Tuf promoter, expression vector, lysine-producing strain and application thereof

Abstract

The application provides a tuf promoter, an expression vector, a lysine production strain and application thereof. The nucleotide sequence of the tuf promoter is shown in any one of SEQ ID NO: 2-6. The lysine production strain constructed by using the promoter can improve the transcription initiation efficiency, effectively enhances the lysine synthesis capacity in corynebacterium glutamicum, and provides an important promoter cis-regulatory element and engineering strategy for constructing a high-efficiency lysine production strain.

Description

Technical Field

[0001] This invention belongs to the fields of microbial genetic engineering and amino acid fermentation technology, specifically involving the construction of novel TUF promoters, recombinant vectors, engineered strains, and the fermentation production of L-lysine. Background Technology

[0002] L-Lysine (2,6-diaminohexanoic acid) is an essential amino acid that plays a crucial physiological role in animal growth, immune function, and nervous system health. It is primarily used in the feed, pharmaceutical, and food industries. Currently, microbial fermentation is the mainstream process for the large-scale production of L-lysine. *Corynebacterium glutamicum* (…) Corynebacterium glutamicum Due to its food safety grade (GRAS) certification, strong product secretion ability, good acid resistance, and easily engineered carbon flux, it has become the preferred host for industrial fermentation of lysine.

[0003] Transcription initiation, a critical rate-limiting step in gene expression, is highly dependent on the sequence structure of the promoter. The promoter determines the location of RNA polymerase and the formation of the transcription initiation complex, and the base composition and spatial conformation of its core elements (-10 region, -35 region, and spacer sequence) directly affect its strength. Single-base point mutations or short-fragment modifications can significantly alter the transcription rate, thereby regulating the mRNA abundance of downstream genes. Since mRNA levels directly determine the amount of translation template, rational promoter design can effectively improve the translation efficiency of target genes. This strategy does not alter the protein-coding sequence and has advantages such as minimal modification, low metabolic disturbance, and avoidance of introducing exogenous tags. However, the systematic and rational design and functional validation of promoters for key genes in the lysine synthesis pathway of Corynebacterium glutamicum are still insufficient. Therefore, developing novel promoter sequences that can efficiently enhance the transcription (and subsequent translation) of lysine synthesis-related genes has significant theoretical and applied value for overcoming the yield bottleneck of industrial strains. Summary of the Invention

[0004] On the one hand, this article provides an isolated promoter whose nucleotide sequence is shown in any one of SEQ ID NO: 2-6, or has promoter activity and has at least 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in any one of SEQ ID NO: 2-6.

[0005] Those skilled in the art will understand that homologous sequences with the high sequence identity described above, as described in SEQ ID NO: 2-6 of this invention, contain only a few base mutations, deletions, or insertions, and retain transcription initiation function completely or substantially completely. The series of mutant tuf promoters of this invention possess gradient transcriptional activity, which can be flexibly selected according to the expression needs of different genes, including both highly active and moderately active promoters, adapting to differentiated gene expression regulation strategies.

[0006] In some embodiments, the promoter comprises the nucleotide sequence shown in SEQ ID NO: 2.

[0007] In some embodiments, the promoter comprises the nucleotide sequence shown in SEQ ID NO: 3.

[0008] On the other hand, the present invention provides a gene expression cassette comprising the promoter described above.

[0009] In some implementations, the gene expression cassette also contains a target gene.

[0010] In some implementations, the target gene is aspB , dapA and dd .

[0011] On the other hand, the present invention provides an expression vector comprising the above-described promoter or the above-described gene expression cassette.

[0012] On the other hand, the present invention provides a host cell comprising the aforementioned promoter, gene expression cassette, or expression vector.

[0013] In some implementations, the host cell is a corynebacterium.

[0014] In some embodiments, the host cell is Corynebacterium glutamicum.

[0015] In some embodiments, the host cell is Corynebacterium glutamicum ATCC13032.

[0016] On the other hand, the present invention provides a method for producing a target product, comprising culturing the host cells in a culture medium and recovering the target product from the culture medium.

[0017] In some implementations, the target product is an amino acid.

[0018] In some embodiments, the target product is L-lysine.

[0019] On the other hand, the present invention provides the application of the above-mentioned promoter, gene expression cassette or expression vector in the construction of lysine-producing strains.

[0020] In some embodiments, the lysine-producing strain is Corynebacterium.

[0021] In some embodiments, the lysine-producing strain is Corynebacterium glutamicum.

[0022] On the other hand, the present invention provides the application of the above-mentioned promoter, gene expression cassette, expression vector or host cell in the fermentation production of lysine or to increase lysine yield.

[0023] In some implementations, the host cell is a corynebacterium.

[0024] In some embodiments, the host cell is Corynebacterium glutamicum.

[0025] On the other hand, the present invention provides a method for constructing a lysine-producing strain, comprising replacing the promoter of any one or more of the following genes of the starting strain with the promoters described above: aspB , dapA and dd .

[0026] In some implementations, the host cell is a corynebacterium.

[0027] In some implementations, the starting strain is Corynebacterium glutamicum.

[0028] In some embodiments, the starting strain is Corynebacterium glutamicum ATCC13032.

[0029] In some implementations, the aspB The nucleotide sequence of the gene is as shown in SEQ ID NO: 34 or has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 34; dapA The nucleotide sequence of the gene is shown in SEQ ID NO: 36, and has at least 85%, 90%, 95%, 96%, 97%, 98%, and 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 36; dd The nucleotide sequence of the gene is shown in SEQ ID NO: 38, and has at least 85%, 90%, 95%, 96%, 97%, 98%, and 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 38.

[0030] In some implementations, the aspBThe amino acid sequence of the protein produced by gene expression is as shown in SEQ ID NO: 35 or has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 35; dapA The amino acid sequence of the protein produced by gene expression is shown in SEQ ID NO: 37, and has at least 85%, 90%, 95%, 96%, 97%, 98%, and 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 37; dd The amino acid sequence of the protein produced by gene expression is shown in SEQ ID NO: 39, and has at least 85%, 90%, 95%, 96%, 97%, 98%, and 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 39.

[0031] This study focuses on Corynebacterium glutamicum and aims to enhance its lysine production capacity through genetic engineering. First, take the gene sequence of the tuf promoter (the sequence is agatcgtttagatccgaaggaaaacgtcgaaaagcaatttgcttttcgacgccccaccccgcgcgttttagcgtg tcagtaggcgcgtagggtaagtggggtagcggcttgttagatatcttgaaatcggctttcaacagcattgatttcgatgtatttagctggccgtt accctgcgaatgtccacagggtagctggtagtttgaaaatcaacgccgttgcccttaggattcagtaactggcacattttgtaatgcgctagatc tgtgtgctcagtcttccaggctgcttatcacagtgaaagcaaaaccaattcgtggctgcgaaagtcgtagccaccacgaagtccaggagga (seq ID NO: 1)) as the basis, using Salis Lab Promoter Calculator rationally designed and optimized the core region (-35 / -10) and UP element, obtaining multiple candidate promoter sequences. Functional verification showed that the sequence TTTTTATATATTATATTTTTTTTGACAAGCGCCCCACCCCGCGCGTTTTAGCGTGTCATATAATGGGGGTAGCGGCTTGTTAGATATC (SEQ ID NO: 2) exhibited the best expression enhancement effect and was the preferred optimized promoter sequence. The sequence TTTTTATATATTATATTTTTTTTGACAAGCTTTTCGACGCCCCACCCCGCGCGTTTTAGCGTGTCATATAATGGGGGTAGCGGCTTGTTAGATATC (SEQ ID NO: 3) also showed good expression enhancement effect and was selected as the second choice. Subsequently, the tuf promoter and the optimized promoter were integrated into the lysine synthesis pathway gene in the genome of the starting strain Lys-05 (Lys-05 strain in Example 1 of CN202610405633.3) using gene editing technology. aspB , give A and ddUpstream of the start codon ATG, a recombinant Corynebacterium glutamicum engineered strain was successfully constructed, exhibiting no plasmid, no growth defects, no need for induction, and good genetic stability. Shake-flask fermentation results showed that the lysine yields of the recombinant strain constructed using the optimized tuf promoter reached 5.17 g / L, 4.72 g / L, and 4.73 g / L, respectively, significantly higher than those of the original tuf promoter-expressing Corynebacterium glutamicum recombinant strains (4.39 g / L, 4.26 g / L, and 4.23 g / L).

[0032] The results showed that key mutations in the promoter sequence effectively enhanced lysine synthesis in Corynebacterium glutamicum by optimizing transcription initiation efficiency, providing an important promoter cis-regulatory element and engineering strategy for constructing efficient lysine-producing strains. Detailed Implementation

[0033] Unless otherwise stated, all technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art.

[0034] In this article, "promoter" refers to a cis-acting nucleic acid fragment located upstream of the transcription start site of a target gene. It can specifically bind to RNA polymerase and transcription factors, thereby initiating the transcription process of the downstream target gene. Based on its sequence characteristics, it can achieve constitutive, inducible, or specific expression of the target gene and regulate the transcriptional level of the gene. In prokaryotes, promoters typically include a shared sequence of the -35 region (TTGACA) and the -10 region (TATAAT).

[0035] In this article, the term "isolated" used to modify promoters means that the promoter sequence has been extracted and isolated from the genome of a natural organism, detached from its naturally adjacent nucleic acid sequences and intracellular environment, and is not present in the organism's genome in a natural state. "Isolated" is also intended to cover promoters obtained through artificial synthesis.

[0036] The term "gene expression cassette" as used in this article refers to a nucleic acid fragment that has a basic complete gene expression function, which includes, in sequence, a promoter that regulates the initiation of transcription, the target gene to be expressed, and a terminator that terminates transcription.

[0037] The term "expression vector" used in this article refers to a type of artificial recombinant vector that optionally possesses the ability to replicate in host cells. It integrates transcriptional regulatory elements such as promoters and terminators, as well as translation initiation-related sequences. After the target gene is inserted into this expression vector and introduced into a host cell, the transcription and translation of the target gene can be initiated by the regulatory elements on the vector, yielding the corresponding gene product. Typically, the recombinant vectors used in recombinant DNA technology are in the form of "plasmids," which are round, double-stranded DNA molecules.

[0038] As used in this article, "host cell" refers to a cell into which the aforementioned promoters or expression vectors can be introduced, such as *Corynebacterium glutamicum*. After the host cell introduces the aforementioned promoters into its genome, it can initiate or increase the expression of genes located downstream of the promoter. After the expression vector (which may exist outside the host cell genome or be integrated into the host cell genome) is introduced into the host cell, the aforementioned promoters can initiate or enhance the expression of the target gene located downstream of the expression vector. The host cell may include the progeny of the host cell, and the progeny may not necessarily be completely identical to the original parent cell due to natural, accidental, or intentional mutations.

[0039] The term “amino acid sequence” as used herein is synonymous with and interchangeable with the terms “polypeptide,” “protein,” and “peptide.” Conventional single-letter or three-letter codes for amino acid residues are used, with the amino acid sequence presented in a standard amino-to-carboxyl-terminal orientation (i.e., N→C). Similarly, the term “nucleotide sequence” as used herein is synonymous with and interchangeable with the terms “polynucleotide,” “nucleic acid,” and “nucleic acid molecule.” Nucleotide sequences are presented using a form commonly used in the art, written and displayed with the standard 5' end → 3' end orientation.

[0040] When referring to amino acid or nucleotide sequences, the term "sequence identity" (also known as "sequence uniformity") refers to the degree of similarity between two amino acid or nucleotide sequences (e.g., a query sequence and a reference sequence), typically expressed as a percentage. Commonly used sequence alignment algorithms or software include DANMAN, CLUSTALW, MAFFT, BLAST, MUSCLE, etc. For the purposes of this invention, the publicly available alignment software BLAST (available at https: / / www.ncbi.nlm.nih.gov / ) can be used to obtain the optimal sequence alignment and calculate the sequence identity between the two amino acid or nucleotide sequences using default settings.

[0041] As used in this article, “including,” “contains,” and “has” mean “including but not limited to,” but also refers to situations consisting only of the listed elements.

[0042] The term "or" refers to a single element among the listed optional elements, unless the context explicitly indicates otherwise. The term "and / or" refers to any one, any two, any three, any more, or all of the listed optional elements.

[0043] Unless otherwise specified, the percentage sign "%" in the examples refers to volume percentage; the percentage of a solution "% (m / v)" refers to the number of grams of solute contained in 100 mL of solution.

[0044] The starting strain used in the examples was the lysine-producing strain Lys-05 (i.e., the Lys-05 strain in Example 1 of Chinese Patent Application No. CN202610405633.3). In short, this strain Lys-05 is the starting strain... C.glutamicum The gene was obtained by engineering modifications based on ATCC 13032. The modification steps included: introducing a homoserine dehydrogenase gene carrying a mutation point into the genome using homologous recombination gene editing technology. man (V59A), Knockout lysine Gene, overexpression of the aspartate kinase gene carrying the mutation point lysC (T311I), aspartate semialdehyde dehydrogenase gene asd L-lysine efflux protein gene lysE and diaminopimelic acid decarboxylase gene lysA For specific modification methods, please refer to Chinese Patent Publication CN121931141A (Application No.: 202610405633.3, Publication Date: April 28, 2026, Invention Title: An L-Lysine Producing Strains and a Method for Constructing and Applying the Strains), the full text of which is incorporated herein by reference.

[0045] The corresponding gene mutation sequences were synthesized by Suzhou Genewise Biotechnology Co., Ltd.; the corresponding promoters and genes are listed in the sequence listing attached to this article.

[0046] The gene editing method used was homologous recombination. The technical terms used in the following examples, such as gene integration and plasmid construction, can be found in the article Vogt M, Haas S, Klaffl S, Polen T, Eggeling L, vanOoyen J, Bott M (2014). Metab Eng The explanation can be found in 22:40-52.

[0047] The technical solution of the present invention will be further described below with reference to embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are merely exemplary and do not constitute a limitation on the scope of the present invention. It should be noted that, unless otherwise specified, the experimental methods used in the following embodiments are conventional methods in the art.

[0048] Example 1: Candidate promoter sequences obtained based on Salis Lab Promoter Calculator design Transcription initiation efficiency is a key rate-limiting step that determines gene expression levels. Even subtle changes in the promoter sequence can significantly affect the protein synthesis rate without altering the amino acid sequence of the coding region. To obtain an optimized promoter sequence that can improve the transcription initiation efficiency of key genes for lysine synthesis, an optimized promoter sequence was developed based on the tuf promoter sequence (the sequence is agatcgtttagatccgaaggaaaacgtcgaaaagcaatttgcttttcgacgccccaccccgcgcgttttagcgtgtcagtaggcgcgtagggtaagtggggtagcggcttgttagataatcttgaaatcggctttcaacagcattgatttcgatgtatttagctggccgttaccctgcgaatgtccacagggtagctggtagtttgaaaatcaacgccgttgcccttaggattcagtaactggcacattttgtaatgcgctagatctgtgtgctcagtcttccaggctgcttatcacagtgaaagcaaaaccaattcgtggctgcgaaagtcgtagccaccacgaagtccaggagga (SEQ ID NO: 1)). This was achieved using Salis Labs. The PromoterCalculator or (https: / / salislab.net / software / ) can be used for rational design and optimization. After screening, the following candidate promoter sequences were obtained, as shown in Table 1 below.

[0049] Table 1. Starter Sequence The above-mentioned tuf promoter sequences were synthesized and linked to the target gene ATG. They were then integrated into the starting strain Lys-05 through gene editing for subsequent functional verification of lysine production.

[0050] Example 2: Construction of engineered strains based on promoter sequence-related lysine synthesis genes Five candidate promoter sequences were obtained through rational design using the Salis Lab Promoter Calculator, as shown in Table 1. To systematically evaluate the regulatory effects of the candidate and original promoter sequences on related genes in the lysine synthesis pathway, the *Corynebacterium glutamicum* aspartate transaminase gene was selected. aspB、The dihydropyridine dicarboxylic acid synthase gene dapA and the meso-diaminopimelic acid dehydrogenase gene ddh were integrated into the genome of *Corynebacterium glutamicum* Lys-05 using the same gene editing strategy. Different promoter sequences from Table 1 were linked to the start codon ATG of the target genes, resulting in 18 recombinant strains. To introduce the candidate and original sequences into *Corynebacterium glutamicum*, GenScript Biotech was commissioned to synthesize the DNA sequences of the different tuf promoter sequences and their regulatory genes from Table 1.

[0051] Electrotransfer competent cells were prepared from the starting strain Lys-05 (Lys-05 strain in Example 1 of CN202610405633.3) according to the standard competent cell preparation method.

[0052] 2.1 Aspartate transaminase gene aspB Construction of recombinant strains integrating different tuf promoter sequences Using the synthesized promoter sequences from Table 1 and their aspartate transaminase (aspB) gene DNA as templates, PCR amplification was performed using primers tuf-F0 / tuf-aspB-R, tuf-F1 / tuf-aspB-R, tuf-F2 / tuf-aspB-R, tuf-F3 / tuf-aspB-R, tuf-F4 / tuf-aspB-R, and tuf-F5 / tuf-aspB-R. Integrated fragments containing the target promoter and aspB gene with lengths of 1368-1637 bp were obtained, and after gel extraction and purification, were designated as the "tuf-aspB 0-5 integrated fragment". Corynebacterium glutamicumUsing the ATCC 13032 genome as a template, PCR amplification was performed using primers Up-aspB-F / R and Down-aspB-F / R to obtain the upstream homologous arm cg1902-UP and the downstream homologous arm cg1902-DW of the cg1902 gene locus. Using the recovered upstream and downstream homologous arms and the aforementioned "tuf-aspB 0-5 integration fragment" as templates, overlap PCR was performed using primers Up-aspB-F and Down-aspB-R to obtain the complete target fragment for genome integration, named tuf-aspB 0-5, with lengths of 2681 bp (tuf-aspB0), 2412 bp (tuf-aspB1), 2420 bp (tuf-aspB2), 2421 bp (tuf-aspB3), 2420 bp (tuf-aspB4), and 2431 bp (tuf-aspB5), respectively. Subsequently, the fragment tuf-aspB0-5 was ligated to a pK18 transpiler (pK18mobSacB, purchased from Miaoling Plasmid Platform, catalog number PO100) to construct the plasmid Δcg1902-Ptuf-aspB0-5. Finally, the plasmid was electroporated into competent cells of the starting strain Lys-05. Positive transformants were screened using primers Up-1902-F and Down-1902-R. Sequencing of the PCR products showed that the tuf promoter sequence, the target gene, and the ligation regions of the upstream and downstream homologous arms were consistent with expectations. The recombinant strain was finally obtained and named... C. glutamicum Lys aspB-R0-R5. The primer sequence is shown in Table 2 below.

[0053] 2.2 Dihydropyridinedicarboxylic acid synthase gene dapA Construction of recombinant bacteria integrating different tuf promoter sequences Using the synthesized promoter sequences from Table 1 and their dihydropyridine dicarboxylic acid synthase dapA gene DNA as templates, PCR amplification was performed using primers tuf-F0 / tuf-dapA-R, tuf-F1 / tuf-dapA-R, tuf-F2 / tuf-dapA-R, tuf-F3 / tuf-dapA-R, tuf-F4 / tuf-dapA-R, and tuf-F5 / tuf-dapA-R. Integrated fragments containing the target promoter and dapA gene, ranging in length from 993 to 1262 bp, were obtained and purified by gel extraction as the "tuf-dapA 0-5 integrated fragment". Corynebacterium glutamicumUsing the ATCC 13032 genome as a template, PCR amplification was performed using primers Up-dapA-F / R and Down-dapA-F / R to obtain the upstream homologous arm cg1556-UP and the downstream homologous arm cg1556-DW of the cg1556 gene locus. Using the recovered upstream and downstream homologous arms and the aforementioned "tuf-dapA 0-5 integration fragment" as templates, overlap PCR was performed using primers Up-dapA-F and Down-dapA-R to obtain the complete target fragment for genome integration, named tuf-dapA0-5, with lengths of 2381 bp (tuf-dapA0), 2112 bp (tuf-dapA1), 2120 bp (tuf-dapA2), 2121 bp (tuf-dapA3), 2120 bp (tuf-dapA4), and 2131 bp (tuf-dapA5), respectively. Subsequently, the fragment tuf-dapA0-5 was ligated to pK18 transparticles to construct the plasmid Δcg1556-Ptuf-dapA0-5. Finally, the plasmid was electroporated into competent cells of the starting strain Lys-05. Positive transformants were screened using primers Up-1556-F and Down-1556-R. Sequencing of the PCR products showed that the tuf promoter sequence, the target gene, and the ligation regions of the upstream and downstream homologous arms were consistent with expectations. The recombinant strain was finally obtained and named *C. glutamicum* LysdapA-R0-R5. The primer sequences are shown in Table 2 below.

[0054] 2.3 Meso-diaminopimelic acid dehydrogenase gene dd Construction of recombinant strains integrating different tuf promoter sequences Using the synthesized promoter sequences from Table 1 and their dihydropyridine dicarboxylic acid synthase (ddh) gene DNA as templates, PCR amplification was performed using primers tuf-F0 / tuf-ddh-R, tuf-F1 / tuf-ddh-R, tuf-F2 / tuf-ddh-R, tuf-F3 / tuf-ddh-R, tuf-F4 / tuf-ddh-R, and tuf-F5 / tuf-ddh-R. Integrated fragments containing the target promoter and ddh gene, ranging in length from 1050 to 1319 bp, were obtained and purified by gel extraction as the "tuf-ddh 0-5 integrated fragment". Corynebacterium glutamicumUsing the ATCC 13032 genome as a template, PCR amplification was performed using primers Up-ddh-F / R and Down-ddh-F / R to obtain the upstream homologous arm cg2903-UP and the downstream homologous arm cg2903-DW of the cg2903 gene locus. Using the recovered upstream and downstream homologous arms and the aforementioned "tuf-ddh 0-5 integration fragment" as templates, overlap PCR was performed using primers Up-ddh-F and Down-ddh-R to obtain the complete target fragment for genome integration, named tuf-ddh 0-5, with lengths of 2421 bp (tuf-ddh0), 2152 bp (tuf-ddh1), 2160 bp (tuf-ddh2), 2161 bp (tuf-ddh3), 2160 bp (tuf-ddh4), and 2171 bp (tuf-ddh5), respectively. Subsequently, the fragments tuf-dapA 0-5 were ligated to pK18 transpiles to construct the plasmid Δcg2903-Ptuf-dapA 0-5. Finally, the plasmid was electroporated into competent cells of the starting strain Lys-05. Positive transformants were screened using primers Up-2903-F and Down-2903-R. Sequencing of the PCR products showed that the tuf promoter sequence, the target gene, and the ligation regions of the upstream and downstream homologous arms were consistent with expectations. The recombinant strain was finally obtained and named C. glutamicum Lys ddh-R0-R5. The primers used in the strain construction are shown in Table 2.

[0055] Table 2 Primers used in strain construction The strains involved in the above construction process are shown in Table 3.

[0056] Table 3 shows the constructed strains. Example 3 Using the L-lysine-producing strain described in Example 2 C. glutamicum Lys aspB R0-R5, C. glutamic Lys dapA - R0-R5, C. glutamicum Lys ddh - R0-R5 were used in shake-flask fermentation to produce L-lysine.

[0057] 3.1 Culture medium 3.1.1 Slant Culture Medium Glucose 1 g / L, peptone 10 g / L, beef extract 10 g / L, yeast powder 5 g / L, NaCl 2.5 g / L, agar 25 g / L, pH 7.0~7.2, sterilized at 0.1 MPa for 20 min.

[0058] 3.1.2 Seed Culture Medium Glucose 1 g / L, corn steep liquor 10.0 mL / L, MgSO4·7H2O 0.4 g / L, KH2PO4 1.0 g / L, L-alanine 0.35 g / L, monosodium glutamate 0.1 g / L, MnSO4·H2O 0.01 g / L, biotin 50 μg / L, nicotinamide 5 mg / L, thiamine 0.2 mg / L, pH 7.0~7.2, sterilized at 0.1 MPa for 15 min.

[0059] 3.1.3 Fermentation medium Glucose 40.0 g / L, corn steep liquor 40.0 mL / L, KH2PO4·3H2O 3.0 g / L, MgSO4·7H2O 1.5 g / L, MnSO4·H2O 0.015 g / L, biotin 0.8 mg / L, nicotinamide 0.8 mg / L, thiamine 150 μg / L, CaCO3 30 g / L (sterilized separately), pH 7.0~7.2, sterilized at 0.1 MPa for 15 min, phenol red 2%, the remainder being water.

[0060] 3.2.1 Seed activation and culture: The bacterial culture was inoculated from the preservation tube and evenly spread onto the activation slant. It was then incubated at 32°C for 12 h, transferred to the activation slant and incubated for another 10 h, before being transferred to a shaker containing 5 mL of seed culture medium for seed culture.

[0061] 3.2.2 Fermentation culture: Inoculate 1.5 mL of seed culture (5% inoculum) into a 500 mL Erlenmeyer flask containing 30 mL of fermentation medium. Seal the flask with nine layers of gauze and place it on a circulating shaker (200 rpm) at 32°C for 48 h. Add 2% calcium carbonate and intermittently add sodium hydroxide to maintain the pH at approximately 7.0 (every 4 h).

[0062] Example 4 Using the L-lysine-producing strain described in Example 2 C. glutamicum Lys aspB - R0-R5, C. glutamic Lys dapA - R0-R5, C. glutamicum Lys ddh -R0-R5 were used to produce L-lysine by shake-flask fermentation (see the culture medium and fermentation process in Example 3). The L-lysine yield of each strain is shown in Table 4 below.

[0063] Table 4. L-lysine yield from shake-flask fermentation of each strain There were significant differences compared to their respective unoptimized promoter strains. p < 0.05.

[0064] In this embodiment, gene editing technology was used to truncate and optimize the tuf promoter. The effects of five candidate tuf promoter sequences on the fermentation of a lysine-containing recombinant strain (Lys-05 strain from Example 1, CN202610405633.3) were tested in parallel at three different gene loci (aspB, dapA, and ddh). Analysis of the fermentation results showed that the recombinant strain carrying the first candidate tuf promoter sequence achieved the highest lysine yield at all loci, at 5.17 g / L, 4.72 g / L, and 4.73 g / L, respectively, representing increases of 17.8%, 10.8%, and 11.8% compared to the original tuf promoter. The recombinant strain carrying the second candidate tuf promoter sequence had the second highest lysine yield. The yields of the remaining candidate promoter sequences showed no significant difference compared to the original tuf promoter. The above results fully demonstrate that candidate sequence No. 1 is a universal strong promoter sequence that can be widely used to enhance the expression of key targets in the lysine synthesis pathway, providing a core regulatory element for constructing high-yield lysine engineered strains.

Claims

1. A separate TUF promoter, characterized in that, The nucleotide sequence is shown in SEQ ID NO: 2 or 3.

2. A gene expression cassette, characterized in that, Includes the promoter described in claim 1.

3. An expression carrier, characterized in that, Includes the promoter of claim 1 or the gene expression cassette of claim 2.

4. A host cell, characterized in that, It includes the promoter of claim 1, the gene expression cassette of claim 2, or the expression vector of claim 3, wherein the host cell is a bacterium of the genus Corynebacterium.

5. The host cell as described in claim 4, characterized in that, The host cell is Corynebacterium glutamicum.

6. The use of the promoter of claim 1, the gene expression cassette of claim 2, or the expression vector of claim 3 in constructing a lysine-producing strain, wherein the lysine-producing strain is a Corynebacterium.

7. The application as described in claim 6, characterized in that, The lysine-producing strain is Corynebacterium glutamicum.

8. The use of the promoter of claim 1, the gene expression cassette of claim 2, the expression vector of claim 3, or the host cell of claim 4 or 5 in the fermentation production of lysine or to increase lysine yield.

9. The application as described in claim 8, characterized in that, The host cell is Corynebacterium glutamicum.

10. A method for constructing a lysine-producing strain, characterized in that, Replace the promoter of any one of the following genes of the starting strain with the promoter of claim 1: aspB , dapA and ddh, The originating strain is Corynebacterium glutamicum.

Images