNA using the PrimeScript™ RT Master Mix method.

[0074] 1) Thaw the red pine RNA on ice and add the mixture (100 ng red pine RNA, 2 μL 8×g DNA digester Mix, and RNase-free water to 16 μL) to a sterile PCR tube.

[0075] 2) Incubate the above PCR tubes in a PCR instrument at 42°C for 2 min.

[0076] 3) Add 4 μL of 5X RT Premix to the above PCR tube and react in a PCR instrument (37℃ for 10 min; 85℃ for sec; store at 4℃).

[0077] 4) Store the reverse transcribed cDNA at -20 ℃.

[0078] (3) Obtain the coding sequence (CDS) of the target genes PkBBM1 (Pkor04G01364.1) and PkBBM2 (Pkor09G02530.1), and synthesize cloning primers accordingly, which are denoted as PkBBM1-F / R and PkBBM2-F / R, respectively.

[0079] PkBBM1-F (5'→3'):ATGGGGTCGGTGAACAATTG;

[0080] PkBBM1-R (5'→3'): TTAGGAATCATTCCATATACTGA;

[0081] PkBBM2-F (5'→3'):ATGGGGTCGACGAGCAATTG;

[0082] PkBBM2-R(5'→3'): TTATGTGTCGTTCCATACAG.

[0083] (4) Using red pine embryogenic callus cDNA as a template, and PkBBM1-F / R and PkBBM2-F / R as primers, according to PrimeSTAR... ® Follow the HS Premix instructions to perform PCR amplification. The reaction mixture is shown in Table 1, and the reaction procedure is shown in Table 2.

[0084] Table 1 PrimeSTAR ® HS Premix reaction system

[0085] .

[0086] Table 2 PrimeSTAR ® HS Premix Reaction Conditions

[0087] .

[0088] (5) Add 5 μL of 10×Loading buffer to the PCR stop solution and mix well. Perform 1.5% agarose gel electrophoresis (120 V, 30 min) to obtain single target bands of approximately 2640 bp and 2352 bp in size, respectively. Figure 3 The target fragment was cut under UV light, and the PCR product was then recovered and purified using a gel extraction kit. The coding sequence of PkBBM1, obtained from red pine embryogenic callus, is shown in SEQ ID No. 1, and the coding sequence of PkBBM2 is shown in SEQ ID No. 2.

[0089] Example 3: Activation Activity Analysis of PkBBM1 and PkBBM2

[0090] (1) Subcellular localization of proteins

[0091] The target band from Example 2 was recovered by gel extraction, and the recovered product was ligated into the pTOPO II-Blunt intermediate vector. The ligation product was transformed into competent cells, and the bacterial culture was then identified by PCR using the M13 universal primers. Positive bacterial cultures were selected for DNA sequencing, and plasmids were extracted. The resulting recombinant plasmids were named Blunt-PkBBM1 and Blunt-PkBBM2, respectively.

[0092] Using Blunt-PkBBM1 and Blunt-PkBBM2 plasmids as templates, PCR amplification was performed using primer pairs pFGC-eGFP-PkBBM1-F / R and pFGC-eGFP-PkBBM2-F / R, respectively. The amplification products were recovered and digested with enzymes. The fragments were then ligated to a linearized pFGC-eGFP vector using homologous recombinase, followed by transformation into competent *E. coli* cells. Clones that tested positive by PCR were selected for DNA sequencing verification. Figure 4 Both PkBBM1 and PkBBM2 proteins are located in the cell nucleus, consistent with the subcellular localization characteristics of transcription factors. After confirming the sequencing results were correct, the corresponding plasmids were extracted and named pFGC-eGFP-PkBBM1 and pFGC-eGFP-PkBBM2, respectively.

[0093] Table 3 Primer sequences used to connect the pFGC-eGFP vector to the PkBBM1 / PkBBM2 genes.

[0094] .

[0095] Agrobacterium carrying the plasmids 35S::GFP, 35S::PkBBM1-GFP, and 35S::PkBBM1-GFP were transiently infecting tobacco leaves, and the distribution pattern of green fluorescence was then detected. Results ( Figure 5 The results showed that in leaves transformed with 35S::GFP, green fluorescence was distributed throughout the entire cell; while in leaves transformed with 35S::PkBBM1-GFP and 35S::PkBBM1-GFP, GFP signal was detected only in the nuclear region, indicating that PkBBM1 and PkBBM2 proteins are localized in the nucleus. This result is consistent with the basic property of most transcription factors being localized in the nucleus.

[0096] (2) Protein transcription activation activity analysis

[0097] Using Blunt-PkBBM1 and Blunt-PkBBM2 plasmids as templates, PCR amplification was performed using primers pGBKT7-PkBBM1 F / R and pGBKT7-PkBBM2 F / R, respectively. The amplified PkBBM1 and PkBBM2 gene fragments were ligated into a linearized pGBKT7 vector, and then transformed into competent *E. coli* cells. Positive clones with correct bands were screened by colony PCR, and after DNA sequencing verification, the resulting recombinant plasmids were named pGBKT7-PkBBM1 and pGBKT7-PkBBM2, respectively.

[0098] Table 4 Primer sequences used to connect the pGBKT7 vector to the PkBBM1 / PkBBM2 genes

[0099] .

[0100] A yeast two-hybrid system was used for detection. The plasmids pGBKT7-PkBBM1, pGBKT7-PkBBM2, positive control, and negative control were transformed into Y2H-Gold competent yeast cells. The three transformed strains were plated on SD / -Trp and SD / -Trp / -His / -Ade / X-α-Gal plates, respectively, and incubated upside down at 30°C for 2–4 days. Colony growth was observed. Figure 6 The pGBKT7-PkBBM1, pGBKT7-PkBBM2, and positive control strains all grew on both SD / -Trp and SD / -Trp / -His / -Ade / X-α-Gal media, with the latter turning blue. The negative control grew only on SD / -Trp and not on the selection medium. Therefore, it was concluded that both PkBBM1 and PkBBM2 proteins possess transcriptional activation capabilities.

[0101] (3) Analysis of protein-binding cis-acting elements

[0102] The binding of high-frequency BBS elements in the PkBBM1 and PkBBM2 proteins was detected using a yeast one-hybrid assay. First, using the Blunt-PkBBM1 and Blunt-PkBBM2 plasmids as templates, PCR amplification was performed using primers pGADT7-Rec2-PkBBM1 F / R and pGADT7-Rec2-PkBBM2 F / R. Subsequently, the amplified PkBBM1 and PkBBM2 genes were ligated into the linearized pGADT7-Rec2 vector, respectively, to obtain the recombinant plasmids pGADT7-Rec2-PkBBM1 and pGADT7-Rec2-PkBBM2.

[0103] Table 5 Primers related to yeast single-hybrid assays

[0104] .

[0105] The pGADT7-Rec2-PkBBMs vector was co-transformed into Y187 yeast competent cells with two different pHis2-BBSs plasmids, respectively. Positive controls (pGADT7-Rec2-53 / pHis-53) and negative controls (pGADT7-Rec2-PkBBMs / pHis-53) were also established. Each yeast transformant was plated on two different media: SD / -His / -Leu / -Trp (basal medium) and the same medium supplemented with 60 mM 3-AT. The cells were incubated upside down at 30°C for 2–4 days, and colony growth was observed. Results ( Figure 7The results showed that on SD / -His / -Leu / -Trp plates, the positive control, negative control, and all three experimental yeast groups grew normally. However, on selection plates containing 60 mM 3-AT, the positive control and pGADT7-Rec2-PkBBMs / pHis2-BBSs transformants grew, but the negative control failed to grow. This indicates that the PkBBMs protein has the ability to bind to the BBS cis-elements.

[0106] In summary, PkBBM1 and PkBBM2 possess the core characteristics of typical transcription factors (nuclear localization, transcriptional activation, and DNA binding), laying the molecular foundation for subsequent functional studies.

[0107] Example 4: Expression patterns of PkBBM1 and PkBBM2 in callus tissue treated with different concentrations of BR

[0108] To investigate whether the transcriptional levels of PkBBM1 and PkBBM2 respond to BR (brassinolide, aldaddin, B425697) signaling, embryogenic callus (same as in Example 2) was cultured on proliferation media containing different concentrations of BR for 0 h, 0.5 h, 1 h, 3 h, 7 d, and 14 d. The material cultured for 14 days was then subjected to somatic embryo maturation culture. The relative expression levels of PkBBM1 and PkBBM2 were detected by qRT-PCR after collection.

[0109] The results are as follows Figure 8 As shown, without BR processing ( Figure 8 A) The expression levels of PkBBM1 and PkBBM2 remained relatively stable before 14 days during the proliferation phase, but peaked at 14 days. After the material was transferred to the maturation medium, the expression levels showed an increasing trend within 3 hours. After treatment with low concentrations of BR ( Figure 8 After B), during the proliferation phase, both PkBBM1 and PkBBM2 showed decreased expression levels at 1 h and 7 d, but still peaked at 14 d. The highest level of PkBBM1 was the same as that without BR treatment, but the highest level of PkBBM2 was lower than that of the material without BR treatment. After the material was transferred to the maturation medium, the expression level showed a trend of first decreasing and then increasing within 3 h, and the expression levels were lower than those of the material without BR treatment. After treatment with a moderate concentration of BR ( Figure 8 Following C), the expression levels of PkBBM1 and PkBBM2 during the proliferation phase showed a trend of first decreasing (0.5 h) and then increasing, with both peaking at 14 days below [value missing]. Figure 8The expression levels in A decreased by 23.27% and 75.50%, respectively. During the mature culture stage, both showed an upward trend, with peak values ​​higher than the material without BR treatment, increasing by 15.20% and 20.15%, respectively. After treatment with high concentrations of BR (… Figure 8 Following step D), the expression levels of PkBBM1 and PkBBM2 fluctuated repeatedly during the proliferation phase, but both showed an increase at 0.5 h and 3 h. Furthermore, at 1 h of maturation culture, their expression levels exhibited a sharp upward trend, followed by a rapid decline. This indicates that the expression of PkBBM1 and PkBBM2 is regulated in a concentration- and time-dependent manner by exogenous BR treatment. Under 0.75 mg / L BR treatment, the expression levels of both were significantly upregulated in the early stages of somatic embryo maturation culture, increasing by 15.20% and 20.15% respectively compared to the no-BR treatment; while high-concentration BR (2 mg / L) treatment led to a sharp fluctuation followed by a rapid decline in expression, indicating that appropriate BR concentrations can positively induce PkBBM expression.

[0110] Example 5: Construction of overexpression vectors for PkBBM1 and PkBBM2 genes in Korean pine

[0111] (1) Based on the coding region sequences of the PkBBM1 and PkBBM2 genes and the sequence characteristics of the pCambia1300-sGFP vector, seamless cloning primers containing vector homologous regions and BamHI restriction sites were synthesized (sequences are shown in Table 6). The bolded part is the vector homologous sequence, and the underline indicates the introduced restriction site.

[0112] Table 6. List of primers for PkBBM1 and PkBBM2 ligation to pCambia 1300 vector

[0113] .

[0114] (2) Using Blunt-PkBBMs plasmid as a template, the above-mentioned pCambia 1300-PkBBM1-F / R and pCambia1300-PkBBM2-F / R primers and high-fidelity DNA polymerase PrimeSTAR were used. ® Amplification was performed using HS Premix, and the PCR reaction system and procedure were the same as in Example 2.

[0115] (3) The above PCR products were separated by 1% agarose gel electrophoresis (120 V, 20~30 min), and the target DNA fragment was recovered by gel recovery kit.

[0116] (4) Simultaneously with the PCR reaction, the pCambia1300 expression vector was digested with BamHI restriction endonuclease (reaction system shown in Table 7) at 30℃ for 20-30 min. The digestion products were separated by 1% agarose gel electrophoresis (120 V, 20-30 min), and the linearized vector fragment was recovered.

[0117] Table 7 Enzyme digestion reaction system

[0118] .

[0119] (5) The target fragment obtained from the above gel recovery was ligated with the linearized vector using the Trelief™ SoSoo Cloning Kit homologous recombination kit. The reaction system is shown in Table 8.

[0120] Table 8 Connection Reaction System

[0121] .

[0122] (6) The ligation product was transformed into competent E. coli cells, and bacterial culture was identified by PCR using pCambia1300-F / R primers. Positive clones with correct electrophoresis were selected and sequenced using the same primers. Plasmids were extracted from the sequencing-correct bacterial cultures and transformed into Agrobacterium for genetic transformation of Pine callus. The resulting overexpression vectors were named p1300-PkBBM1 and p1300-PkBBM2, respectively.

[0123] Example 6: Cultivation of PkBBM1 and PkBBM2 overexpression cell lines of Korean pine

[0124] (1) Selection of explants: use embryogenic callus tissue (such as in Example 2) to proliferate 7-10 days of red pine embryogenic callus tissue.

[0125] (2) Preparation and resuspension of Agrobacterium: The plasmids p1300-PkBBM1 or p1300-PkBBM2 extracted in Example 5 were transformed into GV3101 Agrobacterium competent cells, and the Agrobacterium culture was expanded to OD. 600 When the OD value reaches 0.6, the bacterial suspension is centrifuged at 3000 g for 10 min at 4°C. The supernatant is discarded, and the bacterial cells are resuspended in red pine infection resuspension solution until the OD value is reached. 600 The pH reached 0.4-0.5. The red pine infection resuspension was prepared by adding 100 µM acetylsuccinone (AS) to mLV medium (Coolaber, PML1631) at pH 5.8.

[0126] (3) Infection, co-culture, and recovery culture: After 7-10 days of proliferation culture of embryogenic callus, 1 g of callus was placed in 100 mL of infection solution in a clean bench for 10 min. After infection, the bacterial solution was filtered through a 100-mesh metal cell sieve, and then the callus was gently transferred to a solid co-culture medium containing 100 μmol acetylsyl syringone with forceps. The medium was co-cultured at 25±2℃ in the dark for 2 days. After co-culture, the callus was washed three times with sterilization solution for 5 min each time, and the sterilization solution was dried using a vacuum filtration device. The material was then placed on recovery medium containing 200 mg / L cephalosporin and cultured for 7-14 days.

[0127] The components of the Korean pine co-culture medium are as follows: the basic medium is mLV medium, supplemented with 2 mg / L 2,4-D, 0.5 mg / L 6-BA, 30 g / L sucrose, 0.5 g / L CH, 0.5 g / L Gln, 100 µM acetylsylgenone (AS), 4 g / L gellan gum, pH=5.2.

[0128] The sterilization solution was a liquid mLV medium containing 200 mg / L cephalosporin.

[0129] The recovery culture medium consisted of: mLV medium as the basic medium, supplemented with 2 mg / L 2,4-D, 0.5 mg / L 6-BA, 30 g / L sucrose, 0.5 g / L CH, 0.5 g / L Gln, 200 mg / L cephalosporin (Cef), 4 g / L gellan gum, and pH=5.8.

[0130] (4) Screening culture: The callus material that has recovered to a normal growth state was transferred to a screening medium containing 200 mg / cephalosporin and 20 mg / hygromycin. Callus tissue that grows and proliferates well on the screening medium was picked and transferred to a new screening medium for further culture. The screening was repeated three times, with a screening subculture cycle of 14 days. Each cluster of normally growing callus tissue was numbered as a resistant cell line.

[0131] The screening medium consisted of the following components: the basic medium was mLV medium supplemented with 2 mg / L 2,4-D, 0.5 mg / L 6-BA, 30 g / L sucrose, 0.5 g / L CH, 0.5 g / L Gln, 200 mg / L Cef, 20 mg / L hygromycin (Hyg), 4 g / L gellan gum, and pH=5.8.

[0132] (5) DNA level identification of transgenic cell lines: The resistant callus tissue was transferred to normal proliferation medium for subculture, and genomic DNA was extracted from the resistant callus tissue according to the method of the OMEG Plant DNA Kit. Agrobacterium tumefaciens culture PCR identification was performed as follows. Figure 9 As shown in the figure. The results showed that all 8 PkBBM1 overexpression lines and 5 PkBBM2 overexpression lines amplified the target bands of the expected size.

[0133] (6) RNA level identification of transgenic cell lines: 0.1 g of RNA was extracted from each resistant callus tissue and reverse transcribed into cDNA. Using cDNA as a template, quantitative real-time PCR was performed according to the TB Green PCR kit. ® Prepare the reaction solution according to the Fast qPCR Mix instructions. Use 2 -∆∆ct The relative expression levels of PkBBM1 and PkBBM2 in resistant callus were calculated using a method similar to that used in GraphPad Prism 9.0.0. SPSS 19 was used for significance testing, and the results were graphically displayed using GraphPad Prism 9.0.0. For PkBBM1 and PkBBM2, the two cell lines with the highest expression increases were selected for subsequent overexpression analysis and named OE-BBM1-line number and OE-BBM2-line number, respectively. These transgenic cell lines were then subcultured and propagated for further experiments. The results are as follows: Figure 10 As shown.

[0134] The results showed that, compared with WT, all transgenic cell lines except OE-PkBBM1-7 and OE-PkBBM2-3 achieved overexpression of the PkBBM gene. Therefore, these four transgenic cell lines were selected for propagation and subsequent experiments. Among them, the expression level of PkBBMs was most significantly upregulated in transgenic cells OE-PkBBM1-1, OE-PkBBM1-2, OE-PkBBM2-1, and OE-PkBBM2-4, which were 11.81 times, 16.65 times, 14.15 times, and 21.03 times that of WT, respectively.

[0135] (7) Identification of protein levels in transgenic cell lines: A small amount of OE-pkBBM1 and OE-pkBBM2 transgenic callus tissue that had been cultured for 7 days was placed in a 1.5 mL centrifuge tube, and 500-1000 μL of deionized water was added. The tube was vortexed for 1 min to ensure that the callus tissue was evenly dispersed in the liquid. 20-50 μL of the liquid containing the callus cells was pipetted and dropped into the center of a glass slide. A coverslip was then gently placed on the slide to avoid air bubbles. The green fluorescence of the transgenic material was then observed and photographed under an LSM 800 high-resolution laser confocal microscope (inverted).

[0136] Because the vector pCambia 1300 carries the GFP marker gene, such as Figure 11A. Therefore, transgenes can be identified at the protein level by observing GFP fluorescence in transgenic callus tissue. WT, OE-PkBBM1, and OE-PkBBM2 transgenic callus tissues cultured for 7 days were pressed into temporary slides. The green fluorescence of the transgenic materials was observed and photographed under an LSM 8Pk00 high-resolution laser confocal microscope, with the results as follows: Figure 11 B. Previous laboratory studies have shown that Korean pine callus tissue does not exhibit spontaneous green fluorescence under 488 nm green fluorescent protein excitation wavelength, while the four transgenic cell lines emit green fluorescence under 488 nm excitation wavelength, indicating that the T-DNA fragment carrying the target gene has been successfully inserted into the Korean pine genome and successfully expressed.

[0137] Example 7: Statistical analysis and morphological observation of somatic embryos in transgenic cell lines

[0138] Transgenic callus tissues of OE-PkBBM1 and OE-PkBBM2, as well as wild-type materials from the same batch of subcultures, were subjected to somatic embryo maturation experiments. Well-preserved callus tissues were picked up and placed in tubes, and the tissue clumps were dispersed by pipetting. The mixture was poured into a Buchner funnel lined with filter paper, and vacuum dried until no water droplets remained. The filter paper was then transferred to solid maturation medium and cultured in the dark for 8 weeks.

[0139] The solid maturation medium consisted of the following components: the basic medium was mLV medium, supplemented with 68.4 g / L sucrose, 80 μmol / LABA, 0.5 g / L CH, 1 g / L activated carbon (AC), 0.5 g / L Gln, 0~1 μM brassinolide BR, and 12 g / L gellan gum, with a pH of 5.8.

[0140] The development of somatic embryos was observed and statistically analyzed at 2, 4, and 8 weeks of dark culture, respectively. Figure 12 Transgenic and wild-type embryos treated with 0 mg / L and 0.75 mg / L exogenous brassinolide, respectively, were matured and observed after 2 weeks of culture. The number of early somatic embryos (E-SE) and the size of the embryo head were counted for both wild-type and transgenic materials. At 4 weeks of culture, the number and size of somatic embryos were counted. At 8 weeks of culture, the number and size of cotyledonary embryos were counted. Figure 12 .

[0141] It can be seen that, after 2 weeks of mature culture, the number of early somatic embryos in the field of view of OE-PkBBM1 and OE-PkBBM2 transgenic materials was higher than that of WT. The number of early somatic embryos in the OE-PkBBM1 cell line increased by 59.06% and 30.69% respectively compared with WT, while the number in the OE-PkBBM2 cell line increased by 26.46% and 32.20% respectively compared with WT. After treatment with exogenous BR, consistent with the transgenic results, the size of the embryonic head in the field of view was increased compared with WT, and the embryonic head cells were more densely arranged. The number of early somatic embryos in WT treated with 0.75 mg / L BR increased by 16.54% compared with 0 mg / L BR, while the number of early somatic embryos in OE-PkBBM1 and OE-PkBBM2 transgenic cell lines increased by 37.13%, 37.04%, 31.07%, and 17.39% respectively. Figure 13 A).

[0142] After 4 weeks of somatic embryo maturation culture, both wild-type and transgenic cell lines reached the columnar embryo stage. The surface of the somatic embryo began to change from rough to smooth, and somatic embryo differentiation entered a critical stage. Compared with the wild-type, the somatic embryos of the transgenic cell lines were more compact, with clearer cotyledon and radicle apical structures. The number of columnar embryos in the OE-PkBBM1 cell line increased by 57.01% and 27.39% compared to WT, respectively, while the number in the OE-PkBBM2 cell line increased by 30.74% and 36.24% compared to WT, respectively. The number of columnar embryos in WT treated with 0.75 mg / L BR increased by 150.72% compared to 0 mg / L BR, while the number in the OE-PkBBM1 and OE-PkBBM2 transgenic cell lines increased by 85.85%, 103.04%, 95.30%, and 82.22%, respectively. Figure 13 B). After exogenous BR treatment, the length of the somatic embryos of the transgenic cell lines increased, and some cotyledon tips began to differentiate into cotyledons, such as OE-PkBBM2-1.

[0143] After 8 weeks of somatic embryo maturation culture, both wild-type and transgenic cell lines had completed the differentiation and morphogenesis of cotyledons, hypocotyls, and radicles. The number of somatic embryos in the OE-PkBBM1 cell line increased by 182.81% and 45.30% compared to the WT cell line, respectively, while the number of somatic embryos in the OE-PkBBM2 cell line increased by 60.27% and 54.61% compared to the WT cell line, respectively. The number of WT somatic embryos treated with 0.75 mg / L BR increased by 239.06% compared to those treated with 0 mg / L BR, while the number of OE-PkBBM1 and OE-PkBBM2 transgenic cell lines increased by 118.78%, 138.36%, 132.89%, and 112.93%, respectively. Figure 13 C).

[0144] In addition, transgenic PkBBM1 and PkBBM2 cells and BR treatment increased somatic embryo length. The somatic embryo length of the OE-PkBBM1 cell line increased by 45.44% and 32.65% compared to the WT cell line, respectively, while the somatic embryo length of the OE-PkBBM2 cell line increased by 45.21% and 38.98% compared to the WT cell line, respectively. The somatic embryo length of WT cells treated with 0.75 mg / L BR increased by 66.60% compared to those treated with 0 mg / L BR, while the OE-PkBBM1 and OE-PkBBM2 transgenic cell lines increased by 48.56%, 6.69%, 12.21%, and 10.87%, respectively. Figure 13 D).

[0145] Exogenous application of 0.75 mg / L BR and overexpression of PkBBMs showed a significant synergistic effect. BR treatment increased the number of wild-type somatic embryos by 239.06%; based on overexpression, BR further increased the number of somatic embryos by 112.93%–138.36%, and the length of somatic embryos by 6.69%–48.56%. This indicates that the combined application of BR and PkBBMs can maximize the yield and quality of somatic embryos.

[0146] Example 8: Determination of physiological indicators of wild-type and transgenic cell lines

[0147] Recent studies have shown that reactive oxygen species (ROS), especially hydrogen peroxide (H2O2), play a complex dual role as both signaling and stressors in the initiation, proliferation, differentiation, and maturation of embryogenic callus (SE). In previous laboratory studies, the H2O2 content in Korean pine embryogenic callus showed a trend of first decreasing and then increasing with culture time, reaching its lowest level at 7 days of culture.

[0148] H2O2 is a type of reactive oxygen species. Under the catalysis of catalase, it can rapidly react with DAB (3,3-diaminobenzidine tetrahydrochloride) to form a brownish-red compound, thereby localizing H2O2 in tissues. The results are as follows... Figure 14 As shown in the AE, wild-type cells stained a darker brown color, which was distributed throughout the entire callus mass. In contrast, OE-PkBBM1 and OE-PkBBM2 cell lines showed only sporadic staining on the surface of the callus, with a lighter color than the wild-type. OE-PkBBM1-1 showed the least staining. This indicates that overexpression of PkBBM1 and PkBBM2 can effectively reduce H2O2 within callus cells after 7 days of proliferation culture.

[0149] The activities of SOD, POD, and CAT enzymes, as well as the content of endogenous H2O2, in wild-type, OE-PkBBM1, and OE-PkBBM2 cell lines after 7 days of proliferation and culture were measured using a kit. The results are as follows: Figure 14As shown in FI, the enzyme activity efficiency of SOD, POD, and CAT and the H2O2 content of transgenic cell lines were all lower than those of wild type. Among them, the SOD enzyme activity efficiency of OE-PkBBM1-1 and OE-PkBBM2-1 cell lines was significantly lower than that of WT. Although the POD enzyme activity of all transgenic cell lines was lower than that of WT, it did not reach a significant level. The CAT enzyme activity of all transgenic cell lines was significantly lower than that of WT. Only the H2O2 content of OE-PkBBM1-1 cell line was significantly lower than that of WT.

[0150] The results showed that overexpression of PkBBMs reduced intracellular reactive oxygen species (ROS) levels and alleviated oxidative stress. DAB staining in transgenic cell lines was significantly lighter (wild-type showed dark brown staining throughout the callus, while transgenic lines only showed scattered light staining on the surface), and H2O2 content was significantly reduced (OE-PkBBM1-1 showed a significant level). The activities of SOD, POD, and CAT antioxidant enzymes were generally lower than those in wild-type cells, with CAT activity significantly reduced in all transgenic lines. This indicates that PkBBMs protect embryogenic cell viability and slow down embryogenic degeneration by maintaining ROS homeostasis.

Claims

1. A highly efficient somatic embryogenesis method for Korean pine based on PkBBMs genes, characterized in that, It includes the following steps: (1) Preparation of embryogenic callus: Immature cones of Korean pine were collected, disinfected with 75% alcohol, and whole kernels were placed on DCR induction medium and cultured in the dark until embryogenic callus grew. (2) Preparation of PkBBMs overexpression vector of Korean pine: The PkBBMs gene of Korean pine was ligated to the vector to construct the overexpression vector; (3) Preparation and resuspension of Agrobacterium: The overexpression vector was transformed into competent Agrobacterium cells, and the Agrobacterium culture was expanded. The obtained culture was centrifuged at 4°C, the supernatant was discarded, and the cells were resuspended in red pine infection resuspension solution to OD. 600 When the concentration reaches 0.4-0.5, the inoculum is obtained; (4) Infection, co-culture and recovery culture: After 7-10 days of proliferation culture of embryogenic callus, the callus was taken in a clean bench and placed in the infection solution for infection. Then, the bacterial solution was filtered using a 100-mesh metal cell sieve. The callus was then transferred to a solid co-culture medium with forceps and co-cultured at 25±2℃ in the dark for 2 days. After co-culture, the callus was washed with sterilization solution, the sterilization solution was dried using a vacuum filter, and the material was placed on recovery culture medium for 7-14 days. (5) Screening culture: The callus material that has recovered to the normal growth state is transferred to the screening culture medium. The callus that grows and proliferates well on the screening culture medium is picked and transferred to a new screening culture medium for continued culture. The screening is repeated three times, and the screening subculture cycle is 14 days. (6) Maturation culture: Take a well-preserved callus and place it in a tube. Blow and blow to disperse the tissue clumps. Pour the mixture into a Buchner funnel lined with filter paper. Vacuum dry until there are no water droplets. Transfer the filter paper to a solid maturation culture medium and incubate in the dark for 4-8 weeks.

2. The method for efficient somatic embryogenesis of Korean pine based on PkBBMs genes according to claim 1, characterized in that, In step (1), the DCR induction medium components include: 400 mg / L NH4NO3, 340 mg / L KNO3, 556 mg / L CaNO3·4H2O, 170 mg / L KH2PO4, 370 mg / L MgSO4·7H2O, 85 mg / L CaCl2·2H2O, 6.2 mg / L KI, 22.3 mg / L H3BO3, 8.6 mg / L MnSO4·H2O, 0.25 mg / L ZnSO4·7H2O, 0.83 mg / L Na2MoO4·2H2O, 0.025 mg / L CuSO4·5H2O, 0.025 mg / L CoCl2·6H2O, 0.25 mg / L NiCl, 1 mg / L inositol, 0.5 mg / L Vitamin B1, 0.5 mg / L Vitamin B6, and 0.2 mg / L... Niacin, 200 mg / L glycine, 37.3 mg / L Na2·EDTA, 27.8 mg / L FeSO4·7H2O, 2 mg / L naphthaleneacetic acid, 1.5 mg / L 6-benzylaminopurine, 30 g / L sucrose, 0.5 g / L acid-hydrolyzed casein, 0.5 g / L glutamine, 4 g / L gellan gum, pH=5.

8.

3. The method for efficient somatic embryogenesis of Korean pine based on PkBBMs genes according to claim 1, characterized in that, In step (2), the nucleotide sequence of the Korean pine PkBBMs gene is shown in SEQ ID No.1 or SEQ ID No.

2.

4. The method for efficient somatic embryogenesis of Korean pine based on PkBBMs genes according to claim 1, characterized in that, In step (3), the red pine infection resuspension is: mLV medium with 100 µM acetylsuccinone added, pH=5.

8.

5. The method for efficient somatic embryogenesis of Korean pine based on PkBBMs genes according to claim 1, characterized in that, In step (4), the components of the Korean pine co-culture medium are as follows: the basic culture medium is mLV medium, with the addition of 2 mg / L 2,4-dichlorophenoxyacetic acid, 0.5 mg / L 6-benzylaminopurine, 30 g / L sucrose, 0.5 g / L acid-hydrolyzed casein, 0.5 g / L glutamine, 100 µM acetylsylgenone, 4 g / L gellan gum, and pH=5.

2.

6. The method for efficient somatic embryogenesis of Korean pine based on PkBBMs genes according to claim 1, characterized in that, In step (4), the recovery culture medium consists of the following components: the basic culture medium is mLV medium, with the addition of 2 mg / L 2,4-dichlorophenoxyacetic acid, 0.5 mg / L 6-benzylaminopurine, 30 g / L sucrose, 0.5 g / L acid-hydrolyzed casein, 0.5 g / L glutamine, 200 mg / L cephalosporin, 4 g / L gellan gum, and pH=5.

8.

7. The method for efficient somatic embryogenesis of Korean pine based on PkBBMs genes according to claim 1, characterized in that, In step (5), the screening medium consists of the following components: the basic medium is mLV medium, with the addition of 2 mg / L 2,4-dichlorophenoxyacetic acid, 0.5 mg / L 6-benzylaminopurine, 30 g / L sucrose, 0.5 g / L acid-hydrolyzed casein, 0.5 g / L glutamine, 200 mg / L cephalosporin, 20 mg / L hygromycin, 4 g / L gellan gum, and pH=5.

8.

8. The method for efficient somatic embryogenesis of Korean pine based on PkBBMs genes according to claim 1, characterized in that, In step (6), the solid maturation culture medium consists of the following components: the basic culture medium is mLV medium, with the addition of 68.4 g / L sucrose, 80 μmol / L abscisic acid, 0.5 g / L acid-hydrolyzed casein, 1 g / L activated carbon, 0.5 g / L glutamine, 0~0.75 mg / L brassinolide BR, 12 g / L gellan gum, and pH=5.

8.

9. The method for efficient somatic embryogenesis of Korean pine based on PkBBMs genes according to claim 8, characterized in that, In step (6), the brassinolide BR in the solid maturation medium is 0.75 mg / L.

Images