Osmunda japonica male sterility gene and application thereof

Abstract

The present application relates to a male sterility gene of Oenanthe stolonifera and application thereof, and belongs to the technical field of plant genetic engineering and molecular breeding. The present application obtains a male sterility gene with a nucleotide sequence as shown in SEQ ID NO. 1 by using mitochondrial genome data of male sterility material of Oenanthe stolonifera. According to the three-dimensional structure, it is predicted that the male sterility gene has the effect of destroying NADH dehydrogenase, causing pollen abortion and leading to male sterility. Based on the gene, the present application further provides a primer pair for screening male sterility material of Oenanthe stolonifera, including primers with nucleotide sequences as shown in SEQ ID NO. 11 and SEQ ID NO. 12. Experimental results show that the primer pair provided by the present application can accurately and efficiently detect whether the male sterility gene is contained in the Oenanthe stolonifera to be tested, and further screen the male sterility material of Oenanthe stolonifera. The present application creates a new method for screening male sterility material of Oenanthe stolonifera, which is helpful for hybrid breeding of Oenanthe stolonifera.

Description

Technical Field

[0001] This invention relates to the fields of plant genetic engineering and molecular breeding technology, and in particular to a male sterility gene for ovate watercress and its application. Background Technology

[0002] Water celery ( Oenanthe javanica (Bl.) DC.) is a perennial aquatic vegetable belonging to the genus *Oenanthe* in the family Apiaceae. It has a long history of cultivation and abundant germplasm resources. It is rich in nutrients, containing various bioactive functional substances, and is a vegetable with both medicinal and edible uses. In the *Flora of China*, *Oenanthe* is classified into 9 species and 1 variety, namely: *Oenanthe brevichorus* (…). O. benghalensis Bentll. et Hook.), Alpine watercress ( O. hookeri CB Clarkein Hook. F.), Ovate-leaved watercress ( O. javanica subsp. rosthornji (Diels) FT Pu), water celery, Chinese water celery ( O. sinensis Dunn), Watercress ( O. linearis Wall. ex Dc.), Mengzi water celery ( O. linearis subsp. Rivularis (Dunn) CY Wu et FT Pu, multilobed watercress ( O. thomsonii C. B. clarke), Southwest water celery ( O. dielsii de Boiss. var. dielsii and its variety, fine-leaved watercress ( O. dielsii *De Boiss.* var. *stenophylla de Boiss.* Currently, water celery is widely cultivated and has great development potential. However, water celery breeding has long been stagnant and slow, and hybrid vigor has not been well utilized. On the one hand, water celery is mainly propagated by cuttings, and sexual (seed) propagation is rarely used in production. This has led to the degeneration of water celery varieties, resulting in poor disease resistance and marketability. On the other hand, the hermaphroditic nature of water celery flowers, their small size, numerous flowers, and flower development characteristics make it difficult to obtain hybrid varieties through hybridization. Furthermore, water celery seeds contain inhibitory substances and often have poor seed development, resulting in low germination rates and difficulty in germination. Therefore, the discovery of male-sterile water celery materials and their utilization through hybridization breeding will be key to solving the problems in the development of its industry.

[0003] Male sterility includes two types: nuclear sterility and cytoplasmic sterility (including nucleocytoplasmic male sterility). For vegetable breeding, cytoplasmic male sterility, which is genetically stable, is generally chosen because male sterility is largely controlled by mitochondrial genes. Mitochondria, as important organelles in eukaryotes, have DNA ranging from 200 kb to 3 Mb in size, and their genomes exhibit diverse conformations, such as single-loop, linear, and multi-loop. The published mitochondrial genomes of umbelliferous plants are mostly single-loop structures, such as celery, water celery, carrot, and celery slender-leaved celery. The discovery of male-sterile materials is a valuable tool for creating new materials through hybridization in small-flowered crops, with significant research results in umbelliferous vegetable crops (celery and carrot). Further research indicates that mitochondrial open reading frames (ORFs) exhibit higher complexity due to their active recombination sequences, generating new sequences or genes (new open reading frames), thus leading to sterility, for example, in rice. orf352 ,chili orf456 ,tomato orf137 ,radish orf463a ,rape orf138 In the study of male sterility in water celery, male sterile lines and their candidate genes have been published in species or varieties such as Liyang white celery (a local type of water celery), water celery, multilobed water celery, and linear-leaved water celery, but no reports have been published for ovate-leaved water celery.

[0004] Currently, several male-sterile materials have been found in crops belonging to the Apiaceae family (such as carrots, celery, and fennel), and the relevant sterility genes have been identified. Studies have shown that male sterility in these crops is mostly controlled by mitochondrial genes. Carrots have a relatively large number of reported candidate sterility genes, such as... atp6 , atp8 , atp9 , Cox 1 , Cox 2 , nad3 and cob In celery, the two reported cases of infertility were both caused by mitochondria. Cox 1 The mutation caused it. Mitochondria have been reported in fennel. atp6 The 5' end deletion of the gene is the cause of its infertility. Five cases of male-sterile materials have been reported in water celery: two multilobed water celery species (named 'OtBY001' and 'OtBY002'), two water celery species (named 'OJBY001' and 'LYSQBU001'), and one linear water celery species (named 'ODDBY001') exhibiting male sterility. Among these, the multilobed water celery OtBY002 exhibits male sterility due to mitochondrial deletion. ccmFN Gene mutations lead to infertility; male infertility in both 'Liyang White Celery' LYSQBU001 and 'Line-leaved Water Celery' ODDBY001 is caused by mitochondrial mutations. atp6The mutation (5' deletion) is the cause. However, the presence of male-sterile material and the gene causing male sterility in *Cercis ovatus* has not been reported. Summary of the Invention

[0005] The purpose of this invention is to provide a male sterility gene for *Cercidiphyllum ovatum* and its application, in order to solve the problems existing in the prior art. The primer pair provided by this invention can accurately and efficiently detect whether the male sterility gene is present in *Cercidiphyllum ovatum* to be tested, thereby screening sterile *Cercidiphyllum ovatum* materials.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a male sterility gene for ovate watercress, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The present invention also provides a primer pair for amplifying the male sterility gene of the above-mentioned watercress, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer as shown in SEQ ID NO.12.

[0008] The present invention also provides the application of the above-mentioned male sterility gene of ovoid watercress or the above-mentioned primer pair in the preparation of products for screening male sterility materials of ovoid watercress.

[0009] Furthermore, the product is a reagent kit.

[0010] The present invention also provides a product for screening male-sterile materials of ovoid water celery, comprising the above-mentioned primer pair.

[0011] Furthermore, the product is a reagent kit.

[0012] The present invention also provides the application of the above-mentioned male sterility gene of ovoid water celery, or the above-mentioned primer pair, or the above-mentioned product in identifying whether ovoid water celery is a male sterile material.

[0013] This invention also provides a method for identifying whether water celery (Cercis ovatus) is a male-sterile material, comprising the following steps: Total RNA was extracted from the ovary-leaved water celery samples for testing, and cDNA was synthesized. Using the primer pairs described above, the cDNA was amplified by PCR, and the PCR products were collected. The PCR products were subjected to electrophoresis, staining, and development, and the bands were interpreted. The interpretation band is: If a single 500 bp band is amplified, the tested ovarian cress sample is identified as male-sterile material.

[0014] The present invention also provides the application of the above-mentioned male sterility gene of ovoid watercress, or the above-mentioned primer pair, or the above-mentioned product in screening male sterility materials of ovoid watercress.

[0015] This invention also provides a method for screening male-sterile materials of ovoid water celery, comprising the following steps: Total RNA was extracted from the ovary-leaved water celery samples for testing, and cDNA was synthesized. Using the primer pairs described above, the cDNA was amplified by PCR, and the PCR products were collected. The PCR products were subjected to electrophoresis, staining, and development, and the bands were interpreted. The interpretation band is: If a single 500 bp band is amplified, the tested ovoid-leaf water celery sample is retained as male-sterile material for ovoid-leaf water celery hybridization breeding.

[0016] The present invention discloses the following technical effects: This invention utilizes mitochondrial genome data of male-sterile *Celosia ovata* to obtain a male-sterile gene with the nucleotide sequence shown in SEQ ID NO. 1. Based on its three-dimensional structure, this male-sterile gene is predicted to disrupt NADH dehydrogenase, causing pollen abortion and thus male sterility. Based on this male-sterile gene, this invention also provides primer pairs for screening male-sterile *Celosia ovata* materials, including primers with nucleotide sequences shown in SEQ ID NO. 11 and SEQ ID NO. 12. Experimental results show that the primer pairs provided by this invention can accurately and efficiently detect whether *Celosia ovata* contains this male-sterile gene, thereby screening for male-sterile *Celosia ovata* materials. This invention creates a new method for screening male-sterile *Celosia ovata* materials, which is helpful for hybridization breeding of *Celosia ovata*. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 Obtained from watercress OrBY001 and OrKY001 ORF121 and ORF121-KY Image showing the results of gene nucleotide sequence alignment; Figure 2 The amino acid sequence alignment results of ORF121 and ORF121-KY proteins obtained from OrBY001 and OrKY001 of watercress are shown in the figure; where the black boxes indicate conserved regions. Figure 3 Three-dimensional structural diagrams of ORF121 and ORF121-KY proteins; red circles indicate extended segments. Figure 4 Electrophoresis results of ORF121 and 5'-ORF121 in watercress OrBY001 and OrKY001. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] This invention obtained male-sterile material from wild water celery in Majiang County, Guizhou Province, cloned and analyzed its male-sterile gene, and serves the development of the water celery industry.

[0025] Specifically, this invention uses male-sterile OrBY001 and fertile OrKY001 of water celery as materials. Through analysis of mitochondrial genome, transcriptome, and other data, it was found that the sterility of OrBY001 is due to mitochondrial factors. nad5 and nad1 A 354bp sequence was inserted between them to form a new open reading frame. ORF121 This sequence, which leads to male sterility in water celery, was cloned by PCR. The sequencing results were then analyzed using I-TASSER software on an online website (https: / / I-TASSER server for protein structure and function prediction) to predict the three-dimensional structure of the protein. This study aims to provide a reference for the regulatory network of male sterility in water celery, laying the foundation for breeding new varieties and expanding the water celery industry.

[0026] Example 1 1. Watercress with egg-leaf leaves ORF121 Acquisition of genes Using the water celery genome published by the Guizhou Provincial Institute of Horticulture, and combining it with the OrBY001 and OrKY001 genome databases, sequences with ORF frame lengths of 2007 bp and 1653 bp were obtained through assembly and splicing using software such as DNAMAN and BioEdit Sequence Alignment Editor. A pair of cloning primers was designed based on these sequences, consisting of forward primers F1 and F2 and a reverse primer R1.

[0027] F1: AAGCTGGATGATAAGATAGGGAAT, SEQ ID NO.5; F2: AACAACCATTTAAGGTGAATAGCA, SEQ ID NO.6; R1: GAGAGAATCGAGGACATGCGA, SEQ ID NO. 7.

[0028] 2. Watercress with egg-leaf leaves ORF121 Cloning of genes Leaves and petioles of *Oryza sativa* (OrBY001 and OrKY001) were ground into powder using liquid nitrogen. Total RNA was extracted using a chloroform-free plant total RNA extraction kit (Beijing Biotech Co., Ltd., Beijing) according to the manufacturer's instructions. The purity and concentration of the extracted RNA were determined using 1.5% agarose gel and a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies Inc., USA). Subsequently, cDNA was synthesized using the HiScript 1st Strand cDNA kit (Novizan Biotechnology Co., Ltd., Nanjing) according to the manufacturer's instructions. The synthesized cDNA was diluted 15-fold with sterile ddH2O and used as a template for gene cloning.

[0029] The PCR cloning system was 50 μL: 25 μL. Ex Taq mix (TaKaRa, Dalian), 3 μL DNA template, 3 μL each of forward and reverse primers, and 16 μL of sterile ddH2O.

[0030] The PCR reaction program was as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 70 s, for 34 cycles; extension at 72℃ for 10 min, followed by storage at 4℃.

[0031] The target fragment was separated by 1.2% agarose gel electrophoresis, and the DNA was recovered using an agarose gel DNA recovery kit (Soluble Biotech, Beijing). The recovered PCR product was ligated into the pMD18-T cloning vector, and the ligated vector was transformed into *E. coli* DH5α using a heat shock method (42°C, 60 s). a Above. After passing through a solution containing AMP (ampicillin, 100 mg / L) -1 Plate screening was performed, followed by inverted incubation for 12 hours. Single colonies were then picked for identification via shaking and culture PCR. Correctly identified *E. coli* strains were sent to Nanjing GenScript Biotech Co., Ltd. for sequencing. The cloned gene sequences were assembled and spliced ​​using DNAMAN and BioEdit Sequence Alignment Editor software to obtain complete sequences. ORF121 Gene.

[0032] 3. Watercress with egg-leaf leaves ORF121 Biological information analysis of genes For the data obtained from OrBY001 ORF121 Genes and the corresponding genes obtained from OrKY001 (named) ORF121-KY The gene sequence was analyzed, and the cloned gene was processed using BioXM 2.6 software. ORF121 Genes and the above ORF121-KYGenes are translated into amino acid sequences.

[0033] Sequence alignment results as follows Figure 1 As shown, the data obtained in OrBY001 ORF121 The gene is 2007 bp in length, and its nucleotide sequence is shown in SEQ ID NO.1; it encodes the ORF121 protein, with an amino acid sequence of 668 aa, as shown in SEQ ID NO.2; while the OrKY001 obtained ORF121-KY The 5' end of the gene is relatively long ORF121 The gene is 354 bp short, and its nucleotide sequence is shown in SEQ ID NO.3; it encodes the ORF121-KY protein, which has an amino acid sequence of 550 aa, as shown in SEQ ID NO.4.

[0034] SEQ ID NO.1:

[0035] SEQ ID NO.2: 。

[0036] SEQ ID NO.3:

[0037] SEQ ID NO.4: .

[0038] Use DNAMAN software to process the above. ORF121 Genes and ORF121-KY Gene alignment and mapping showed that OrBY001... ORF121 The gene extends 354 bp at the 5' end, while the 3' end is similar to that in OrKY001. ORF121-KY The gene sequences are identical.

[0039] The three-dimensional structure prediction analysis of the two proteins mentioned above was performed using the online software I-TASSER (https: / / I-TASSER server for protein structure and function prediction).

[0040] like Figure 2 and Figure 3As shown, amino acid sequence alignment analysis revealed two conserved regions (DVGRKWVIDNVY and SMYSSAFKMGP, SEQ ID NO. 8 and SEQ ID NO. 9) at the C-terminus of ORF121 and ORF121-KY proteins, while OrBY001 showed one conserved region (MHRIKIRLDD, SEQ ID NO. 10) at the N-terminus. Three-dimensional structural analysis indicated that both proteins contain a tightly folded core domain, while only OrBY001 exhibits a flexible N-terminal extension of 118 aa. Sequence analysis showed that this N-terminal extension possesses high flexibility and hydrophobicity, which may mediate the localization of ORF121 protein in the mitochondrial membrane.

[0041] Structural comparison shows that the ORF121 protein is similar to Staphylococcus aureus (…). Gluconobacter oxydans The toxin, N-ethylmaleimide reductase (6ymwA), exhibits very high structural similarity. These results indicate that the ORF121 protein possesses DNA-binding and DNA-dependent RNA polymerase activity, and is a mitochondrial-targeting protein that functions by participating in the transcription of the mitochondrial genome; its aberrant expression leads to pollen sterility (male sterility).

[0042] 4. Watercress with egg-leaf leaves ORF121 Gene function prediction Known nad5 and nad1 The ORF121 protein encodes key subunits of mitochondrial respiratory chain complex I (NADH dehydrogenase), which are involved in energy metabolism (oxidative phosphorylation). The 118 amino acids at the N-terminus of the ORF121 protein target mitochondria and can cleave them. nad5 and nad1 The encoded complex I (NADH dehydrogenase) transcript leads to impaired mitochondrial respiratory function and a decrease in ATP levels. Simultaneously, this protein specifically activates auxin signaling, redistributes reactive oxygen species (ROS) in chloroplasts / peroxosomes, causing elevated ROS levels and resulting in abnormal intercellular communication. Existing research has found that the primary cause of abnormal vacuolation in microspores is insufficient ATP, while elevated ROS levels further exacerbate oxidative damage, ultimately leading to pollen abortion, i.e., male sterility.

[0043] 5. Watercress with egg-leaf leaves ORF121 Gene verification Figure 4 As shown in Figure A, in OrBY001 and OrKY001 ORF121 and ORF121-KYThe gene fragment lengths are approximately 2000 bp and 1600 bp, respectively. This is to verify the presence of ovoid-leaved watercress in OrBY001. ORF121 The structural characteristics of the genes, based on OrBY001 and OrKY001 ORF121 Based on the gene sequence alignment results, specific primers were designed at the 5' end where the differences between the two sequences are greatest. The primer sequences are as follows: F: AAGCTGGATGATAAGATAGGGAAT, SEQ ID NO.11; R: ATAAAGATTCTTCAAGATATCATAT, SEQ ID NO. 12.

[0044] PCR amplification was performed using genomic DNA from OrBY001 and OrKY001 as templates, and the results are as follows: Figure 4 As shown in Figure B, a specific band of approximately 500 bp was amplified only in OrBY001, while no corresponding amplification product was found in OrKY001. This result confirms that OrBY001... ORF121 There is a specific sequence of about 500 bp at the 5' end of the gene, but this sequence is missing in OrKY001.

[0045] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A male sterility gene for ovate-leaved watercress, characterized in that, The nucleotide sequence of the male sterility gene of the ovary watercress is shown in SEQ ID NO.

1.

2. A primer pair for amplifying the male sterility gene of ovoid watercress according to claim 1, characterized in that, This includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer as shown in SEQ ID NO.

12.

3. The use of the male sterility gene of ovoid watercress according to claim 1 or the primer pair according to claim 2 in the preparation of products for screening male sterility materials of ovoid watercress.

4. The application as described in claim 3, characterized in that, The product in question is a reagent kit.

5. A product for screening male-sterile materials of ovoid-leaved water celery, characterized in that, Includes the primer pair as described in claim 2.

6. The product as described in claim 5, characterized in that, The product in question is a reagent kit.

7. The use of the male sterility gene of celosia ovata as described in claim 1, the primer pair as described in claim 2, or the product as described in claim 5 or 6 in identifying whether celosia ovata is a male sterile material.

8. A method for identifying whether *Cymbidium ovatum* is a male-sterile material, characterized in that, Includes the following steps: Total RNA was extracted from the ovary-leaved water celery samples for testing, and cDNA was synthesized. The cDNA was amplified by PCR using the primer pair as described in claim 2, and the PCR products were collected. The PCR products were subjected to electrophoresis, staining, and development, and the bands were interpreted. The interpretation band is: If a single 500 bp band is amplified, the tested ovarian cress sample is identified as male-sterile material.

9. The use of the male sterility gene of octopus according to claim 1, the primer pair according to claim 2, or the product according to claim 5 or 6 in screening male sterility materials of octopus.

10. A method for screening male-sterile materials of *Celtis oleracea*, characterized in that, Includes the following steps: Total RNA was extracted from the ovary-leaved water celery samples for testing, and cDNA was synthesized. The cDNA was amplified by PCR using the primer pair as described in claim 2, and the PCR products were collected. The PCR products were subjected to electrophoresis, staining, and development, and the bands were interpreted. The interpretation band is: If a single 500 bp band is amplified, the tested ovoid-leaf water celery sample is retained as male-sterile material for ovoid-leaf water celery hybridization breeding.

Images