Use of pea aphid apoD3 gene as a target in the control of pea aphids

Abstract

The present application belongs to the field of green prevention and control of agricultural pests, insect molecular biology and RNA interference technology, and particularly relates to the use of pea aphid ApoD3 gene as a target in the prevention and control of pea aphids. The present application discloses the important physiological role of the ApoD3 gene of the pea aphid ApoD3 in regulating the accumulation of medium and long chain normal alkanes, maintaining the water retention barrier of the epidermis and enhancing the adaptability to drought environment. The silencing of the ApoD3 gene can simultaneously affect the water retention capacity, survival capacity under drought conditions and reproductive capacity of the pea aphid, and the designed RNA interference target sequence has good target gene specificity. Therefore, ApoD3 can be used as a candidate molecular target for the RNA interference prevention and control of the pea aphid, and provides a new technical approach for the green and precise prevention and control of the pea aphid.

Description

Technical Field

[0001] This invention belongs to the fields of green control of agricultural pests, insect molecular biology and RNA interference technology, specifically involving the use of the ApApoD3 gene of the pea aphid as a target in the control of pea aphids. Background Technology

[0002] pea aphid ( Acyrthosiphon pisum Aphids and other piercing-sucking pests are important damagers of leguminous crops. They directly inhibit crop growth and reduce yield by feeding on the phloem sap, while also transmitting various plant viral diseases. They mainly harm leguminous crops such as peas, broad beans, alfalfa, and clover. Currently, the control of aphids and other piercing-sucking pests still mainly relies on chemical insecticides such as organophosphates, pyrethroids, and neonicotinoids. Although chemical control has advantages such as rapid effectiveness and obvious results, long-term and large-scale use has led to increasing pesticide resistance in pests, pesticide residues causing soil and water pollution, and adverse effects on natural enemies, pollinators, and other non-target organisms. Therefore, developing efficient, green, and safe new pest control technologies has become an important research direction in the field of agricultural pest management.

[0003] RNA interference (RNAi) is a sequence-specific gene silencing mechanism mediated by double-stranded RNA. Due to its high target selectivity, well-defined mechanism of action, and good environmental compatibility, it has become an important technological direction for the green control of agricultural pests. During the adaptation of insects to terrestrial environments, the cuticle layer of their bodies gradually forms a hydrophobic barrier mainly composed of cuticular hydrocarbons (CHCs). This barrier effectively reduces the rate of water loss through the body surface, maintains the insect's water balance, and enhances the insect's adaptability to adverse environmental conditions such as drought. When the synthesis, transport, or deposition of cuticular hydrocarbons is disrupted, the cuticular barrier function declines, leading to rapid water loss and consequently reduced survival and reproductive capacity. Therefore, genes related to the maintenance of cuticular hydrocarbon homeostasis have become potential targets for RNAi pest control. In the pea aphid, apolipoprotein D family members ApApoD1 and ApApoD2 have been reported to participate in physiological processes such as epidermal hydrocarbon accumulation, water retention, drought adaptation, and reproduction. However, there are multiple ApoD paralogous genes in the pea aphid genome, and the sequence and structural characteristics of different paralogous proteins differ, so their physiological functions cannot be simply inferred from each other.

[0004] Apolipoprotein D (ApoD) belongs to the lipid transporter superfamily and is characterized by its ability to bind hydrophobic small molecules. Another paralogous gene, ApApoD3, exists in the pea aphid. Its encoded protein contains a signal peptide and a conserved lipocalin domain, consistent with the typical characteristics of a secretory hydrophobic ligand transporter. However, the amino acid sequence identity between ApApoD3 and ApApoD1 and ApApoD2 is only 23.53% and 26.78%, respectively, suggesting that they may have different ligand-binding properties and physiological functions. Currently, existing RNA interference targets mainly focus on epidermal hydrocarbon synthases, lipid transporters, and their receptors, with limited research on secretory carrier proteins with lipid binding and transport functions. Whether ApApoD3 is involved in the accumulation of long-chain n-alkanes, maintenance of epidermal water retention, and drought adaptation in the pea aphid remains unclear, and no technological insights have been found regarding its potential use as an RNA interference target for pea aphid control. Therefore, there is an urgent need in this field to clarify the physiological function of ApApoD3 in the accumulation of hydrocarbons and water retention in the epidermis of pea aphids, and to develop an RNA interference control technology targeting ApApoD3, so as to provide a new molecular target and technical approach for the green control of aphids. Summary of the Invention

[0005] Based on this, the purpose of this invention is to provide the use of the pea aphid apolipoprotein D3 gene ApApoD3 as an RNA interference target in the control of pea aphids, and to provide double-stranded RNA targeting ApApoD3 mRNA, a double-stranded DNA transcription template for preparing the double-stranded RNA, and an RNA interference product containing the double-stranded RNA, thereby providing candidate molecular targets and technical solutions for the control of pea aphids based on RNA interference technology.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides pea aphids ( Acyrthosiphon pisum The use of the apolipoprotein D3 gene ApApoD3 as an RNA interference target in the preparation of products for the control of pea aphids, wherein the products reduce the reproductive capacity and / or the survival capacity of pea aphids under drought conditions by reducing the expression level of the ApApoD3 gene in pea aphids.

[0007] Preferably, reducing the expression level of the ApApoD3 gene reduces the hydrocarbon content in the pea aphid epidermis.

[0008] More preferably, the epidermal hydrocarbons include n-alkanes.

[0009] More preferably, reducing the expression level of the ApApoD3 gene reduces the content of one or more n-alkanes in the epidermis of the pea aphid, namely n-C25, n-C26, n-C27, n-C28, n-C29, n-C30, and n-C32.

[0010] Preferably, reducing the expression level of the ApApoD3 gene reduces the water content of pea aphids and / or increases the rate of water loss, thereby reducing the survival ability of pea aphids under drought conditions.

[0011] Preferably, the RNA interference agent used to reduce the expression level of the ApApoD3 gene is a double-stranded RNA that targets ApApoD3 mRNA.

[0012] Secondly, the present invention provides a double-stranded RNA targeting the ApApoD3 mRNA gene of the pea aphid apolipoprotein D3 gene. The double-stranded RNA comprises a double-stranded region formed by two complementary RNA strands. One RNA strand contains a 300 nt RNA sequence corresponding to the 300 bp nucleotide sequence shown in SEQ ID NO:1. The 300 nt RNA sequence has the same base composition as the nucleotide sequence shown in SEQ ID NO:1, except that thymine T is replaced with uracil U. The other RNA strand contains an RNA sequence complementary to the 300 nt RNA sequence.

[0013] The 300 bp nucleotide sequence shown in SEQ ID NO:1 is located within the coding region of the ApApoD3 gene and is a target sequence for ApApoD3 RNA interference. This double-stranded RNA can target ApApoD3 mRNA and reduce the expression level of the ApApoD3 gene in pea aphids.

[0014] Thirdly, the present invention provides a double-stranded DNA transcription template for preparing the above-mentioned double-stranded RNA, wherein the double-stranded DNA transcription template comprises a 300 bp nucleotide sequence as shown in SEQ ID NO:1, and T7 RNA polymerase promoter sequences are respectively attached to both ends of the 300 bp nucleotide sequence for in vitro transcription to prepare the double-stranded RNA.

[0015] Preferably, the T7 RNA polymerase promoter sequence is as follows: TAATACGACTCACTATAGGG.

[0016] Preferably, the double-stranded DNA transcription template is obtained by amplification using forward and reverse primers with the T7 RNA polymerase promoter sequence connected to the 5′ end, respectively.

[0017] More preferably, the double-stranded RNA is prepared using the double-stranded DNA transcription template as a template and an in vitro transcription system with T7 RNA polymerase.

[0018] Fourthly, the present invention provides the use of the above-mentioned double-stranded RNA targeting ApApoD3 mRNA in the preparation of RNA interference products for the control of pea aphids.

[0019] Preferably, the double-stranded RNA reduces the reproductive capacity and / or the survival capacity of the pea aphid under drought conditions by lowering the expression level of the ApApoD3 gene in the pea aphid.

[0020] Fifthly, the present invention provides an RNA interference product for controlling pea aphids, the RNA interference product comprising the above-mentioned double-stranded RNA targeting ApApoD3 mRNA.

[0021] In a sixth aspect, the present invention provides a method for controlling pea aphids, comprising administering an effective amount of the above-mentioned double-stranded RNA targeting ApApoD3 mRNA into pea aphids, thereby reducing the expression level of the ApApoD3 gene in pea aphids and reducing the reproductive capacity and / or the survival capacity of pea aphids under drought conditions.

[0022] Preferably, the double-stranded RNA is administered to the pea aphid via injection.

[0023] Preferably, the pea aphid is a nymph.

[0024] More preferably, the pea aphid is a third-instar nymph.

[0025] In one specific embodiment of the present invention, dsApApoD3 was microinjected into third-instar pea aphid nymphs, with an injection volume of approximately 200 nL per nymph and a concentration of dsApApoD3 of 6000 ng / μL.

[0026] Beneficial effects of the present invention This invention provides the use of the apolipoprotein D3 gene ApApoD3 in pea aphids as a candidate molecular target for RNA interference control. Reducing the expression level of the ApApoD3 gene in pea aphids through RNA interference can decrease the hydrocarbon content in the aphid epidermis, affect their water balance, and reduce their survival and reproductive capacity under drought conditions. This provides experimental evidence for further development of RNA interference control technology targeting ApApoD3 in pea aphids.

[0027] Specifically, after treatment with dsApApoD3, the expression level of the ApApoD3 gene decreased significantly starting from 36 h after treatment, and the significant silencing effect lasted until 96 h; among them, the ApApoD3 expression level at 48 h after treatment was 47.47% lower than that of the control group.

[0028] After silencing the ApApoD3 gene, the total hydrocarbon content in the epidermis of the pea aphid decreased by 28.69% compared with the control group.

[0029] Furthermore, silencing the ApApoD3 gene significantly reduced the content of various n-alkanes in the epidermis of the pea aphid, with the contents of n-C25, n-C26, n-C27, n-C28, n-C29, n-C30, and n-C32 decreasing by 42.75%, 32.19%, 33.12%, 32.28%, 23.62%, 38.63%, and 66.48%, respectively.

[0030] After the ApApoD3 gene was silenced, the water content of pea aphids decreased by 19.44% compared with the control group, and the water loss rate increased to about 2.05 times that of the control group, indicating that the silencing of the ApApoD3 gene can significantly affect the water balance of pea aphids.

[0031] Under severe drought conditions, silencing the ApApoD3 gene significantly shortened the survival time of the pea aphid. 36 h after treatment, the survival rate of the dsApApoD3 treatment group was 0%, while the survival rate of the control group was 26.67%, meaning the survival rate of the dsApApoD3 treatment group was 26.67 percentage points lower than that of the control group.

[0032] Furthermore, silencing the ApApoD3 gene significantly reduced the cumulative reproduction of the pea aphid. During the observation period of 12–120 h after treatment, the cumulative average reproduction of the dsApApoD3 treatment group at each observation time point was significantly lower than that of the control group.

[0033] Therefore, RNA interference treatment targeting ApApoD3 can simultaneously produce phenotypes of reduced survival and reproductive capacity under drought conditions, providing experimental support for the application of ApApoD3 as a candidate molecular target for the control of RNA interference in pea aphids.

[0034] Sequence-specific analysis showed that the 300 bp RNA interference target sequence shown in SEQ ID NO:1 was a 300 / 300 nt perfect match with the corresponding regions of the two annotated ApApoD3 transcripts XM_008183410.3 and XM_001949312.5, with 100% nucleotide sequence identity and no gaps; the nucleotide sequences of the two transcripts within the 300 bp RNA interference target region were completely identical.

[0035] Under the BLASTn search conditions used, no significant match was detected between the 300 bp RNA interference target sequence and ApApoD1, ApApoD2, or other annotated pea aphid non-target loci.

[0036] Furthermore, RNA-seq results showed that neither ApApoD1 nor ApApoD2 was significantly downregulated at the detection time point of 48 h after dsRNA treatment; the log2fold change of ApApoD1 and ApApoD2 were 0.401 and 0.380, respectively, and the FDR-corrected P values ​​were 0.338 and 0.163, respectively.

[0037] Therefore, the existing sequence alignment results and transcriptome detection results together support that the 300 bp RNA interference target sequence shown in SEQ ID NO:1 has good targeting specificity for ApApoD3 in the pea aphid. Attached Figure Description

[0038] Figure 1 A diagram illustrating the sequence structure, conserved domains, and phylogenetic relationships of the ApApoD3 gene in the pea aphid; among which, Figure 1 A is a schematic diagram of the ApApoD3 transcript structure and detection region, showing the 5′ untranslated region, the 300 nt RNA interference target region for synthesizing dsApApoD3, the 80 nt RT-qPCR detection region for detecting ApApoD3 transcription levels, and the 3′ untranslated region; Figure 1 B is a schematic diagram of the structural domains of three paralogous proteins ApApoD1, ApApoD2 and ApApoD3 of the pea aphid apolipoprotein D, which shows the signal peptide region and the conserved Lipocalin domain, and demonstrates the amino acid sequence consistency of ApApoD1 and ApApoD2 with respect to ApApoD3. Figure 1 C represents the phylogenetic tree of ApApoD3 and its homologous protein D from hemiptera insects. The phylogenetic tree was constructed using the neighbor-joining method, employing a p-distance model, and underwent 1000 bootstrap replication tests. The values ​​at branch nodes represent the support of the corresponding branch. Figure 2 This figure shows the spatiotemporal expression characteristics, drought stress response, and duration of RNA interference of the ApApoD3 gene in the pea aphid. The relative expression level of ApApoD3 was detected by RT-qPCR, with the Rps20 gene of the pea aphid as an internal reference. Data in the figure are expressed as mean ± standard error. Different lowercase letters indicate significant differences between groups. An asterisk indicates a significant difference between the dsApApoD3 treatment group and the dsMuslta control group at the same time point, where "*" indicates P < 0.05, "**" indicates P < 0.01, and "ns" indicates no significant difference. Figure 2A represents the relative expression level of ApApoD3 in different developmental stages of the pea aphid, including the embryonic stage, the first to fourth instar nymphal stage, and the adult stage. Figure 2 B represents the relative expression level of ApApoD3 in different tissues of adult pea aphids, including the head, thorax, abdomen, intestine, and abdominal epidermis. Figure 2 C represents the relative expression level of ApApoD3 in pea aphids after 12 h, 24 h, and 36 h of treatment under drought stress conditions with a relative humidity of 5% and control conditions with a relative humidity of 70%. Figure 2 D represents the dynamic changes in ApApoD3 transcription levels from 24 h to 120 h after injection of dsApApoD3, with pea aphids injected with dsMuslta serving as negative controls. Figure 3 A graph showing the effects of silencing ApApoD3 on epidermal hydrocarbons, water balance, drought survival, and reproductive capacity in pea aphids; among which, Figure 3 A represents the total hydrocarbon content in the epidermis of the pea aphid 72 h after injection of dsMuslta or dsApApoD3. Figure 3 B represents the content of different epidermal hydrocarbon components in the dsMuslta treatment group and the dsApApoD3 treatment group, wherein the components include n-C25 to n-C33 straight-chain alkanes; the epidermal hydrocarbons were detected by gas chromatography-mass spectrometry and quantified using n-tetracosane as an internal standard. Figure 3 C represents the moisture content of the pea aphids in the dsMuslta and dsApApoD3 treatment groups; Figure 3 D represents the water loss rate of pea aphids in the dsMuslta and dsApApoD3 treatment groups after 12 hours of severe drought treatment. Figure 3 E represents the Kaplan-Meier survival curves of pea aphids in the dsMuslta and dsApApoD3 treatment groups under severe drought conditions. The complete survival distribution of the two groups was compared using the Mantel-Cox log-rank test. Simultaneously, the survival status of the two groups of pea aphids was compared at 12 h, 24 h, 36 h, and 48 h, with a two-tailed Fisher's exact test used at each time point. Holm's method was used to correct for multiple comparisons. Significant differences were found between the two groups at 36 h, but not at 12 h, 24 h, and 48 h. Figure 3F represents the average cumulative reproduction of pea aphids in the dsMuslta and dsApApoD3 treatment groups over a period of 12–120 h. The data were obtained from three biological replicates, and a two-way repeated measures ANOVA was used. The Sidak method was employed to compare the differences between the two treatment groups at each observation time point. Figure 3 A~ Figure 3 D and Figure 3 Data in F are expressed as mean ± standard error; an asterisk indicates a significant difference between the treatment and control groups, where “*” indicates P < 0.05 and “**” indicates P < 0.01; Figure 4 Principal component analysis (PCA) results; Figure 5 This figure shows the transcriptomic response, differentially expressed gene validation, and changes in in vivo metabolite content in pea aphids after ApApoD3 silencing. Data in the figure are expressed as mean ± standard error. An asterisk indicates a significant difference between the dsApApoD3 treatment group and the dsMuslta control group, where "*" indicates P < 0.05, "**" indicates P < 0.01, and "ns" indicates no significant difference. Figure 5 A is a volcano plot of differentially expressed genes between the two treatment groups 48 h after injection of dsApApoD3 or dsMuslta; red dots represent significantly upregulated differentially expressed genes, blue dots represent significantly downregulated differentially expressed genes, and gray dots represent genes that did not meet the differential expression screening criteria; the screening criteria for differentially expressed genes were false detection rate FDR < 0.01 and |log2FC| ≥ 1. Figure 5 B is the gene ontology enrichment analysis diagram of differentially expressed genes after ApApoD3 silencing. The enriched items include responses to toxic substances, iron ion binding, hormone activity, neuropeptide signaling pathways, neuropeptide hormone activity, and G protein-coupled receptor binding. Figure 5 C represents the results of RT-qPCR validation of differentially expressed genes related to lipid metabolism and epidermal structure. The genes detected include fatty acid synthase gene ApFASN, epidermal protein gene ApCPR8, (11Z)-hexadecano-11-enoyl-CoA binding enzyme gene ApZ11-ECC, and protein 5 containing acyl-CoA binding domain gene ApACBD5. Figure 5 D represents the phospholipid content in pea aphids in the dsMuslta and dsApApoD3 treatment groups. Figure 5 E represents the total cholesterol content in pea aphids in the dsMuslta and dsApApoD3 treatment groups. Figure 5 F represents the triglyceride content in pea aphids in the dsMuslta and dsApApoD3 treatment groups. Figure 5 G represents the trehalose content in pea aphids in the dsMuslta and dsApApoD3 treatment groups.

[0039] In the image above, ApApoD3 represents the pea aphid apolipoprotein D3 gene; dsApApoD3 represents a double-stranded RNA designed targeting the ApApoD3 gene; dsMuslta represents the negative control double-stranded RNA; RT-qPCR represents real-time quantitative polymerase chain reaction; CHCs represent epidermal hydrocarbons; RH represents relative humidity; PL represents phospholipids; TC represents total cholesterol; TG represents triglycerides; Trehalose represents trehalose; FDR represents false discovery rate; FC represents fold change; EO represents embryo; L1–L4 represent first to fourth instar nymphs, respectively; AD represents adult aphids; HD represents head; TX represents thorax; AN represents abdomen; GT represents intestine; and AC represents abdominal epidermis. Detailed Implementation

[0040] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0041] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinct meaning in the context. As used herein, it should be understood that terms such as “comprising,” “having,” “including,” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or,” depending on the context.

[0042] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.

[0043] Example 1: Sequence structure and phylogenetic analysis of the ApApoD3 gene in the pea aphid This embodiment aims to clarify the sequence structure of the ApApoD3 gene in the pea aphid, the conserved domain characteristics of the encoded protein, and its position in phylogeny, providing a sequence basis for subsequent functional studies and target selection.

[0044] 1.1 Sequence Origin and Bioinformatics Analysis Methods The amino acid sequence of ApApoD3 (NCBI accession number: XP_001949347.1) was used as the BLASTp query sequence to search the NCBI Hemiptera protein database, and 19 homologous sequences (homology >45%, E value <1e-79) were obtained. The corresponding species and accession numbers are shown in Table 1.

[0045] Table 1. Corresponding species and accession numbers

[0046] Multiple sequence alignment was performed using the ClustalW program in MEGA X software. The phylogenetic tree was reconstructed using the Neighbor-Joining (NJ) method with a p-distance model and 1000 Bootstrap replicates. The phylogenetic tree was visualized using iTOL v7. Gene structure diagrams and protein domain diagrams were drawn using IBS 2.0 software.

[0047] 1.2 Transcript structure and encoding protein domain of ApApoD3 Figure 1 A schematic diagram of the ApApoD3 transcript structure is shown. The ApApoD3 mRNA has a complete 5′ untranslated region (UTR) and a 3′ untranslated region, with lengths of 145 nt and 325 nt, respectively. Within its coding region, this invention designs a 300 nt RNA interference target region (corresponding to the 300 bp nucleotide sequence shown in SEQ ID NO:1 of this invention, specifically: TCATTTCGGCCAATGTCCAACTCTAGAACCAATGACTGATTTTTCAATGGATAAGCTTTTAGGAAAATGGTATGCAATACAAAAAACATCAACGTCAAGTCGGTGTCTGGAATATAACTTTGAAAAAACAGGCGAGCCCAATGCATATAAATTAGATCAAATGAGCGAAAATTCTATAATCAATGTGGCGAAGTCCAATAATTACCACTATGTTGGAAATTTGAAAGCGGATCCAAGCTTACCTTCAAGAATGATAGCTAATTTTCCTTTAAGTGTTGCAGGTAAAGCGTCGTTTGTTGT), and an 80 nt RT-qPCR detection region ( Figure 1 A).

[0048] Figure 1B shows the domain composition of three paralogous proteins of the pea aphid apolipoprotein D: ApApoD1, ApApoD2, and ApApoD3. ApApoD3 encodes a protein of 256 amino acids (longer than ApApoD1's 212 amino acids and ApApoD2's 194 amino acids), containing a signal peptide sequence at its N-terminus, consistent with the characteristics of secretory proteins; it also contains a conserved lipocalin domain, consistent with the structural characteristics of secretory hydrophobic ligand carrier proteins. Pairwise alignments showed that ApApoD1 and ApApoD3 share only 23.53% amino acid sequence similarity, and ApApoD2 and ApApoD3 share only 26.78% amino acid sequence similarity. Figure 1 B) indicates that ApApoD3 has a high degree of paralogous differentiation from other paralogous proteins in the same family, and its physiological function cannot be directly inferred from the research conclusions of ApApoD1 or ApApoD2.

[0049] 1.3 Construction and Analysis of Phylogenetic Trees Figure 1 C presents a phylogenetic tree of ApApoD3 and ApoD homologous proteins from 19 Hemiptera insects. The tree was constructed using the neighbor-join method with a p-distance model and 1000 bootstrap replicates. The values ​​at branch nodes represent the support of the corresponding branch. Phylogenetic analysis shows that ApApoD3 is closely related to the ApoD homologous proteins of *Metopolophium dirhodum* and *Myzus persicae*, clustering together in a highly supported Aphididae-specific clade. This clade is associated with sequences from *Sipha flava* and *Cinara cedri*, but less closely related to sequences from Phylloxaceridae and Adelgidae. Figure 1 C). The above phylogenetic results indicate that ApApoD3 has closely related homologous proteins in some aphids, providing a sequence basis for further research on the function of related homologous proteins.

[0050] Example 2: Spatiotemporal expression characteristics of the ApApoD3 gene in the pea aphid and analysis of its drought stress response. This embodiment aims to clarify the expression distribution characteristics of ApApoD3 in different developmental stages and adult tissues of the pea aphid, as well as the transcriptional response pattern of this gene to drought stress, thereby providing an expression profile basis for understanding its physiological function and determining the time window for RNA interference treatment.

[0051] 2.1 Expression characteristics at different developmental stages The tested pea aphids were a clone of the red pea aphid (Acyrthosiphon pisum) with a consistent genetic background, and were reared on broad bean (Vicia faba L.) seedlings. The environmental conditions were set at 18℃, 70% relative humidity, and a photoperiod of 16 h light / 8 h dark.

[0052] To obtain test insects at different developmental stages, embryos (n=50) were obtained by abdominal dissection of wingless parthenogenetic adult aphids. First to fourth instar nymphs (n* 40, 20, 10, and 8 individuals respectively) and adults (n=5 individuals) were collected, with three biological replicates for each sample. Total RNA was extracted using RNAiso Plus reagent (TaKaRa Bio, Japan) and quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). 800 ng of total RNA was used for reverse transcription to synthesize cDNA (20 μL system) using the PrimeScript™ RTReagent Kit with gDNA Eraser (TaKaRa Bio, Japan). RT-qPCR was performed on a CFX Opus 96 system (Bio-Rad, USA) using SYBR® Premix Ex Taq™ II (TaKaRa Bio, Japan). The ribosomal protein S20 gene Rps20 (GenBank accession number NM_001162819.2) was used as an internal control gene, and the relative expression level was calculated using the Pfaffl mathematical model.

[0053] like Figure 2 As shown in Figure A, ApApoD3 is expressed at all developmental stages of the pea aphid, but the expression levels differ significantly between different developmental stages. Specifically, ApApoD3 expression is highest during the embryonic (EO) and adult (AD) stages; expression levels decrease significantly after entering the nymphal stage, showing a continuous downward trend from the first to third instar nymphs (L1 to L3), and then significantly rebounding in the fourth instar nymph (L4). Figure 2 A). This expression pattern suggests that ApApoD3 may play different roles in embryonic development, nymphal molting transition, and adult physiological maintenance.

[0054] 2.2 Expression characteristics of different tissues in adult insects To detect the tissue expression distribution of ApApoD3, head, thorax, abdomen, intestine, and abdominal epidermis were obtained from adult pea aphids. The sample size was 50 heads and 50 intestines, 20 abdominal epidermis, and 10 thoraxes and 10 abdomens, with three biological replicates for each tissue. RNA extraction, reverse transcription, and RT-qPCR were performed as described in section 2.1 of Example 2.

[0055] like Figure 2As shown in Figure B, ApApoD3 exhibits strong tissue-specific expression. ApApoD3 expression was highest in the head (HD), followed by the abdominal epidermis (AC), maintained at lower levels in the abdomen (AN) and chest (TX), and lowest in the intestine (GT). Figure 2 B). The high expression of ApApoD3 in the abdominal epidermis is consistent with its physiological function in epidermal hydrocarbon accumulation and water retention. Its high expression in the head may reflect the presence of this gene in the scalp epidermis, and may also be involved in the physiological activities of neural, secretory, or lipid-related tissues in the head, but its specific physiological significance needs further clarification.

[0056] 2.3 Transcriptional Responses under Drought Stress Third-instar nymphs (50 individuals per replicate, 3 biological replicates) were placed in 50 mL centrifuge tubes, with 10 g of silica gel at the bottom of the tubes, separated from the test insects by a layer of cotton. A HOBO Pro v2 temperature and humidity recorder (Onset Computer Corp., USA) was used to confirm that the relative humidity in the tubes decreased to 5% within 1 h. Control centrifuge tubes were kept at 70% relative humidity without desiccant. Culture conditions were 18°C, with a photoperiod of 16 h light / 8 h dark. Samples were taken after 12 h, 24 h, and 36 h of treatment, flash-frozen in liquid nitrogen, and stored at -80°C. RNA extraction, reverse transcription, and RT-qPCR were performed as described in section 2.1 of Example 2.

[0057] like Figure 2 As shown in Figure C, the transcriptional response of ApApoD3 to drought stress is not instantaneous. After 12 and 24 hours of treatment at 5% relative humidity, the expression level of ApApoD3 showed no significant change compared to the 70% relative humidity control group; however, when drought stress persisted for 36 hours, the transcriptional level of ApApoD3 was significantly induced, increasing by 1.59 times compared to the control group (70% relative humidity). Figure 2 C). These results indicate that ApApoD3 is involved in the intermediate physiological response under sustained drought conditions, rather than the acute stress response, suggesting that it may play a role in lipid metabolism reprogramming or epidermal barrier maintenance under sustained drought stress.

[0058] Example 3: Specificity verification and silencing efficiency detection of ApApoD3 gene RNA interference target sequence This embodiment aims to verify the specificity of the 300 bp RNA interference target sequence designed in this invention for the ApApoD3 gene, and to systematically detect the silencing efficiency and effective silencing time window of ApApoD3 after RNA interference, so as to determine the optimal detection time point for subsequent phenotypic analysis.

[0059] 3.1 Preparation of double-stranded RNA Using a 300 bp fragment within the coding region of ApApoD3 (sense primer F: TCATTTCGGCCAATGTCCAAC (SEQ ID NO:2); antisense primer R: ACAACAAACGACGCTTTACCTG (SEQ ID NO:3)) as a template, a T7 promoter sequence (TAATACGACTCACTATAGGG (SEQ ID NO:4)) was ligated to the 5′ end of both the forward and reverse primers, resulting in DNA fragments with T7 promoter sequences at both ends (amplification product length approximately 320 bp). Double-stranded RNA (dsRNA), i.e., dsApApoD3, was synthesized in vitro using the T7 RiboMAX™ ExpressRNAi System (Promega, USA) according to the manufacturer's instructions. After purification, the concentration was determined using a NanoDrop 2000 spectrophotometer.

[0060] The negative control used a 193 bp fragment of the mouse lymphotoxin-α gene (GenBank accession number XM_006536550.2) that had no significant homology with the pea aphid genome. Double-stranded RNA was synthesized using the same method and labeled as dsMuslta. The amplified product was approximately 213 bp in length.

[0061] The primer sequences used are detailed in Table 2.

[0062] Table 2 Primer sequences used

[0063] 3.2 BLASTn sequence specificity verification To verify the specificity of the 300 bp dsApApoD3 target sequence designed in this invention, the complete 300 bp target sequence was used as the query sequence and BLASTn was performed in the NCBI RefSeq RNA database (limited to Acyrthosiphon pisum).

[0064] The results are shown in Table 3. The 300 bp target sequence only matched the full length of two annotated ApApoD3 transcriptional variants (XM_008183410.3 and XM_001949312.5), with an alignment length of 300 / 300 nt, 100% identity, no gaps, and an E value of 1.52 × 10⁻⁶. -157Although the two transcriptional variants differ in sequence outside the target region, the complete 300 bp dsRNA target sequence is identical in both variants. This target sequence does not show significant BLASTn matching with ApApoD1 (LOC100168232, NM_001326662.2), ApApoD2 (LOC100572774, XM_008188354.3), or any other annotated pea aphid loci. These results confirm that the 300 bp dsApApoD3 fragment has high sequence specificity for ApApoD3.

[0065] Table 3. BLASTn specificity assessment of the 300 bp double-stranded ApApoD3 fragment.

[0066] 3.3 Microinjection-mediated RNA interference treatment First-instar nymphs less than 12 hours old were transferred to fresh broad bean seedlings and allowed to grow to the third instar for RNAi treatment. After briefly fixing the third-instar nymphs on ice (approximately 30 seconds), each nymph was injected with 200 nL of dsApApoD3 solution at a concentration of 6000 ng / μL using a microinjector. The control group was injected with the same volume and concentration of dsMuslta. After injection, the test insects were transferred back to fresh broad bean seedlings and cultured in an incubator at 18°C, 70% relative humidity, and a 16-hour light / 8-hour dark photoperiod.

[0067] 3.4 Detection of RNA interference efficiency and effective silencing time window Samples were taken at 24 h, 36 h, 48 h, 60 h, 72 h, 84 h, 96 h, 108 h, and 120 h post-dsRNA injection. Each treatment had three biological replicates, with each replicate containing six aphids. Total RNA extraction, reverse transcription, and RT-qPCR were performed as described in section 2.1 of Example 2. RT-qPCR detection used ApApoD3-specific primers (see Table 2, product 80 bp), with Rps20 as an internal reference gene. Silencing efficiency was expressed as the percentage reduction in relative ApApoD3 expression in the dsApApoD3 treatment group compared to the dsMuslta control group.

[0068] like Figure 2As shown in Figure D, compared with the dsMuslta control group, the abundance of ApApoD3 transcripts was not significantly reduced 24 h after dsApoD3 injection. The first significant silencing point was detected at 36 h post-injection, at which time ApApoD3 expression was reduced by 46.02% compared with the control group. At 48 h post-injection, the expression level decreased by 47.47%; at 60 h, by 45.87%; at 72 h, by 44.81%; at 84 h, by 36.42%; and at 96 h, by 23.54%. Therefore, the significant silencing time window for ApApoD3 was determined to be 36 h–96 h post-injection. By 108 h and 120 h, ApApoD3 expression gradually recovered and no longer showed a significant difference compared with the control group.

[0069] Based on the above results, subsequent phenotypic detection experiments were conducted within a time window of 48–72 h after dsRNA injection.

[0070] 3.5 Expression detection of paralogous genes ApApoD1 and ApApoD2 To rule out the possible off-target silencing effect of dsApApoD3 treatment on the paralogous genes ApApoD1 and ApApoD2, the changes in transcript abundance of ApApoD1 and ApApoD2 after dsApApoD3 treatment were specifically examined based on the RNA-seq data from Example 7.

[0071] The results are shown in Table 4. 48 h after dsApApoD3 injection, the log2 FC of ApApoD1 was 0.401, with an FDR-corrected P-value of 0.338; the log2 FC of ApApoD2 was 0.380, with an FDR-corrected P-value of 0.163. Neither reached the significant differential expression threshold (FDR < 0.01 and |log2FC| ≥ 1). These results further demonstrate that the dsApApoD3 designed in this invention has high specificity for the target gene and did not cause inhibition of the expression of paralogous genes ApApoD1 and ApApoD2.

[0072] Table 4. Transcriptome sequencing (RNA-seq) analysis of non-target ApoD paralogous genes after dsApApoD3 treatment

[0073] Example 4: Effect of ApApoD3 silencing on hydrocarbon accumulation in the epidermis of pea aphids This embodiment aims to quantitatively detect the changes in the total amount of hydrocarbons and n-alkane components of each carbon chain length in the epidermis of pea aphids after ApApoD3 gene silencing using gas chromatography-mass spectrometry (GC-MS), thereby directly verifying the function of ApApoD3 in the formation of the epidermal lipid barrier.

[0074] 4.1 Insect treatment and sample collection Following the method described in 3.3 of Example 3, third-instar nymphs were injected with either dsApApoD3 or dsMuslta (negative control), and then transferred to broad bean seedlings. They were reared at 18°C, 70% relative humidity, and a 16-hour light / 8-hour dark photoperiod. Insects were collected 72 hours after dsRNA injection. The control group (dsMuslta) had 6 biological replicates, and the dsApApoD3 treatment group had 5 biological replicates. Each biological replicate used 4 aphids, with a fresh weight of approximately 10 mg.

[0075] 4.2 Extraction of hydrocarbons from the epidermis The test insect was placed in a 2 mL glass sample vial, and 200 μL of HPLC-grade n-hexane containing n-tetracosane as an internal standard was added. Extraction was performed at room temperature with shaking for 2 min. The extraction was repeated twice, each time using 200 μL of fresh n-hexane. The three extracts were combined, for a total of 600 μL. The combined extract was purified using a microcolumn containing 300 mg of activated silica gel, eluted with 2 mL of n-hexane. The eluent was concentrated to near dryness under a nitrogen stream, reconstituted with 50 μL of n-hexane, and transferred to an automated sample vial for analysis.

[0076] 4.3 GC-MS Detection Conditions GC-MS analysis was performed using a Thermo Fisher gas chromatography-mass spectrometry system (Thermo Fisher Scientific, USA), equipped with an Agilent HP-5 MS UI column (30 m × 0.32 mm × 0.25 μm). Helium was used as the carrier gas at a constant flow rate of 1.0 mL / min. The injection volume was 1 μL, using splitless injection mode, and the injection port temperature was 300 °C. The column oven temperature program was: 60 °C for 2 min, ramped to 320 °C at a rate of 5 °C / min, and held at 320 °C for 10 min. The mass spectrometer transfer line temperature was 280 °C, and the detector operated in electron impact ionization (EI) mode. Quantification of skin hydrocarbons was performed using Thermo Fisher software, calculated by normalizing the peak areas of each component relative to the internal standard peak area of ​​n-tetracosane.

[0077] 4.4 Changes in total skin hydrocarbon content like Figure 3 As shown in Figure A, compared with the dsMuslta-injected control group, the accumulation of total hydrocarbons (CHCs) on the pea aphid epidermis was significantly reduced in the dsApApoD3-injected group. Specifically, the total CHC content in the dsApApoD3-injected group was reduced by 28.69% compared with the control group.

[0078] 4.5 Changes in n-alkane components of different chain lengths Further analysis was conducted on the n-alkane components at various carbon chain lengths. For example... Figure 3 As shown in B, nine straight-chain n-alkanes were detected in the hydrocarbon extract from the pea aphid epidermis, with carbon chain lengths ranging from n-C25 to n-C33. After silencing ApApoD3, seven of the nine n-alkanes showed a significant decrease. Specifically, n-C25 decreased by 42.75%, n-C26 by 32.19%, n-C27 by 33.12%, n-C28 by 32.28%, n-C29 by 23.62%, n-C30 by 38.63%, and n-C32 by 66.48% (all percentage decreases compared to the dsMuslta control group). Although n-C31 and n-C33 showed a decreasing trend, the differences did not reach statistical significance.

[0079] The above results indicate that ApApoD3 is essential for the normal accumulation of medium- and long-chain n-alkanes (especially n-C25–n-C30 and n-C32) in the pea aphid, with the most significant effect on the longer-chain n-C32 alkanes (reducing them by 66.48%). This is the first time that GC-MS analysis of epidermal hydrocarbon components has demonstrated that ApApoD3 participates in regulating the accumulation of epidermal hydrocarbons in the pea aphid, particularly affecting the steady-state maintenance of medium- and long-chain n-alkane components.

[0080] Example 5: Effects of ApApoD3 silencing on water balance and drought tolerance in pea aphids This embodiment evaluates the effect of ApApoD3 silencing on the water balance and drought tolerance of pea aphids by measuring the body water content, water loss rate, and survival under severe drought conditions of pea aphids after ApApoD3 silencing.

[0081] 5.1 Determination of insect body moisture content and water loss rate Third-instar nymphs injected with dsApApoD3 or dsMuslta were recovered on broad bean seedlings for 48 h before being transferred to a severely drought-stricken environment with relative humidity below 5% and temperature of 18°C ​​for dehydration experiments. Each treatment was set up with 3 biological replicates, with 15 aphids per replicate.

[0082] The initial fresh weight (Mf) of each replicate test insect was measured using an Entris® II analytical balance (Sartorius, Germany). After 12 h of severe drought treatment, the insect weight was measured (M12h), and then the insects were dried in a 60°C oven for 7 h to obtain the absolute dry weight (Md). The water content rate (WCR) and water loss rate (WLR) were calculated using the following formulas: ; ; Among them, M f For the initial fresh weight, M 12h The weight after 12 hours of severe drought treatment, M d This is the absolute dry weight after drying.

[0083] like Figure 3 As shown in Figure C, compared with the dsMuslta control group, the water content of pea aphids in the dsApApoD3 treatment group was significantly reduced, with a reduction of 19.44%.

[0084] like Figure 3 As shown in Figure D, after 12 hours of severe drought treatment, the water loss rate of pea aphids in the dsApApoD3 treatment group increased significantly, approximately 2.05 times that of the dsMuslta control group.

[0085] 5.2 Construction of survival curves under severe drought conditions Third-instar nymphs injected with dsApApoD3 or dsMuslta were recovered on broad bean seedlings for 48 h before being transferred to a severely drought-stricken environment with relative humidity below 5% and temperature of 18°C. Each treatment was performed in triplicate, with 15 aphids per replicate. Mortality was recorded every 12 h, and observation continued until 60 h or all test insects had died.

[0086] Survival curves were constructed using the Kaplan-Meier method, and the Mantel-Cox log-rank test was used to compare the differences in intact survival distribution between the dsApApoD3 treatment group and the dsMuslta control group. Survival status of the two groups of insects was compared at 12 h, 24 h, 36 h, and 48 h using a two-tailed Fisher's exact test, and Holm's method was used for multiple comparison correction.

[0087] like Figure 3 As shown in E, the Kaplan-Meier survival analysis results indicate that ApApoD3 silencing significantly shortens the survival time of pea aphids under severe drought conditions, and there is a significant difference in the complete survival distribution between the dsApApoD3 treatment group and the dsMuslta control group (Mantel-Cox test, P < 0.01).

[0088] After time-point specificity comparisons and multiple comparison corrections, at 36 h, all test insects in the dsApApoD3 treatment group had died, with a survival rate of 0%, while 26.67% of test insects in the dsMuslta control group remained alive. The difference between the two groups was significant (P < 0.01), meaning the survival rate of the dsApApoD3 treatment group was 26.67 percentage points lower than that of the dsMuslta control group. At 12 h, 24 h, and 48 h, the differences in survival status between the two groups did not reach statistical significance.

[0089] The above results indicate that silencing ApApoD3 reduced the water content of pea aphids by 19.44%, increased the water loss rate to approximately 2.05 times that of the control group, and accompanied by a decrease in survival ability under severe drought conditions. Combined with the decrease in epidermal hydrocarbon content after ApApoD3 silencing, this suggests that ApApoD3 is involved in the physiological processes related to pea aphid epidermal hydrocarbon homeostasis, water retention, and drought tolerance, providing experimental evidence for ApApoD3 as a candidate target for drought-sensitized RNA interference.

[0090] Example 6: Effect of ApApoD3 silencing on the reproductive capacity of pea aphids This embodiment evaluates the effect of ApApoD3 silencing on the reproductive capacity of pea aphids by detecting the cumulative reproduction of pea aphids after ApApoD3 gene silencing.

[0091] Third-instar nymphs injected with dsApApoD3 or dsMuslta were transferred to fresh broad bean seedlings and reared at 18°C, 70% relative humidity, and a 16-hour light / 8-hour dark photoperiod. Each treatment had three biological replicates, with at least 30 aphids per replicate. Cumulative reproduction was recorded every 12 hours after the emergence of nymphs, expressed as the cumulative number of nymphs produced per adult aphid, and observation continued for up to 120 hours.

[0092] Reproductive data were analyzed using two-way repeated-measures ANOVA, and the Sidak method was used to perform multiple comparison corrections on the differences between the dsApApoD3 treatment group and the dsMuslta control group at each observation time point.

[0093] like Figure 3 As shown in Figure F, during the observation period of 12 h to 120 h, the cumulative average reproduction rate of the dsApApoD3 treatment group at each observation time point was significantly lower than that of the dsMuslta control group. At 12 h and 24 h, the differences between the dsApApoD3 treatment group and the dsMuslta control group reached a highly significant level (P < 0.01); at each observation time point from 36 h to 120 h, the differences between the two groups reached a significant level (P < 0.05).

[0094] The above results indicate that silencing the ApApoD3 gene significantly reduces the cumulative reproduction rate of pea aphids, suggesting that ApApoD3 is associated with reproductive-related phenotypes in pea aphids. Combined with the findings that ApApoD3 silencing reduces insect body water content, increases water loss rate, and decreases survival ability under severe drought conditions, ApApoD3 silencing can simultaneously produce phenotypes related to individual survival and reproduction, providing experimental support for ApApoD3 as a candidate molecular target for RNA interference control in pea aphids.

[0095] Example 7: Transcriptome response and differentially expressed genes in pea aphids after ApApoD3 silencing This embodiment aims to analyze the systemic transcriptional reprogramming events that occur in pea aphids after ApApoD3 silencing at the whole transcriptome level using transcriptome sequencing (RNA-seq) technology, and to reveal the molecular response network after epidermal barrier damage.

[0096] 7.1 Transcriptome Sequencing Sample Preparation and Sequencing Third-instar nymphs injected with dsApApoD3 or dsMuslta were collected from broad bean seedlings after a 48-hour recovery period. Three biological replicates were set up for each treatment, with 40 aphids per replicate. Total RNA was extracted using TRIzol reagent, requiring an RNA integrity value (RIN) > 7.0. One μg of RNA was taken from each replicate, and a library was constructed using the Hieff NGS Ultima mRNA Library Prep Kit (Yisheng Biotechnology, China). The library was sequenced at both ends (150 bp paired ends) on an Illumina NovaSeq 6000 platform (Illumina, USA).

[0097] Raw sequencing data were filtered and quality-controlled using FASTP software to obtain high-quality clean reads. The clean reads were then aligned to the pea aphid reference genome (v2.0) using HISAT2 software. Gene expression levels were quantified using FPKM (Fragments Per Kilobase of transcript per Million mapped reads). Differentially expressed genes (DEGs) were identified using the DESeq2 software package, with a screening threshold of False Discovery Rate (FDR) < 0.01 and |log2FC| ≥ 1. Functional annotation (aligned to Nr, Swiss-Prot, Pfam, etc.) and GO (Gene Ontology) / KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment analysis of differentially expressed genes were performed using the clusterProfiler R software package.

[0098] 7.2 Principal Component Analysis like Figure 4 As shown, the Principal Component Analysis (PCA) results indicate that Principal Component 1 (PC1) and Principal Component 2 (PC2) explained 37.55% and 20.82% of the total variance, respectively. The dsApApoD3 treatment group ( Figure 4 Group B (blue circle, n=3) and the dsMuslta control group ( Figure 4 The global gene expression profiles of Group A (red square, n=3) show clear separation in principal component space. Figure 4 This indicates that silencing ApApoD3 induced systemic transcriptional reprogramming in the pea aphid.

[0099] 7.3 Identification of Differentially Expressed Genes like Figure 5 As shown in Figure A, the volcano plot illustrates the overall distribution of differentially expressed genes between the dsApApoD3 treatment group and the dsMuslta control group. After ApApoD3 silencing, a total of 187 differentially expressed genes were identified in the pea aphid (FDR < 0.01 and |log2FC| ≥ 1). Among them, 112 genes were significantly upregulated (…). Figure 5 (Red dot in A), 75 genes were significantly downregulated ( Figure 5 Genes that did not meet the differential expression screening criteria (blue dots in A) are represented by gray dots.

[0100] 7.4 GO functional enrichment analysis of differentially expressed genes like Figure 5 As shown in B, GO functional enrichment analysis of 187 differentially expressed genes showed that the differentially expressed genes were mainly significantly enriched in 6 key pathways ( Figure 5 B), these pathways can be categorized into two main functional modules: (1) Toxicity response and oxidative stress modules: Differentially expressed genes were significantly enriched in the "response to toxic substance" and "iron ion binding" pathways. This result indicates that ApApoD3 deletion triggers significant stress signals at the transcriptional level, activating the body's defense response network associated with toxic metabolites and iron ion binding.

[0101] (2) Neuroendocrine regulation module: Notably, a large number of differentially expressed genes were highly enriched in the neuropeptide activity, hormone activity, and G protein-coupled receptor binding pathways. Key functional genes within this module all showed highly significant upregulation and high enrichment factors. This transcriptome feature suggests that ApApoD3 knockdown not only affects the maintenance of basal homeostasis but also triggers widespread disruption and reprogramming of the neuropeptide-GPCR-hormone signaling network.

[0102] 7.5 Validation of Paralogous Gene Specificity Based on RNA-seq data, the expression changes of ApApoD1 and ApApoD2 after dsApApoD3 treatment were specifically examined. As shown in Table 4, the log2 FC of ApApoD1 was 0.401, with an FDR-corrected P-value of 0.338; the log2 FC of ApApoD2 was 0.380, with an FDR-corrected P-value of 0.163, neither reaching the threshold for significant differential expression (FDR < 0.01 and |log2FC| ≥ 1). These results provide direct transcriptomic evidence for the specificity of dsApApoD3 for its target genes (see also 3.5 in Example 3).

[0103] Example 8: RT-qPCR validation of differentially expressed genes and detection of metabolite content in vivo This embodiment aims to independently validate differentially expressed genes related to lipid metabolism and epidermal structure identified in transcriptome sequencing using RT-qPCR, and to detect changes in the content of major lipid and carbohydrate metabolites in pea aphids after ApApoD3 silencing, so as to verify the physiological and metabolic effects of ApApoD3 silencing from multiple dimensions.

[0104] 8.1 RT-qPCR Validation of Differentially Expressed Genes Based on transcriptome sequencing results, four differentially expressed genes related to lipid metabolism and epidermal structure were selected for independent RT-qPCR validation. Specifically, these are: fatty acid synthase gene ApFASN (fatty acid synthesis, XM_029486512.1), epidermal protein 8 gene ApCPR8 (epidermal structure, XM_008183441.3), (11Z)-hexadecanoyl-11-enoyl-CoA conjugate enzyme gene ApZ11-ECC (hydrocarbon-related metabolism, XM_016802171.2), and acyl-CoA-binding domain protein 5 gene ApACBD5 (acyl-CoA metabolism, XM_016802794.2). Primer sequences are shown in Table 2. Insects were collected 48 h after dsRNA injection, with three biological replicates per treatment and five aphids per replicate. Total RNA extraction, reverse transcription, and RT-qPCR were performed as described in Example 2, Section 2.1, using Rps20 as an internal control gene.

[0105] The results are as follows Figure 5 As shown in Figure C, compared with the dsMuslta control group, the transcript abundance of the above four genes was significantly reduced in the dsApApoD3 treatment group. Specifically, ApFASN decreased by 38.08%, ApCPR8 by 63.90%, ApZ11-ECC by 52.80%, and ApACBD5 by 32.81%. Figure 5 C).

[0106] The above results are consistent with the transcriptome sequencing data, verifying that the expression of genes involved in fatty acid supply (ApFASN), epidermal structure formation (ApCPR8), hydrocarbon-related metabolism (ApZ11-ECC), and acyl-CoA metabolism (ApACBD5) was suppressed after ApApoD3 silencing, further confirming the multi-pathway molecular response after epidermal lipid barrier damage at the transcriptional level.

[0107] 8.2 Detection of the content of major lipid and carbohydrate metabolites in the body To evaluate the internal metabolic changes caused by ApApoD3 silencing, the contents of phospholipids (PL), total cholesterol (TC), triglycerides (TG), and trehalose in pea aphids were measured.

[0108] Aphids were collected 48 h after dsRNA injection, with three biological replicates per treatment and 30 aphids per replicate. The content of each metabolite was determined using a commercial assay kit (Suzhou Grease Biotechnology Co., Ltd., China). Aphid tissues were homogenized in their respective extraction solvents (anhydrous ethanol for phospholipids and total cholesterol, a dedicated buffer for triglycerides, and distilled water for trehalose), centrifuged, and the supernatant was incubated with the specific working reagent according to the manufacturer's instructions. Absorbance was measured using a microplate reader: phospholipids were measured at 600 nm, and triglycerides, total cholesterol, and trehalose were measured at 510 nm. Metabolite concentrations were calculated using the manufacturer's specific formula and normalized to the fresh weight of the sample.

[0109] The results are as follows Figure 5 D to Figure 5 As shown in G: Compared with the dsMuslta control group, the phospholipid (PL) content in pea aphids was significantly reduced by 41.69% after treatment with dsApApoD3. Figure 5 D); Triglyceride (TG) content decreased significantly by 56.96% ( Figure 5 F); Total cholesterol (TC) levels showed no significant change ( Figure 5 E); Trehalose content increased significantly by 74.76% ( Figure 5 G).

[0110] The above metabolite detection results indicate that ApApoD3 silencing does not indiscriminately disrupt all lipid classes, but rather exhibits a degree of selectivity: the significant decrease in phospholipids and triglycerides suggests that ApApoD3 is involved in maintaining neutral lipid and membrane lipid homeostasis in aphids, while the lack of significant change in total cholesterol content indicates that this gene does not broadly act on all lipid transport processes. The significant increase in trehalose (74.76%) suggests that under conditions of epidermal barrier damage and accelerated water loss, aphids may initiate an osmotic protection and / or energy compensation mechanism mediated by trehalose, which may be a systemic metabolic compensatory response to water loss stress.

[0111] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. Pea aphid ( Acyrthosiphon pisum The use of the apolipoprotein D3 gene ApApoD3 as an RNA interference target in the preparation of products for the control of pea aphids, characterized in that... The product reduces the reproductive capacity and / or the survival ability of pea aphids under drought conditions by lowering the expression level of the ApApoD3 gene in pea aphids.

2. The use according to claim 1, characterized in that, Lowering the expression level of the ApApoD3 gene reduces the hydrocarbon content in the epidermis of the pea aphid.

3. The use according to claim 2, characterized in that, The skin hydrocarbons include n-alkanes.

4. The use according to claim 3, characterized in that, Lowering the expression level of the ApApoD3 gene reduces the content of one or more n-alkanes in the epidermis of pea aphids, namely n-C25, n-C26, n-C27, n-C28, n-C29, n-C30, and n-C32.

5. The use according to any one of claims 1 to 4, characterized in that, Lowering the expression level of the ApApoD3 gene reduces the water content of pea aphids and / or increases their rate of water loss, thereby reducing their survival ability under drought conditions.

6. The use according to any one of claims 1 to 5, characterized in that, RNA interference agents used to reduce ApApoD3 gene expression levels are double-stranded RNAs that target ApApoD3 mRNA.

7. A double-stranded RNA targeting the ApApoD3 mRNA gene of the pea aphid, characterized in that, The double-stranded RNA comprises a double-stranded region formed by two complementary RNA strands, the double-stranded region comprising a 300 nt RNA sequence corresponding to the 300 bp nucleotide sequence shown in SEQ ID NO:1, wherein thymine T is replaced by uracil U.

8. A double-stranded DNA transcription template for preparing the double-stranded RNA of claim 7, characterized in that, The double-stranded DNA transcription template contains a 300 bp nucleotide sequence as shown in SEQ ID NO:1, and the two ends of the 300 bp nucleotide sequence are respectively connected to T7 RNA polymerase promoter sequences for in vitro transcription to prepare the double-stranded RNA.

9. An RNA interference product for controlling pea aphids, characterized in that, The product comprises the double-stranded RNA as described in claim 7.

10. A method for controlling pea aphids, characterized in that, This includes administering an effective amount of the double-stranded RNA of claim 7 into the pea aphid to reduce the expression level of the ApApoD3 gene in the pea aphid, thereby reducing the pea aphid's reproductive capacity and / or its survival under drought conditions.

Images