A nucleic acid molecule heh1 for shortening the heading stage of rice and its application

Abstract

The present application belongs to the field of genetic engineering, and particularly relates to a nucleic acid molecule HEH1 and application thereof. The present application creates a nucleic acid molecule HEH1 with the function of shortening the heading period of rice.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a nucleic acid molecule HEH1 and its applications. Background Technology

[0002] Rice (Oryza sativa L.) is my country's largest grain crop, with over 60% of the population relying on it as their staple food. In the rice-growing areas of southern my country, multiple cropping systems such as oilseed rice rotation and tobacco-rice rotation place strict requirements on the heading period of rice varieties—early rice needs to mature appropriately to make way for subsequent crops, and late rice also needs to head at the right time to avoid the low temperatures of autumn. However, many high-yield and high-quality rice varieties currently promoted in production have a longer heading period, making it difficult to adapt to the cropping requirements of multiple cropping systems. Therefore, shortening the rice heading period is of great significance for increasing the multiple cropping index and making full use of temperature and light resources.

[0003] The heading stage of rice is jointly regulated by intrinsic genetic factors and external light and temperature conditions. In the photoperiod regulatory network, the florigen genes Hd3a and RFT1 occupy a central position in the regulatory pathway; they are the final outputters of flowering signals and directly determine the timing of the transition from vegetative to reproductive growth in rice. Furthermore, upstream heading stage genes (such as Ehd1, Ghd7, and Hd1) control the timing of heading by regulating the transcriptional levels of Hd3a and RFT1.

[0004] In recent years, CRISPR / Cas9 gene editing technology has provided a new means for the precise improvement of rice heading time. Existing technologies have reported altering the heading time by editing the coding region of the inflorescence gene; however, complete knockout of the coding region often leads to excessive delay in heading or even failure to flower, severely negatively impacting yield. Editing the non-coding regions of flowering genes (such as promoters, 5'UTR, and 3'UTR) holds promise for achieving "fine-tuning" rather than "shutting down" gene expression, thereby regulating the heading time. However, many existing technologies have delayed the heading time by editing the UTR regions of rice genes such as PRR37, Hd3a, and RFT1 (CN122060774A); patents CN108841855A and CN117625602A also disclose methods for delaying rice flowering / heading time by editing the OsEhd1 promoter region. Although patent CN118165985A discloses a method for creating early-maturing rice varieties by editing the OsEhd1 promoter region, the OsEhd1 gene is located upstream of the regulation of Hd3a and RFT1. Changes to the OsEhd1 promoter cannot affect other genes regulating Hd3a and RFT1, potentially causing early-maturing rice to fail under certain conditions. Therefore, directly editing the Hd3a and RFT1 gene promoters to obtain novel promoters that shorten the heading period of rice will help ensure the stability of the early-maturing trait in rice, offering a more advantageous technical effect.

[0005] However, since existing technologies for editing the Hd3a and RFT1 promoters both lead to a delay in the heading period, it remains uncertain whether a shortening of the heading period can actually be achieved. Summary of the Invention

[0006] The purpose of this invention is to provide a novel nucleic acid molecule.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] The present invention provides a nucleic acid molecule, characterized in that: the sequence of the nucleic acid molecule is shown in SEQ ID NO. 6.

[0009] The present invention also provides an expression cassette, characterized in that it is formed by sequentially linking the above-mentioned nucleic acid molecule, the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO. 2, and the terminator of the sequence shown in SEQ ID NO. 3.

[0010] In some embodiments, the nucleotide sequence of the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO. 2 is as shown in SEQ ID NO. 4 or SEQ ID NO. 5.

[0011] The present invention also provides a method for shortening the heading period of rice, characterized in that: the rice genome region sequence shown in SEQ ID NO. 1 of the rice to be improved is artificially modified to the sequence shown in SEQ ID NO. 6, and rice plants with shortened heading period are selected.

[0012] The present invention also provides the application of the above-mentioned nucleic acid molecule, or the above-mentioned expression cassette, or the above-mentioned method in shortening the heading period of rice.

[0013] The present invention also provides a method for detecting whether rice contains the above-mentioned nucleic acid molecules, characterized in that: a genomic DNA sample of rice to be tested is used as a template, and PCR amplification is performed using primer pairs 5'-ACGGGTTGATAAGTTGCGGAA-3' and 5'-GCTCGGTCAGTGTACTGCATG-3'; the sequence of the amplified product is detected to match the above-mentioned nucleic acid molecules.

[0014] The innovation and beneficial effects of this invention are as follows: Given the complexity and unpredictability of the Hd3a regulatory region, this invention obtains a novel nucleic acid molecule, HEH1, which has the technical effect of shortening the heading period of rice. Attached Figure Description

[0015] Figure 1 Editing diagram.

[0016] Figure 2 Diagram of gene editing vector.

[0017] Figure 3 Image of the Hd3a mutant during the heading stage. Detailed Implementation

[0018] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0019] As used herein, “rice” means any rice plant and includes all plant varieties that can be bred with rice, including the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which the plant can regenerate, plant callus, and complete plant cells in a plant or plant part, such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, etc. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' direction; amino acid sequences are written from left to right in the amino to carboxyl direction. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Committee on Biochemical Nomenclature. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, “nucleic acid” includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and, unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the basic properties of natural nucleotides and hybridize with single-stranded nucleic acids in a manner similar to that of naturally occurring nucleotides. As used herein, the term “encoding” or “encoded” in the context of a particular nucleic acid means that the nucleic acid contains the necessary information to guide the translation of that nucleotide sequence into a particular protein. Codons are used to represent the information encoding the protein. As used herein, “full-length sequence” referring to a particular polynucleotide or the protein it encodes means the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. Full-length polynucleotides encode the full-length, catalytically active form of that particular protein. The terms “polypeptide” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. This term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. This term is also used for naturally occurring amino acid polymers. The terms “residue” or “amino acid residue” or “amino acid” are used interchangeably in this document to refer to an amino acid incorporated into a protein, polypeptide, or peptide (collectively, “protein”). Amino acids can be naturally occurring amino acids, and unless otherwise limited, may include known analogs of natural amino acids that can function in a similar manner to naturally occurring amino acids.

[0020] As used herein, the terms "isolated" and "purified" may be used interchangeably to refer to nucleic acids or polypeptides or their biologically active portions, which are substantially or essentially free of components typically associated with or reacting with the nucleic acid or polypeptide as found in their natural environment. Thus, when isolated or purified nucleic acids or polypeptides are produced using recombinant techniques, they are substantially free of other cellular material or culture media, or when isolated or purified nucleic acids or polypeptides are chemically synthesized, they are substantially free of chemical precursors or other chemicals. "Isolated" nucleic acids typically do not contain sequences (such as protein-coding sequences) naturally flanking the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid may comprise a nucleotide sequence of less than about 0.5 kb naturally flanking the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.

[0021] In this application, the terms "comprising," "including," or variations thereof should be understood to include other elements, numbers, or steps besides those described. "Test plant" or "test plant cell" refers to a plant or plant cell in which genetic modification has taken effect, or a progeny cell of such a modified plant or cell containing the modification. "Control," "control plant," or "control plant cell" provides a reference point for measuring phenotypic changes in the test plant or plant cell. Control plants or plant cells may include, for example: (a) wild-type plants or cells, i.e., plants or cells with the same genotype as the genetic modification starting material, the genetic modification producing the test plants or cells; (b) plants or plant cells with the same genotype as the starting material but transformed with an empty construct (i.e., a construct with no known effect on the target trait, such as a construct containing the target gene); (c) plants or plant cells that are non-transformed isomers of the test plants or plant cells; (d) plants or plant cells that are genetically identical to the test plants or plant cells but not exposed to conditions or stimuli that would induce the expression of the target gene; or (e) the test plants or plant cells themselves, which are under conditions where the target gene is not expressed.

[0022] Those skilled in the art will readily recognize that advances in molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, have provided a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequences and potential gene sequences of proteins of interest in agriculture.

[0023] In some embodiments, the nucleotide sequence of this application may be modified to perform conserved amino acid substitutions. Principles and examples of conserved amino acid substitutions are further described below. In some embodiments, the nucleotide sequence of this application may be substituted without altering the amino acid sequence according to disclosed monocotyledonous codon preferences; for example, a codon encoding the same amino acid sequence may be substituted with a codon preferred by monocotyledons without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application may be substituted with a different codon encoding the same amino acid sequence, thereby changing the nucleotide sequence without altering the encoded amino acid sequence. Conserved variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiments due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in this application may be substituted according to a codon preferred by monocotyledons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side-chain substituents, such as the hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituents having the various properties considered above are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978), *Atlas of Protein Sequence and Structure* (Natl. Biomed. Res. Found., Washington, D. C.) (incorporated herein by reference). Conserved substitutions, such as replacing one amino acid with another amino acid having similar properties, can be performed. Sequence identity verification includes hybridization techniques. For example, a known nucleotide sequence, in whole or in part, can be used as a probe for selective hybridization with other corresponding nucleotide sequences present in cloned genomic DNA fragments or cDNA fragment groups (i.e., genomic libraries or cDNA libraries) from a selected organism.

[0024] In some embodiments, a fragment of a nucleotide sequence and the amino acid sequence it encodes is also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide of an embodiment or a portion of the amino acid sequence of a polypeptide. A fragment of the nucleotide sequence may encode a protein fragment that retains the biological activity of the native or corresponding full-length protein and thus has protein activity. Mutant proteins include biologically active fragments of native proteins containing consecutive amino acid residues that retain the biological activity of the native protein. Some embodiments also include transformed plant cells or transgenic plants containing a nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed using an expression vector containing a nucleotide sequence of at least one embodiment and a promoter operatively linked thereto that drives expression in plant cells. Transformed plant cells and transgenic plants represent plant cells or plants whose genome contains a heteropolynucleotide. Generally, the heteropolynucleotide is stably integrated into the genome of the transformed plant cell or transgenic plant to pass the polynucleotide to offspring. The heteropolynucleotide may be integrated into the genome alone or as part of an expression vector. In some embodiments, the plants involved in this application include plant cells, plant protoplasts, plant cell tissue cultures capable of regenerating plants, plant callus, plant masses, and plant cells that are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, fruits, ears, husks, straw, roots, root tips, anthers, etc. This application also includes plant cells, protoplasts, tissues, callus, embryos, flowers, stems, fruits, leaves, and roots derived from transgenic plants of this application or their progeny, and thus at least partially containing the nucleotide sequences of this application.

[0025] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s *Molecular Cloning: A Laboratory Manual* (Sambrook J & Russell DW, 2001), or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available and conventional methods well known to those skilled in the art.

[0026] Example

[0027] Example 1: Hd3a promoter element analysis and target design

[0028] The inventors intend to achieve the technical effect of regulating the heading period of rice by editing the Hd3a promoter. They used PLACE (https: / / www.dna.affrc.go.jp / PLACE / ?action=newplace), an online plant 5' cis-regulatory element analysis software, to analyze the cis-regulatory elements on the Hd3a promoter. The results showed that the cis-regulatory elements on the Hd3a promoter are mainly distributed at positions -1274 to -31 (Table 1).

[0029]

[0030] Continued from the table above

[0031]

[0032] Target sites in the densely populated cis-elements region were analyzed using the online software CRISPR-GE (http: / / skl.scau.edu.cn / ). Five target sites were selected based on GC content and off-target probability: T6, T7, T8, T9, and T10. The sequences of each target site are as follows: T6: GAGCGATTAGCTAAACTTTT; T7: GGCTATATCAACTGTCAAAC; T8: ACTACGACGTCGACTGCTGC; T9: AGTGAAAGTTGGACATGGACA; T10: GGGTTTTTTGCAAGATCGA (the last base A comes from the first base of the start codon ATG).

[0033] Example 2: Targeted editing operation of the Hd3a regulatory region

[0034] Nucleic acid molecules encoding sgRNA molecules were synthesized based on the target sequence. These sgRNA molecules can recognize the designed target sequence. CRISPR / Cas9 editing vectors pZZT 560, pZZT 561, pZZT 562, and pZZT 563 were constructed. These vectors are commonly used in rice gene editing operations in this field and can express sgRNA that recognizes the target sequence and the editing enzyme Cas9 in rice, while also carrying the antibiotic resistance gene required for genetic transformation (see vector diagram). Figure 2 (Taking pZZT 560 as an example, the other vectors only differ in target sequence). The target identified by each vector is as follows: pZZT 560: T6+T7, pZZT 561: T7+T8, pZZT 562: T8+T9, pZZT 563: T9+T10.

[0035] The editing vector was transferred into Agrobacterium strain EHA105 and infected embryogenic callus induced by the restorer line R1607 seeds. After routine infection, co-culture, screening, differentiation and rooting, positive transformed plants were obtained and propagated.

[0036] Example 3: Identification of the genotype and phenotype of edited plants

[0037] Lines with successfully mutated promoter regions were screened using DNA fragment PCR amplification and sequencing. A total of seven lines showed Hd3a promoter mutations. The heading date of these seven plants was investigated in a test site in Nanning, Guangxi in March 2026, as shown in Table 2. Among them, the HEH1 material had the shortest heading date, only 90.33 ± 0.47 days, the shortest among all edited materials, while other agronomic traits remained unchanged, and the plant growth was good. Figure 3 It has the best application prospects.

[0038]

[0039] This invention further develops a detection method for HEH1 material. Specifically, primers 5'-ACGGGTTGATAAGTTGCGGAA-3' and 5'-GCTCGGTCAGTGTACTGCATG-3' are designed on both sides of the promoter mutation site. The target fragment is detected by PCR amplification and agarose gel electrophoresis, and then the fragment is recovered and sequenced to confirm that it is the HEH1 sequence.

[0040] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A nucleic acid molecule, characterized by: The nucleic acid molecule sequence is shown in SEQ ID NO.

6.

2. An expression box, characterized in that: It is formed by sequentially linking the nucleic acid molecule as described in claim 1, the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO. 2, and the terminator of the sequence shown in SEQ ID NO.

3.

3. The expression box according to claim 2, characterized in that: The nucleotide sequence of the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO. 2 is shown in SEQ ID NO. 4 or SEQ ID NO.

5.

4. A method for shortening the heading period of rice, characterized in that: The rice genome region sequence shown in SEQ ID NO. 1 of the rice to be improved was artificially modified to the sequence shown in SEQ ID NO. 6, and rice plants with shortened heading period were selected.

5. The application of the nucleic acid molecule of claim 1, or the expression cassette of any one of claims 2-3, or the method of claim 4 in shortening the heading period of rice.

6. A method for detecting whether rice contains the nucleic acid molecule described in claim 1, characterized in that: Using the genomic DNA sample of the rice to be tested as a template, PCR amplification was performed using primer pairs 5'-ACGGGTTGATAAGTTGCGGAA-3' and 5'-GCTCGGTCAGTGTACTGCATG-3'; the sequence of the amplified product was then detected to match the nucleic acid molecule described in claim 1.

Images