Plant cold-tolerant protein SbPLD alpha 3 and application thereof

Abstract

The application discloses a plant low-temperature tolerance protein SbPLD alpha 3 and application, and belongs to the technical field of plant genetic engineering. The protein provided by the application is named as SbPLD alpha 3 protein. The amino acid sequence of the SbPLD alpha 3 is shown in the amino acid sequence of SEQ ID NO. 7. The application further provides the application of overexpressing the plant low-temperature tolerance protein SbPLD alpha 3, or a gene coding the protein SbPLD alpha 3, or a biological material containing the plant low-temperature tolerance protein SbPLD alpha 3 coding gene in improving the cold resistance of plants, or the application in breeding cold-resistant transgenic plants, or the application in improving plant cold-resistant germplasm resources and the like. The application has application value for researching the low-temperature resistance mechanism of plants and cultivating low-temperature tolerance or low-temperature sensitive plants, and has application prospect for plant breeding.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a plant low-temperature resistant protein SbPLDα3 and its applications. Background Technology

[0002] Because plants cannot move and have been subjected to adverse natural environments for a long time, they have evolved complex and efficient response mechanisms. This response begins with responding to and transmitting environmental signals, and then makes adaptive adjustments at the molecular, cellular, and physiological levels, eventually forming a regulatory network to resist abiotic stress.

[0003] Phospholipase D (PLD) is the first key enzyme catalyzing the hydrolysis of phospholipids, participating in membrane lipid construction and signal transduction processes in cells. Under abiotic and biotic stresses such as low temperature, drought, nutrient deficiency, and pathogen infection, phosphatidic acid (PA) produced by PLD hydrolysis of phospholipids can induce a series of proteases to trigger cellular physiological responses, mediating cellular responses to stimuli. Different PLD genes participate in different stress response processes, exhibiting unique and overlapping functions. Therefore, PLD has broad application prospects in improving plant stress resistance. In crop stress resistance breeding, by transferring or editing corresponding genes, crops can acquire more efficient stress resistance.

[0004] Different types of phospholipase D play different roles in regulating plant growth and stress response. Currently, there are no reports on the low-temperature response of sorghum phospholipase D. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide a plant cold-resistance protein SbPLDα3 and its application, providing an important theoretical basis for in-depth analysis of the cold resistance mechanism of sorghum and elucidating the regulatory role of the phospholipase D gene in plant cold resistance adaptation.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a plant cold-resistance protein SbPLDα3, wherein the amino acid sequence of SbPLDα3 is as follows: (1) The amino acid sequence as shown in SEQ ID NO.7; or (2) An amino acid sequence that still has cryogenic regulation function after the amino acid sequence shown in (1) has been replaced, deleted, and / or inserted one or more amino acids; or (3) An amino acid sequence derived from sorghum that has more than 95% identity with (1) and still possesses low-temperature regulation function; or (4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence of (1) or (2) or (3).

[0007] The protein can be synthesized artificially or obtained by first synthesizing its encoding gene and then expressing it biologically; the amino acid sequence of the tag is shown in SEQ ID NO.9.

[0008] The gene encoding the SbPLDα3 protein in this invention is named the SbPLDα3 gene, and the nucleotide sequence of the gene is as follows: (1) A nucleotide sequence as shown in SEQ ID NO:8; or (2) A nucleotide sequence that is completely complementary to the nucleotide sequence shown in SEQ ID NO:8; or (3) A nucleotide sequence having ≥75% identity with the nucleotide sequence shown in SEQ ID NO:8 and encoding the aforementioned cryoprotective protein; or (4) Under strict conditions, it can hybridize with the nucleotide sequence shown in SEQ ID NO:8 and encodes the nucleotide sequence of the cryoresistant protein described above.

[0009] The stringent conditions were: hybridization in a 2×SSC, 0.1% SDS solution at 68°C with two washes of 5 min each, followed by hybridization in a 0.5×SSC, 0.1% SDS solution at 68°C with two washes of 15 min each.

[0010] The aforementioned 75% or more identity can be 80%, 85%, 90%, or 95% or more identity.

[0011] In a second aspect, the present invention provides the use of biological materials overexpressing the plant hypothermia protein SbPLDα3 described in the first aspect, or the gene encoding said protein SbPLDα3, or containing a gene encoding the plant hypothermia protein SbPLDα3, in any of the following: (1) Application in improving plant cold resistance; (2) Application in the breeding of cold-resistant transgenic plants; (3) Application in the improvement of cold-resistant plant germplasm resources; (4) Application in improving plant survival rate under low temperature conditions; (5) Application in constructing research models of plant low-temperature tolerance mechanisms; (6) Application in the preparation of experimental materials for low-temperature resistant plants.

[0012] In a third aspect, the invention relates to the application of overexpressing the plant hypothermia protein SbPLDα3 described in the first aspect, or the gene encoding the protein SbPLDα3, or biological materials containing the gene encoding the plant hypothermia protein SbPLDα3 in enhancing plant root length.

[0013] In a fourth aspect of the present invention, the application of overexpressing the plant hypothermia-resistance protein SbPLDα3 described in the first aspect above, or the gene encoding the protein SbPLDα3, or biological materials containing the gene encoding the plant hypothermia-resistance protein SbPLDα3, in improving the activity of plant antioxidant enzymes, reducing the content of plant cell membrane lipid peroxidation product MDA, or reducing plant electrolyte loss.

[0014] In a fifth aspect, the invention relates to the application of biomaterials that overexpress the plant hypothermia protein SbPLDα3 described in the first aspect, or the gene encoding the protein SbPLDα3, or containing the gene encoding the plant hypothermia protein SbPLDα3, in improving the accumulation of soluble sugars, enhancing water retention capacity, or strengthening NO signal transduction in plants.

[0015] Furthermore, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0016] Furthermore, the biological material is an expression cassette, a recombinant vector, a host cell, or a recombinant bacterium.

[0017] The recombinant vector can specifically be a recombinant expression vector. Existing expression vectors can be used to construct recombinant expression vectors containing the gene. When constructing a recombinant expression vector using the gene, any type of enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide. These can be used alone or in combination with other plant promoters. Furthermore, when constructing a recombinant expression vector using the gene, enhancers, including translational enhancers or transcriptional enhancers, can be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plants or transgenic microorganisms, the expression vector can be processed, such as by adding genes that express enzymes or luminescent compounds that produce color changes in plants or microorganisms, antibiotic resistance markers, or chemical reagent resistance marker genes. From a transgenic safety perspective, no selective marker genes can be added, and phenotypic screening can be performed directly.

[0018] The recombinant vector can specifically be: inserting a double-stranded DNA molecule into the multiple cloning site (e.g., the BamHI restriction site) of the pCambia2301 vector to obtain the recombinant plasmid pCambia2301-SbPLDα3.

[0019] In a sixth aspect, the present invention provides a method for improving the low-temperature tolerance of plants by increasing the expression level of the gene encoding the low-temperature tolerance protein SbPLDα3 in plants, the method comprising: (1) Transform a vector overexpressing the SbPLDα3 gene, which encodes the low-temperature tolerance protein, into plants using genetic engineering techniques; or (2) By using genetic engineering techniques, the promoter that regulates the expression of the gene encoding the cryoprotective protein SbPLDα3 is selected and modified to be a strong promoter; or (3) Increase the copy number of the gene encoding the low-temperature tolerance protein SbPLDα3 in plant chromosomes through genetic engineering; or (4) Introducing enhancers through genetic engineering; The amino acid sequence of the cryoresistant protein SbPLDα3 is shown in SEQ ID NO.7.

[0020] In a seventh aspect, the present invention provides a method for preparing low-temperature sensitive plants, wherein the expression level of the gene encoding the low-temperature tolerance protein SbPLDα3 in plants is reduced, the method comprising: (1) By using homologous recombination and CRISPR / Cas9 gene editing technology, the gene encoding the low-temperature resistance protein SbPLDα3 is disrupted or deleted from the plant genome, rendering it unable to be expressed; or (2) Using RNA interference technology, the expression of the gene encoding the cryoprotective protein SbPLDα3 is inhibited at the transcriptional or post-transcriptional level, thereby reducing its mRNA and protein levels; or (3) By means of genetic engineering, the promoter of the gene encoding the cryoprotective protein SbPLDα3 is replaced with a weak promoter or an inducible promoter; The amino acid sequence of the cryoresistant protein SbPLDα3 is shown in SEQ ID NO.7.

[0021] Furthermore, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0022] Furthermore, the dicotyledonous plant is specifically Arabidopsis thaliana; the Arabidopsis thaliana may specifically be Arabidopsis thaliana ecotype Colombia; the monocotyledonous plant is specifically a grass; the grass may specifically be rice, wheat, sorghum, millet, barley, or corn, preferably sorghum.

[0023] In summary, this invention provides a protein, SbPLDα3, associated with plant cold tolerance. Introducing the gene encoding SbPLDα3 into plants significantly enhances their resistance to low-temperature stress (improved ROS scavenging, osmotic regulation, and signal transduction capabilities, thus increasing cold tolerance). This invention has application value for studying plant cold tolerance mechanisms and cultivating cold-tolerant or cold-sensitive plants, and shows promising applications in plant breeding.

[0024] The beneficial effects of this invention include at least the following: (1) This invention is the first to discover and verify the low temperature regulation function of plant low temperature resistance protein SbPLDα3, filling the research gap of SbPLDα3 gene in the field of low temperature response, and providing a new key gene resource and theoretical basis for elucidating the molecular mechanism of plant cold resistance.

[0025] (2) This invention can enhance the resistance to low temperature in all aspects from the phenotypic and physiological levels by overexpressing the SbPLDα3 gene in the target plant: under low temperature stress, the transgenic plants have slight chlorosis of leaves, longer roots, and significantly reduced deformity damage; at the same time, it can significantly increase the activity of antioxidant enzymes such as SOD, CAT, and APX, reduce the content of MDA, a product of cell membrane lipid peroxidation, reduce electrolyte loss (relative conductivity reduction), and construct a multi-layer low temperature defense system by accumulating soluble sugars, improving water retention capacity, and enhancing NO signal transduction, effectively resisting the damage of low temperature to plants.

[0026] (3) This invention can cultivate low-temperature resistant transgenic crops by introducing the SbPLDα3 gene to address the yield reduction problem caused by low temperature stress and ensure crop yield and quality; it can also obtain low-temperature sensitive plants by introducing substances that inhibit the expression of this gene, providing ideal experimental materials for in-depth research on plant low-temperature resistance signaling pathways and regulatory networks.

[0027] (4) The gene function of the present invention has been fully verified, and the technical process of recombinant vector construction and Agrobacterium-mediated transformation is mature and controllable. The low temperature resistance regulation mechanism of the gene is conserved and can be widely used in the genetic improvement of various plants such as Arabidopsis thaliana and crops. It has broad breeding application prospects and has important practical significance for the agricultural stress-resistant breeding industry. Attached Figure Description

[0028] Figure 1 Phenotypic results of wild-type (WT) and SbPLDα3 transgenic plants after low-temperature treatment.

[0029] Figure 2 The results show the changes in antioxidant enzymes in wild-type (WT) and SbPLDα3 transgenic plants after low-temperature treatment.

[0030] Figure 3 The results show the changes in soluble sugars in wild-type (WT) and SbPLDα3 transgenic plants after low-temperature treatment.

[0031] Figure 4 The results show the changes in electrical conductivity of wild-type (WT) and SbPLDα3 transgenic plants after low-temperature treatment.

[0032] Figure 5 The results show the changes in signaling molecules in wild-type (WT) and SbPLDα3 transgenic plants after low-temperature treatment.

[0033] Figure 6 The results show the changes in water content of wild-type (WT) and SbPLDα3 transgenic plants after low-temperature treatment. Detailed Implementation

[0034] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0035] Furthermore, the technical solutions of the various embodiments of the present invention can be combined with each other, but only if they are feasible for those skilled in the art. If the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention.

[0036] Unless otherwise specified, the experimental methods used in the following embodiments of the present invention are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were all purchased from conventional biochemical reagent stores. All quantitative experiments in the following embodiments were performed in triplicate, and the results were averaged.

[0037] Columbia ecotype Arabidopsis thaliana, also known as wild-type Arabidopsis thaliana, is designated WT.

[0038] The plant expression vector pCambia2301, or pCambia2301 vector for short (is a conventional vector that can be purchased from multiple biotech companies, such as Beijing Coollife Technology Co., Ltd. and UBO Biotechnology).

[0039] The soil used in the examples refers to artificial soil (vermiculite:perlite:black soil = 1:1:3; volume ratio). Arabidopsis thaliana cultivation conditions: temperature 22±2℃, light intensity 400 μmol·m⁻²·s⁻¹, photoperiod 16h light / 8h dark, relative humidity 65-75%. Sorghum cultivation conditions: temperature 27℃, photoperiod 16h light / 8h dark, relative humidity 70-75%.

[0040] The following specific embodiments illustrate the solution proposed in this invention: Example 1: Low Temperature Stress SbPLDα3 Gene expression patterns in sorghum seedlings 1. Sorghum seedlings at the three-leaf-one-heart stage were treated in a 4℃ incubator. Leaf samples were taken at different treatment time points (0h, 12h, 24h, 72h), flash-frozen in liquid nitrogen, and stored at -80℃.

[0041] 2. Total RNA was extracted using the Axygen kit.

[0042] 3. Reverse transcription was performed using the Takala reverse transcription kit.

[0043] 4. Real-time quantitative PCR was performed using the Bio-Rad CFX96 Real-Time System. Sorghum ACTIN was used as the internal reference gene for qRT-PCR. Relative expression levels were determined using 2... -△△CT Method calculation. SbPLDα3 Gene expression levels at 0h were set to 1, and relative expression levels at other time points were calculated. Each sample underwent three independent biological replicates, with each replicate undergoing three technical replicates.

[0044] Used for detection SbPLDα3 The primer pairs for the gene are as follows: SbPLDα3-RT-F: 5'-TGAGAGTGTGGAGTGTGTGC-3' (SEQ ID NO. 1); SbPLDα3-RT-R: 5'-GTGGTGAGGATGGGTGGAAG-3' (SEQ ID NO. 2).

[0045] The primer pairs used to detect the Actin1 gene are as follows: Actin-F: 5'- ACGGCCTGGATGGCGACGTACATG-3' (SEQ ID NO. 3); Actin-R: 5'- GCAGAAGGACGCCTACGTTGGTGAC-3' (SEQ ID NO. 4).

[0046] SbPLDα3 See gene expression patterns under low temperature stress. Figure 1 .

[0047] After 12 hours of low temperature stress SbPLDα3 The gene expression level in sorghum seedling leaves was approximately 3.5 times that at 0 h; after 24 h of low-temperature stress, SbPLDα3 The gene expression level in sorghum seedling leaves was approximately 1.5 times that at 0 h; after 72 h of low-temperature stress, SbPLDα3 The gene expression level in sorghum seedling leaves was approximately four times that at 0h. The results indicate that in sorghum seedlings... SbPLDα3 The gene can be induced to express to varying degrees by low temperature, indicating that the SbPLDα3 protein is an important regulator in the process of sorghum adapting to abiotic stress.

[0048] Example 2: Obtaining Transgenic Plants I. Construction of Recombinant Plasmids Will SbPLDα3 The double-stranded DNA molecule of the gene was inserted into the BamHI restriction site of the pCambia2301 vector to obtain the recombinant plasmid pCambia2301-SbPLDα3, which was then sequenced for verification.

[0049] II. Obtaining Transgenic Arabidopsis 1. The recombinant plasmid pCambia2301-SbPLDα3 was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was suspended in a solvent to obtain OD. 600nm Infection solution with a pH of 0.6-0.8. Solvent: Contains 5 g / 100 mL glucose, 100 μMAS, 100 μL / L Triton X-100, 0.02% Silwet L-77, 2 ng / L 6-BA, with the balance being water.

[0050] 2. Take Colombian ecotype Arabidopsis plants, immerse the inflorescence in the infection solution for 10 seconds, and after 10 minutes, immerse the inflorescence in the infection solution again for 10 seconds. Then place the plants flat in a tray (cover with plastic wrap to keep them moist) and incubate in the dark for 24 hours.

[0051] 3. Take the plants that have completed step 2, culture them normally for 2 days, then immerse the inflorescences in the infection solution again for 10 seconds, then place the plants flat in a tray (cover with plastic wrap to keep them moist), and culture them in the dark for 24 hours.

[0052] 4. After completing step 3, cultivate the plants normally. Collect the seeds after the fruit pods mature, which are the T1 generation seeds.

[0053] 5. Take the seeds obtained in step 4, disinfect them with 75% alcohol and 10% sodium hypochlorite, and sow them on 1 / 2 MS medium plates containing 40 mg / L kanamycin. Vernalize at 4℃ for 2 days, and then culture at 22±2℃ under light for 5-7 days.

[0054] 6. After completing step 5, transplant the seedlings whose leaves have grown to be green and do not turn yellow into soil and cultivate them until harvesting seeds, i.e., T2 generation seeds.

[0055] 7. Take the seeds obtained in step 6, disinfect them, and culture them on a 1 / 2 MS culture plate containing kanamycin (40 mg / L). Select a line with a positive to negative ratio of 3:1 and culture it until the seeds mature, i.e., T3 generation seeds.

[0056] 8. Collect T3 generation seeds from individual plants, disinfect them, and then culture them on 1 / 2 MS plates containing kanamycin (40 mg / L). The lines that do not show resistance segregation are positive homozygous lines. Transfer them to soil and culture them at room temperature.

[0057] 9. After completing step 8, randomly select leaves from positive plants, extract DNA, and perform PCR amplification (Taq enzyme from Nanjing Novizan Biotech). The amplification products are then detected by electrophoresis and compared with the vector plasmid containing the target gene for confirmation, thus identifying positive seedlings. The primers consist of the upstream of the vector fragment (approximately 100 bp of the 35S promoter) and the downstream of the target gene, approximately 1900 bp.

[0058] 35S-F: GACGCACAATCCCACTATCC (SEQ ID NO.5); SbPLDα3-R2: TCAAGCCATCCTTCTTAAGC (SEQ ID NO. 6).

[0059] PCR reaction mixture (total 20 μl): ddH2O 8 μl; 2×Taq Master Mix 10 μL; template DNA 1 μl; primers (10 μM) 1 μl. PCR reaction program: pre-denaturation 95℃ for 5 min, denaturation 95℃ for 30 s, annealing 55℃ for 30 s, extension 72℃ for 60 s, 34 cycles, extension 72℃ for 5 min.

[0060] Two homozygous transgenic lines, OEα-01 (overexpressing α-01) and OEα-02 (overexpressing α-02), were randomly selected for identification in Example 3.

[0061] Example 3: Identification of Transgenic Plants In this embodiment, a -4°C low-temperature stress environment was created using a low-temperature incubator (under laboratory conditions).

[0062] 1. Seedling phenotypic observation experiment Seeds tested: T3 generation seeds of OEα-01 strain, T3 generation seeds of OEα-02 strain, and seeds of wild-type Arabidopsis thaliana.

[0063] The tested seeds were sterilized, and then sown separately in artificial soil and 1 / 2 MS medium plates. Seedlings in the soil were cultured until homogeneous and then placed at -4℃ for 7 days. Seedlings in the medium were cultured until the three-leaf stage and then placed at -4℃ for 7 days. Phenotypic traits were photographed and observed on the 7th day after the low-temperature treatment.

[0064] Phenotypic traits are shown in the figure. Figure 1After low-temperature treatment, both wild-type and transgenic lines experienced varying degrees of stress. Wild-type Arabidopsis thaliana leaves accumulated large amounts of anthocyanins, turning dark purple, while the transgenic lines were less affected by the low temperature, showing only slight chlorosis in their leaves and a slight anthocyanin accumulation phenotype in new leaves. Their growth status remained largely unchanged from the 0h time. In the culture medium, after low-temperature treatment, the root length of the transgenic lines was significantly greater than that of the wild-type.

[0065] 2. Measurement of various physiological indicators Seeds tested: T3 generation seeds of OEα-01 strain, T3 generation seeds of OEα-02 strain, and seeds of wild-type Arabidopsis thaliana.

[0066] (1) Assay of superoxide dismutase (SOD) activity The tested seeds were sterilized and sown in soil. Two pots were used for each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana, with four plants in each pot, and the plants were cultured for three weeks. One pot from each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana was placed at -4℃ for 24 hours, while the remaining plants were cultured at room temperature for 24 hours. Leaf samples were taken from all treatments for superoxide dismutase activity determination.

[0067] For the method of detecting superoxide dismutase activity, please refer to the following literature: Wang, YC, Gao, CQ, Liang, YN, Wang, C., Yang, CP, and Liu, GF (2010). A novel bZIP gene from Tamarix hispida mediates physiological responses to salt stress in tobaccoplants. J. Plant Physiol. 167, 222–230. doi: 10.1016 / j.jplph. 2009.09.008.

[0068] See results Figure 2 At room temperature, there was no significant difference in SOD activity between wild-type and transgenic lines (OE), indicating that the reactive oxygen species (ROS) scavenging capacity of each line was similar. After low-temperature stress, the SOD activity of wild-type plants decreased, while the SOD activity of transgenic lines increased significantly and was significantly higher than that of wild-type plants. This suggests that overexpression of the SbPLDα3 gene leads to enhanced ROS scavenging capacity in plants, thereby improving their stress resistance.

[0069] (2) Assay of catalase (CAT) activity The test seeds were sterilized and sown in soil. Two pots were used for each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana, with four plants in each pot, and the plants were cultured for three weeks. One pot from each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana was placed at -4°C for 24 hours, while the remaining plants were cultured at room temperature for 24 hours. Leaf samples were taken from all treatments for catalase activity assay.

[0070] For the method of detecting catalase activity, please refer to the following literature: Velikova V, Yordanov I, Edreva A. Oxidative stress and some antioxidant systems in acid rain-treated beanplants: protective role of exogenous polyamines[J]. Plant science, 2000, 151(1):59-66. See results Figure 2 At room temperature, there was no significant difference in CAT activity between wild-type and transgenic lines (OE). However, after low-temperature treatment, the CAT activity of all materials increased to varying degrees. The CAT activity of transgenic lines increased significantly and was significantly higher than that of wild-type. This indicates that overexpression of the SbPLDα3 gene enhances the plant's ability to scavenge reactive oxygen species, thereby improving its stress resistance.

[0071] (3) Assay for ascorbate peroxidase (APX) activity The tested seeds were sterilized and sown in soil. Two pots were used for each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana, with four plants in each pot, and the plants were cultured for three weeks. One pot from each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana was placed at -4°C for 24 hours, while the remaining plants were cultured at room temperature for 24 hours. Leaf samples were taken from all treatments for ascorbate peroxidase activity assay.

[0072] For the method of detecting ascorbate peroxidase activity, please refer to the following literature: Murshed R, Lopez-Lauri F, Sallanon H. Microplate quantification of enzymes of the plant ascorbate–glutathione cycle[J]. Analytical Biochemistry, 2008, 383(2):320-322. See results Figure 2At room temperature, there was no significant difference in APX activity between wild-type and transgenic lines (OE), but low-temperature treatment significantly induced an increase in APX activity in transgenic lines, which was significantly higher than that in wild-type. This indicates that overexpression of the SbPLDα3 gene leads to enhanced plant scavenging capacity for reactive oxygen species, thereby improving stress resistance.

[0073] (4) Determination of malondialdehyde (MDA) content Malondialdehyde (MDA) is one of the most important products of cell membrane lipid peroxidation, and its production damages the cell membrane. Therefore, it is a commonly used physiological indicator for measuring plant senescence and stress resistance.

[0074] The tested seeds were sterilized and sown in soil. Two pots were used for each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana, with four plants in each pot, and the plants were cultured for three weeks. One pot from each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana was placed at -4℃ for 24 hours, while the remaining plants were cultured at room temperature for 24 hours. Leaf samples were taken from all treatments for malondialdehyde (MDA) content determination.

[0075] For the method of detecting malondialdehyde content, please refer to the literature: DRAPERH H: Malondialdehyde determination as index of lipid peroxidation[J]. Methods in Enzymology, 1989, 186. See results Figure 2 At room temperature, there was no significant difference in MDA content between wild-type and transgenic lines (OE). However, low-temperature treatment significantly stimulated an increase in MDA content in all plant materials. The MDA content of wild-type Arabidopsis thaliana was significantly higher than that of transgenic lines after low-temperature treatment, and the increase was the largest. This indicates that wild-type plants suffered the most severe cell membrane damage when subjected to low-temperature stress. Furthermore, it shows that overexpression of the SbPLDα3 gene enhances the plant's resistance to low temperatures by reducing cell damage.

[0076] (5) Determination of soluble sugar content Soluble sugars are important osmotic regulators in plants. They increase cell sap concentration, lower the cell freezing point, and prevent cell dehydration or freezing. Therefore, they are a commonly used physiological indicator for measuring plant stress resistance.

[0077] The test seeds were sterilized and sown in soil. Two pots were used for each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana, with four plants in each pot, and the plants were cultured for three weeks. One pot from each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana was placed at -4℃ for 24 hours, while the remaining plants were cultured at room temperature for 24 hours. Leaf samples were taken from all treatments for soluble sugar content determination.

[0078] For the method of detecting soluble sugar content, please refer to the following literature: Buysse J, Merckx R. An improved colorimetric method to quantify sugar content of plant tissue[J]. Journal of Experimental Botany, 1993, 44(10):1627-1629. See results Figure 3 At room temperature, the soluble sugar content of wild-type plants was significantly lower than that of transgenic lines. After low-temperature treatment, the soluble sugar content of both wild-type and transgenic lines increased significantly, and the soluble sugar content of transgenic lines was significantly higher than that of wild-type controls. This indicates that overexpression of the SbPLDα3 gene reduces the risk of cell dehydration or freezing by increasing soluble sugar content, thereby increasing low-temperature resistance.

[0079] (6) Measurement of relative conductivity Relative conductivity is an important indicator for measuring the integrity of plant cell membranes. When plants are damaged or under adverse stress conditions, the cell membrane is easily damaged, leading to the leakage of cytoplasmic sap and the loss of electrolytes, which increases the relative conductivity.

[0080] The tested seeds were sterilized and sown in soil. Two pots were used for each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana, with four plants in each pot, and the plants were cultured for three weeks. One pot from each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana was placed at -4°C for 24 hours, while the remaining plants were cultured at room temperature for 24 hours. Leaf samples were taken from all treatments for relative conductivity measurement.

[0081] For methods of detecting relative conductivity, please refer to the following literature: Lutts S, Kinet JM, Bouharmont J. 1996. NaCl-induced senescence in leaves of rice (Oryza sativa L.) cultivars differing in salinity resistance. Annals of Botany, 78, 389-398.

[0082] See results Figure 4 Under normal conditions, the relative electrical conductivity of all plant lines was low. Low-temperature treatment significantly increased the electrical conductivity of both wild-type and transgenic lines, with the conductivity of the wild-type control being significantly higher than that of the transgenic lines. This indicates that the wild-type control plants suffered more severe low-temperature damage, while the lines overexpressing the SbPLDα3 gene showed relatively less cell membrane damage and stronger adaptability to low temperatures.

[0083] (7) Ca 2+ Concentration Measurement Ca 2+ Ca2+ is an important second messenger in plant signal transduction, playing a crucial role in plant growth, development, and stress response. When plants face stress, free Ca2+ in the cytoplasm... 2+ The concentration can rise instantaneously, thereby triggering various biochemical reactions within the cells. Therefore, it is a commonly used physiological indicator for measuring plant stress resistance.

[0084] The tested seeds were sterilized and sown in soil. Two pots were used for each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana lines, with four plants per pot, and the plants were cultured for three weeks. One pot from each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana lines was placed at -4°C for 24 hours, while the remaining plants were cultured at room temperature for 24 hours. Leaf samples were taken from all treatments for Ca2+ analysis. 2+ Concentration determination.

[0085] Ca 2+ Concentration detection utilized Ca, developed by the Haimen Biotech Research Institute in China. 2+ The test kit was used.

[0086] See results Figure 5 At room temperature, the calcium content in wild-type and transgenic plants... 2+ No significant differences were observed in the Ca content of each plant after low-temperature treatment. 2+ Concentrations increased in all cases, but the differences were not statistically significant. Overall, the Ca concentrations in the transgenic lines... 2+ The content was higher than that of the wild type, indicating that overexpression of the SbPLDα3 gene is beneficial to improve the ability to resist low temperatures.

[0087] (8) Determination of NO content NO is a key signaling molecule in plants' response to stress, and changes in its content are directly related to the initiation, regulation, and tolerance of plant stress responses. Therefore, it is a commonly used physiological indicator for measuring plant stress resistance.

[0088] The tested seeds were sterilized and sown in soil. Two pots were used for each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana strains, with four plants in each pot, and the plants were cultured for three weeks. One pot from each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana strains was placed at -4°C for 24 hours, while the remaining plants were cultured at room temperature for 24 hours. Leaf samples were taken from all treatments for NO content determination.

[0089] NO levels were detected using a NO detection kit developed by the Biotech Institute of Haimen, China.

[0090] See results Figure 5 At room temperature, the NO content of wild-type plants and transgenic plants was not significantly different. Low temperature treatment significantly inhibited NO production in wild-type plants, while significantly inducing NO signaling in transgenic plants, and the NO content was significantly higher than that in wild-type control plants. This indicates that overexpression of the SbPLDα3 gene improves the plant's resistance to low temperature stress by increasing NO content.

[0091] (9) Moisture content determination The tested seeds were sterilized and sown in soil. Two pots were used for each of the OEα-01, OEα-02, and wild-type Arabidopsis thaliana, with four plants per pot. After three weeks of cultivation, the seeds were placed in a -4℃ environment. At 0h, 1h, 2h, 3h, 4h, 5h, 6h, and 7h, 100-200mg of leaf samples were taken from each treatment plant, and the fresh weight (FW) was immediately recorded. The leaves were then dried in an 80℃ oven until constant weight, and the dry weight (DW) was recorded. The leaf water content at each time point was calculated as (FW - DW) / FW.

[0092] See results Figure 6 At room temperature (0 h), there was no significant difference in water content among the treatments. With prolonged low-temperature treatment, the water content of both wild-type and transgenic plants gradually decreased, with the wild-type Arabidopsis showing a faster rate of decrease. At each time point, the difference in water content between wild-type and transgenic plants reached a significant level. This indicates that low temperature causes water loss in Arabidopsis plants, and overexpression of the SbPLDα3 transgene can improve the plant's water retention capacity and reduce water loss under low-temperature conditions.

[0093] It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes that element.

[0094] The sequence numbers of the above embodiments of the present invention are for descriptive purposes only and do not represent the superiority or inferiority of the embodiments.

[0095] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A plant low-temperature resistant protein SbPLDα3, characterized in that, The amino acid sequence of SbPLDα3 is as follows: (1) The amino acid sequence as shown in SEQ ID NO.7; or (2) An amino acid sequence that still has cryogenic regulation function after the amino acid sequence shown in (1) has been replaced, deleted, and / or inserted one or more amino acids; or (3) An amino acid sequence derived from sorghum that has more than 95% identity with (1) and still possesses low-temperature regulation function; or (4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence of (1) or (2) or (3).

2. The use of overexpressing the plant hypothermia protein SbPLDα3 of claim 1, or the gene encoding said protein SbPLDα3, or biological material containing the gene encoding the plant hypothermia protein SbPLDα3, in any of the following: (1) Application in improving plant cold resistance; (2) Application in the breeding of cold-resistant transgenic plants; (3) Application in the improvement of cold-resistant plant germplasm resources; (4) Application in improving plant survival rate under low temperature conditions; (5) Application in constructing research models of plant low-temperature tolerance mechanisms; (6) Application in the preparation of experimental materials for low-temperature resistant plants.

3. The application of overexpressing the plant low-temperature tolerance protein SbPLDα3 as described in claim 1, or the gene encoding the protein SbPLDα3, or biological materials containing the gene encoding the plant low-temperature tolerance protein SbPLDα3 in improving plant root length.

4. The application of overexpressing the plant hypothermia protein SbPLDα3 as described in claim 1, or the gene encoding the protein SbPLDα3, or biological materials containing the gene encoding the plant hypothermia protein SbPLDα3 in improving the activity of plant antioxidant enzymes, reducing the content of plant cell membrane lipid peroxidation product MDA, or reducing plant electrolyte loss.

5. The application of overexpressing the plant hypothermia protein SbPLDα3 of claim 1, or the gene encoding the protein SbPLDα3, or biological materials containing the gene encoding the plant hypothermia protein SbPLDα3 in improving the accumulation of soluble sugars, enhancing water retention capacity, or strengthening NO signal transduction in plants.

6. The application according to any one of claims 2 to 5, characterized in that, The plant is a monocotyledonous plant or a dicotyledonous plant.

7. The application according to any one of claims 2 to 5, characterized in that, The biological material is an expression cassette, a recombinant vector, a host cell, or a recombinant bacterium.

8. A method for improving the low-temperature tolerance of plants, characterized in that, Methods to increase the expression level of the gene encoding the cold-resistance protein SbPLDα3 in plants include: (1) Transform a vector overexpressing the SbPLDα3 gene, which encodes the low-temperature tolerance protein, into plants using genetic engineering techniques; or (2) By using genetic engineering techniques, the promoter that regulates the expression of the gene encoding the cryoprotective protein SbPLDα3 is selected and modified to be a strong promoter; or (3) Increase the copy number of the gene encoding the low-temperature tolerance protein SbPLDα3 in plant chromosomes through genetic engineering; or (4) Introducing enhancers through genetic engineering; The amino acid sequence of the cryoresistant protein SbPLDα3 is shown in SEQ ID NO.

7.

9. A method for preparing low-temperature sensitive plants, characterized in that, Methods to reduce the expression level of the gene encoding the cold-resistance protein SbPLDα3 in plants include: (1) By using homologous recombination and CRISPR / Cas9 gene editing technology, the gene encoding the low-temperature resistance protein SbPLDα3 is disrupted or deleted from the plant genome, rendering it unable to be expressed; or (2) Using RNA interference technology, the expression of the gene encoding the cryoprotective protein SbPLDα3 is inhibited at the transcriptional or post-transcriptional level, thereby reducing its mRNA and protein levels; or (3) By means of genetic engineering, the promoter of the gene encoding the cryoprotective protein SbPLDα3 is replaced with a weak promoter or an inducible promoter; The amino acid sequence of the cryoresistant protein SbPLDα3 is shown in SEQ ID NO.

7.

10. The method according to claim 8 or 0, characterized in that, The plant is a monocotyledonous plant or a dicotyledonous plant.

Images