Chrysanthemum tcaCX3 gene and its application in cis-jasmone synthesis

Abstract

The application discloses a Tansy TcACX3 gene and application thereof in cis-Jasmone synthesis. The application first separates an acyl-CoA oxidase gene TcACX3 from Tansy, and when the gene is co-expressed with ACS, MFP and KAT genes, the endogenous substrate can be catalytically converted into cis-Jasmone with high efficiency. The application realizes the biosynthesis of cis-Jasmone in cells of Nicotiana benthamiana, Escherichia coli, Saccharomyces cerevisiae, Yarrowia lipolytica or Bacillus subtilis through whole-cell catalysis or heterologous expression fermentation strategy. The application fills the research blank of the biosynthesis of cis-Jasmone, provides a basis for realizing large-scale biosynthesis pathway production, and has good research potential and wide application prospect.

Description

Technical Field

[0001] This invention relates to the fields of synthetic biology and metabolic engineering, and more specifically, to the pyrethrum TcACX3 gene and its application in cis-Jasmone synthesis. Background Technology

[0002] cis-jasmone ( cis Jasmone is a naturally occurring volatile organic compound found in plants. Its unique chemical structure endows it with a wide variety of biological activities, making it highly valuable in the fields of daily chemicals, food, and modern agriculture. In the daily chemical and food industries… cis Jasmone possesses a delicate and lasting jasmine fragrance with a lively fruity note, making it a core ingredient in the formulation of high-end jasmine perfumes, cosmetics, and daily chemical fragrances. It is also widely used in various flavored foods to enhance sensory quality. In modern agriculture, as a key jasmonic acid derivative, it can induce a systemic defense response in plants, effectively repelling pests such as aphids while attracting their natural enemies (such as parasitic wasps). Therefore, it has enormous application potential in green agriculture and nematode control.

[0003] current, cis The commercial production of Jasmone relies primarily on two methods: natural extraction and chemical synthesis, both of which face significant bottlenecks. While natural extraction can provide "natural-grade" products, it is limited by the growth cycle of raw materials such as jasmine (e.g., short flowering period, low yield), extraction efficiency (yield of only a few ten-thousandths), and high separation costs. Chemical synthesis offers advantages such as high yield, relatively controllable costs, and freedom from natural conditions, but faces severe challenges related to environmental regulations and sustainable development. In contrast, although biosynthesis (utilizing microbial fermentation or enzyme catalysis) is considered a green and sustainable production approach, it still faces three core challenges: first, incomplete biosynthetic pathway analysis leads to difficulties in heterologous reconstruction; second, low chassis cell efficiency results in insufficient enzyme activity and intermediate product toxicity; and third, imbalanced metabolic flux regulation leads to insufficient precursor supply and product titers far below industrial standards.

[0004] In conclusion, although cis Jasmone shows great market potential in the spices and agriculture sectors, but to truly achieve industrial application, it still needs to focus on innovation across the entire chain: "gene mining - pathway reconstruction - chassis optimization - process enhancement." Specifically, it should leverage gene mining and metabolic engineering techniques to improve... cis The synthesis of Jasmone aims to develop novel biomanufacturing technologies or integrated processes that can substantially overcome current rate-limiting steps in biosynthesis, significantly improve catalytic efficiency, and ultimately achieve economic viability throughout the entire process. This is crucial for promoting... cisThe green transformation of Jasmone-related industries is of decisive significance. Summary of the Invention

[0005] To address the aforementioned technical problems, the present invention aims to provide a pyrethrum TcACX3 gene and its application in cis-Jasmone synthesis, offering a novel, efficient functional gene and complete technical solution for pyrethol production in yeast, thus solving the problem of the inability to synthesize and produce pyrethol in Saccharomyces cerevisiae in existing technologies. This invention is the first to clone and functionally identify an acyl-CoA oxidase gene (TcACX3) from the pyrethrum (Tanacetum cinerariifolium). Experiments have demonstrated that when TcACX3 is co-expressed with AtOPCL, AtMFP, and AtKAT genes derived from Arabidopsis thaliana, or with TcACS, TcMFP, and TcKAT genes derived from pyrethrum, it can efficiently catalyze the production of cis-Jasmone from endogenous substrates.

[0006] To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows: In a first aspect, the present invention provides a pyrethrum TcACX3 gene, its homologous gene or a variant thereof, the nucleotide sequence of which is shown in SEQ ID NO.1, or a sequence having at least 85% identity with the nucleotide sequence shown in SEQ ID NO.1. For example, a sequence having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0007] As some specific embodiments of the present invention, the pyrethrum TcACX3 gene belongs to the acyl-CoA oxidase gene, has the LXXD motif, and has the activity of catalyzing acyl-CoA.

[0008] Secondly, the present invention provides a protein encoded by the pyrethrum TcACX3 gene, the amino acid sequence of which is shown in SEQ ID NO. 2, or an amino acid sequence having at least 85% identity with the amino acid sequence shown in SEQ ID NO. 2, and containing the conserved regions shown by amino acids 17-132, 134-247, and 478-655 in SEQ ID NO. 2, and having acyl-CoA oxidase activity. For example, a sequence having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0009] Thirdly, the present invention provides a gene combination comprising the pyrethrum TcACX3 gene as described above, its homologous gene or a variant thereof; The gene ACS encodes acetyl-CoA ligase; MFP, a gene encoding the activity of multifunctional proteins; And the gene KAT that encodes 3-ketoacyl-CoA thiolytic enzyme.

[0010] As some specific embodiments of the present invention, the gene ACS encoding acetyl-CoA ligase includes the TcACS gene derived from pyrethrum or the AtACS gene derived from Arabidopsis thaliana; the nucleotide sequence of the TcACS gene is as shown in SEQ ID NO. 3, or is a sequence having at least 85% identity with the nucleotide sequence shown in SEQ ID NO. 3, for example, a sequence having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0011] As some specific embodiments of the present invention, the gene MFP encoding multifunctional protein activity includes the TcMFP gene derived from pyrethrum or the AtMFP gene derived from Arabidopsis thaliana; the nucleotide sequence of the TcMFP gene is as shown in SEQ ID NO.4, or is a sequence having at least 85% identity with the nucleotide sequence shown in SEQ ID NO.4, for example, a sequence having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0012] As some specific embodiments of the present invention, the gene KAT encoding 3-ketoacyl-CoA thiolytic enzyme includes the TcKAT gene derived from pyrethrum or the AtKAT gene derived from Arabidopsis thaliana; the nucleotide sequence of the TcKAT gene is as shown in SEQ ID NO. 5, or is a sequence having at least 85% identity with the nucleotide sequence shown in SEQ ID NO. 5, for example, a sequence having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0013] As some specific embodiments of the present invention, each gene in the gene combination is independently controlled by a constitutive promoter or an inducible promoter.

[0014] Fourthly, the present invention provides a method for production cis - Jasmone's recombinant host cells, which simultaneously express the following four enzymes: (a) The protein encoded by the pyrethrum TcACX3 gene; (b) Proteins possessing acetyl-CoA ligase activity; (c) Proteins with multifunctional protein activity; (d) Proteins with 3-ketoacyl-CoA thiolytic activity.

[0015] As some specific embodiments of the present invention, the host cell is selected from any one of the following: tobacco benthamiana, Escherichia coli, Saccharomyces cerevisiae, Yersinia lipolytica, and Bacillus subtilis cells.

[0016] Fifthly, the present invention provides the use of the pyrethrum TcACX3 gene, its homologous gene or variant thereof, the protein encoded by the pyrethrum TcACX3 gene, gene combinations or recombinant host cells in the synthesis of cis-Jasmone as described in any of the preceding claims.

[0017] In a sixth aspect, the present invention provides a method for producing cis-Jasmone, the method comprising whole-cell catalysis or heterologous expression fermentation.

[0018] As one embodiment of the present invention, the whole-cell catalysis includes: using a cell expressing a protein encoded by the gene combination as described in any of the preceding claims as a whole-cell catalyst, contacting it with dodecaoxadienoic acid, and catalyzing the acquisition of cis-Jasmone.

[0019] As one embodiment of the present invention, the whole-cell catalysis specifically includes the following steps: mixing cells expressing the protein encoded by the gene combination as described in any of the above claims with a reaction system containing dodecaoxadienoic acid to carry out a whole-cell catalytic reaction; then separating and purifying cis-Jasmone from the reaction product; wherein the conditions for the whole-cell catalytic reaction are: temperature 25-37℃, pH 6.0-8.0, and reaction time 24-72 hours.

[0020] As one embodiment of the present invention, the heterologous expression fermentation includes: culturing a host cell containing the gene combination as described in any of the preceding claims, and isolating cis-Jasmone from the culture.

[0021] As one embodiment of the present invention, the heterologous expression fermentation specifically includes the following steps: inoculating host cells containing the gene combination described in any of the above-mentioned methods into a fermentation medium, fermenting under suitable conditions, inducing the expression of each gene in the gene combination, so that the host cells convert dodecaoxadienoic acid to cis-Jasmone during growth, and separating and purifying cis-Jasmone from the fermentation product. The host cells are selected from any one of *Nicotiana benthamiana*, *Escherichia coli*, *Saccharomyces cerevisiae*, *Yarrowia lipolytica*, and *Bacillus subtilis* cells. The fermentation conditions can be routinely optimized according to the selected host cells, for example, temperature 25-37℃, pH 6.0-8.0, fermentation time 24-72 hours, and an inducer can be added for induced expression.

[0022] Compared with the prior art, the present invention has the following beneficial effects: 1) This invention cloned an acyl-CoA oxidase gene TcACX3 from pyrethrum. By heterologously expressing this gene with ACS, MFP, and KAT and integrating it into host cells (such as Nicotiana benthamiana, Escherichia coli, Saccharomyces cerevisiae, Yersinia lipolytica, Bacillus subtilis, etc.), the biosynthesis of cis-Jasmone was successfully achieved.

[0023] 2) The TcACX3 of the present invention can serve as a key gene for the biosynthesis of cis-Jasmone. It can catalyze the formation of 3,7-ddh-JA from dodecaoxadienoic acid (cis-OPDA), followed by spontaneous decarboxylation to form cis-Jasmone. This provides a new approach for preparing engineered strains that produce high-yield cis-Jasmone, has good industrial application potential, and meets the growing demand from consumers. Attached Figure Description

[0024] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1 Phylogenetic analysis of the TcACX3 gene; Figure 2 This is a schematic diagram of the pathway for the co-catalytic synthesis of cis-Jasmone by the TcACX3 gene and the AtOPCL, AtMFP, and AtKAT genes. Figure 3 To validate the function of the TcACX3 protein. Detailed Implementation

[0025] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.

[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0027] The liquid culture medium formulation in this embodiment of the invention is as follows: LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride; Kana-LA medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar powder, 50 μg / mL kanamycin; Kana-LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 50 μg / mL kanamycin; Sc-Ura-Liquid Culture Medium: 20 g / L yeast extract, 40 g / L peptone, 40 g / L glucose, 1.5 g / L amino acid mixture (-Ura, purchased from Shanghai Yuanye Biotechnology Co., Ltd., product code S28160-20g), 6.7 h / L YNB (containing ammonium sulfate, purchased from Shanghai Yuanye Biotechnology Co., Ltd., product code S34927-500g); Fermentation liquid culture medium: 20 g / L yeast extract, 40 g / L peptone, 40 g / L glucose, 20 g / L galactose.

[0028] Example 1: Bioinformatics analysis of the pyrethrum TcACX3 gene Using pyrethrum leaves, stems, roots, and flowers as experimental materials, transcriptome analysis of pyrethrum tissues was performed using next-generation high-throughput sequencing (RNS-seq). Through co-expression and correlation analysis, one ACX gene was identified. The protein expressed by this gene exhibits acyl-CoA oxidase characteristics, and this gene was named TcACX3. The TcACX3 gene was analyzed using relevant databases and bioinformatics software. The main findings are as follows: (1) CD-search searches for conserved domains of the TcACX3 protein; (2) ProtParam analysis of the basic physicochemical properties of TcACX3 protein; (3) Muscle 5.1 software was used to perform homology comparison of TcACX3 protein, and Fasttree 2.1.11 software was used to construct a phylogenetic tree.

[0029] 1. Analysis of conserved domains of the protein encoded by the TcACX3 gene The conserved domains of the TcACX3 gene-encoded protein were searched using CD-search in NCBI. The results are shown in Table 1. The TcACX3 protein possesses three conserved Acyl-CoA oxidase domains, located at 17-132 aa (Acyl-CoA_ox_N), 134-247 aa (Acyl-CoA_dh_M), and 478-655 aa (ACOX), respectively. The TcACX3 protein belongs to the Acyl-CoA oxidase protein family, a key enzyme family in plant fatty acid metabolism. Its expression is induced by abiotic stresses (such as high temperature, low temperature, salt stress, and drought) and biotic stresses, and it participates in the synthesis of the important plant hormone jasmonic acid.

[0030] Table 1. Conserved domain analysis of TcACX3 protein

[0031] 2. Physicochemical properties analysis of the protein encoded by the TcACX3 gene The basic physicochemical properties of the TcACX3 protein were predicted and analyzed using ExPaSy-ProtParam. The results showed that the TcACX3 protein contains 663 amino acids, has a relative molecular mass of 74.41 KD, a theoretical isoelectric point of 8.12, and an instability parameter of 35.35, classifying it as a stable protein. Its average hydrophobicity is -0.186, classifying it as a soluble protein.

[0032] 3. Protein sequence alignment To comprehensively analyze the structural characteristics of the TcACX3-encoded protein, this invention selected proteins derived from Artemisia annua (based on the protein sequences of ACX family members reported in the literature). Artemisia annua Arabidopsis thaliana ( ) Arabidopsis thaliana ),chrysanthemum( Chrysanthemum nankingense ) and chamomile ( Chrysanthemum lavandulifolium Twenty-four ACX protein sequences from different plants, including [list of plants], were analyzed using Muscle software for homology sequence alignment, and a phylogenetic tree was constructed using Fasttree software. The results are as follows: Figure 1 As shown, TcACX3 is derived from Artemisia annua ( A. annua PWA73349.1 and chrysanthemum ( C. nankingense The highest homology is found in Cn1526080.

[0033] The nucleotide sequence of the wild-type pyrethrum TcACX3 gene of this invention is shown in SEQ ID NO.2, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.1.

[0034] Example 2: Spontaneous decarboxylation of 3,7-ddh-JA to form cis-Jasmone 1 mg of 3,7-ddh-JA (3,7-didehydro-JA, 3,7-didehydrojasmonic acid, PubChem CID: 9855819) standard was placed at 25℃ for 0 h, 8 h, 16 h, 30 h, 42 h, 54 h, and 72 h, respectively. Then, 500 μL of ethyl acetate was added to the reaction system to terminate the reaction. After thorough shaking and mixing, the mixture was allowed to stand and separate into layers. The upper ethyl acetate layer was collected as the sample to be tested. The organic phase was analyzed by liquid chromatography-mass spectrometry (LC-MS). The contents of 3,7-ddh-JA and cis-Jasmone in the sample were determined, and the percentages of these two components were calculated. Table 2 shows that after 30 hours of standing, approximately 45% of 3,7-ddh-JA spontaneously decarboxylated to form cis-Jasmone; after 72 hours of standing, all of 3,7-ddh-JA was converted to cis-Jasmone. cis -jasmone, demonstrating that 3,7-ddh-JA can spontaneously decarboxylate to form cis-jasmone.

[0035] Table 2. Spontaneous decarboxylation time progression of 3,7-ddh-JA

[0036] Example 3: Cloning and functional verification of the pyrethrum TcACX3 gene like Figure 2 As shown, to verify whether the screened pyrethrum TcACX3 gene has a synergistic effect with the gene encoding acetyl-CoA ligase (ACS), the gene encoding a multifunctional protein (MFP), and the gene encoding 1-3-ketoacyl-CoA thiolase (KAT) in catalyzing the synthesis of cis-Jasmone from cis-OPDA, the pyrethrum TcACX3 gene needed to be cloned from the pyrethrum genome and heterologously expressed as a protein. The Arabidopsis-derived AtACX (NM_117778.8), AtACS (NBCI:NM_101901.4), AtMFP (NBCI:NM_119045.5), and AtKAT (NBCI:NM_128874.4) gene sequences were obtained through total synthesis.

[0037] 3.1 Total RNA was extracted from flower tissue at the S2 stage of pyrethrum using a plant RNA extraction kit. cDNA was then synthesized via reverse transcription and used as a template for cloning the full-length sequence of the aforementioned gene. Using the full-length CDS sequence of the TcACX3 gene predicted by transcriptome sequencing as a template, the full-length sequence was amplified. The primer sequences for PCR amplification are as follows: Primer sequences used for amplifying the TcACX3 gene: Forward primer F: ACAAAAAAGCAGGCTTAGATGAATGGATGGAGTGGATTAC (SEQ ID NO.9); Reverse primer R: TACAAGAAAGCTGGGTACTCTATAGCTTAGCAGAGTGTTAAC (SEQ ID NO.10).

[0038] PCR reactions were performed using the Vazyme Phanta® Max Super-Fidelity DNA Polymerase system. The reaction conditions included: pre-denaturation at 95°C for 3 min; followed by 35 cycles, each consisting of 95°C for 15 s, annealing at 55-60°C for 15 s, extension at 72°C for 90 s, and a final extension at 72°C for 5 min. The resulting PCR products were purified and recovered using the Gel DNA Extraction Mini Kit (Vazyme, DC301-01). The PCR product fragments were ligated into the pET-28a (Merck Millipore, 69864) expression vector using the Gibson assembly method.

[0039] 3.2 Obtaining monoclonal transformants Transforming pET-28a(+)-TcACX3 into E. coli (such as DH5α) suitable for plasmid amplification is carried out through the following steps: 500 ng of the Gibson assembly reaction product (i.e., the constructed recombinant plasmid pET-28a(+)-TcACX3) is added to E. coli DH5α competent cells in the logarithmic growth phase. After mixing by pipetting and aspiration, the cells are incubated in a 42°C water bath for about 90 seconds. Subsequently, the transformed cells are plated on the corresponding Kana-LA medium and cultured at 37°C for 1 day to obtain single-clone transformants.

[0040] Gene sequences such as AtACS, AtMFP, AtKAT, and AtACX were linked into the pET-28a(+) vector through whole-genome synthesis. After sequencing and enzyme digestion, the clones were identified as correct and plasmids were extracted for later use.

[0041] 3.3 Inoculate single-clone transformants into Kana-LB liquid medium and culture until the logarithmic growth phase. Take 5 mL of culture medium, centrifuge, and collect the bacterial cells. Extract plasmid DNA using the FastPure Plasmid Mini Kit (DC201-01). Transform the pET-28a(+)-TcACX3 plasmid into a suitable E. coli strain for protein expression (e.g., Rosetta DE3). The transformation steps are the same as in 3.2. The procedures for pET-28a(+)-AtACS, pET-28a(+)-AtMFP, pET-28a(+)-AtKAT, and pET-28a(+)-AtACX plasmids are the same. Inoculate single-clone transformants into Kana-LB liquid medium to obtain seed culture.

[0042] 3.4 The seed culture was inoculated into 5 mL of LB medium and cultured at 37℃ and 220 rpm. After approximately 4 h of culture, IPTG (isopropyl galactothioglycoside) was added to the culture system to a final concentration of 0.1 mM for protein expression induction. The culture was then maintained at 18℃ and 220 rpm for 18 h. The cells were collected by centrifugation at 4000 rpm for 8 min, and resuspended in 5 mL of enzyme reaction buffer. Subsequently, the cells were disrupted using an ultrasonic cell disruptor, with a 3 s sonication interval followed by a 6 s pause, for a total of 15 min. The recombinant protein was purified by nickel column affinity chromatography using the 6×-His tag of the vector, and the protein concentration was determined.

[0043] 3.5 The obtained recombinant proteins were subjected to in vitro enzymatic reactions. The reaction system was as follows: 50 mM ATP, 50 mM acetyl-CoA, 5% MgCl2, 50 μM substrate cis-OPDA, and 5 μg purified TcACX3, AtACS, AtMFP, AtKAT, and AtACX proteins. The reaction was carried out in combination with TcACX3+AtACS+AtMFP+AtKAT and AtACS+AtMFP+AtKAT+AtACX, respectively. The reaction system was incubated at 25 ℃ and 220 rpm for 18 h.

[0044] 3.6 After the reaction was complete, 10 μL of 1M hydrochloric acid was added to the system to adjust the pH to approximately 5. Then, 500 μL of ethyl acetate was added, and the mixture was thoroughly shaken and allowed to stand for phase separation. The upper ethyl acetate layer was collected as the sample to be analyzed. The organic phase was analyzed using liquid chromatography-mass spectrometry (LC-MS). The analysis was based on the characteristic ion fragments of the target compound cis-Jasmone (EIC = [M+H)). + =165) was extracted and analyzed. The results are as follows: Figure 3As shown, the combination of proteins from Arabidopsis thaliana (AtACS+AtMFP+AtKAT+AtACX) cannot catalyze the formation of cis-Jasmone from cis-OPDA, but it can catalyze the formation of cis-Jasmone from cis-OPDA only after being combined with TcACX3 from pyrethrum (TcACX3+AtACS+AtMFP+AtKAT).

[0045] Example 4: Transient expression of multi-source β-oxidation genes combined with TcACX3 in *Nicotiana benthamiana* catalyzes the synthesis of cis-OPDA into 3,7-ddh-JA and cis-Jasmone. This embodiment utilizes four key enzymes (ACX, ACS, MFP, KAT) in the fatty acid β-oxidation pathway in *Nicotiana benthamiana* (… Nicotiana benthamiana In the process of synergistic catalysis of cis-OPDA, 3,7-ddh-JA is generated, and partially spontaneous decarboxylation is performed to generate cis-Jasmone. Tomato-derived SlACX, Arabidopsis-derived AtACX, Arabidopsis-derived AtACS, Arabidopsis-derived AtMFP, and Arabidopsis-derived AtKAT genes, and pyrethrum-derived TcACX3, TcACS, TcMFP, and TcKAT genes were selected. Among these, the pyrethrum-derived TcACX3, TcACS, TcMFP, and TcKAT genes were obtained by PCR amplification (specific steps are the same as in Example 3.1), and the tomato-derived SlACX (NM_001247729.3) gene sequence was obtained by total synthesis. The following four gene combinations were designed for the above genes: Table 3 Transient gene combinations expressed in *Tobacco Benzois*.

[0046] Note: The numbers in parentheses are from the NCBI website or are serial numbers in this invention.

[0047] The primer sequences used to amplify the TcACX3 gene derived from pyrethrum have been described in section 3.1; The primer sequences used to amplify the TcACS gene are shown below: Forward primer F (SEQ ID NO.11): CAAAAAAGCAGGCTTAGTCGACATGGAAAAATCCGGCTACGGTC; Reverse primer R (SEQ ID NO.12): CAAGAAAGCTGGGTACTCGAGTTACATTTTCGATTTAACTTGTGC.

[0048] The primer sequences used to amplify the TcMFP gene are shown below: Forward primer F (SEQ ID NO.13): CAAAAAAGCAGGCTTAGTCGACATGGTCGGAAAAACAACGATCTC; Reverse primer R (SEQ ID NO.14): CAAGAAAGCTGGGTACTCGAGTTACAACCGTGATTTTGCTTG.

[0049] The primer sequences used to amplify the TcKAT gene are shown below: Forward primer F (SEQ ID NO.15): CAAAAAAGCAGGCTTAGTCGACATGGCCCCAGCAGCTGTAGTTG; Reverse primer R (SEQ ID NO.16): CAAGAAAGCTGGGTACTCGAGTTACAGAAGTTCCACAACG.

[0050] 4.1 Construction of plant expression vectors and Agrobacterium-mediated transformation Using a multi-fragment seamless cloning technique (such as Gibson Assembly), the four target genes from each of the above combinations were placed under the control of independent strong plant promoters (CaMV 35S) and terminators, and tandemly assembled into a plant binary expression vector (pEAQ-HT). The constructed recombinant plasmids were introduced into Agrobacterium tumefaciens (GV3101) competent cells via electroporation or freeze-thaw methods. The correctness of the recombinant plasmids was verified by colony PCR, restriction enzyme digestion, and Sanger sequencing.

[0051] 4.2 Transient expression of *Tobacco Benzovia* and substrate feeding The validated Agrobacterium strain was cultured to the logarithmic growth phase, and the cells were collected by centrifugation and resuspended in an osmosis buffer containing acetylsyringone. The cells were then incubated at room temperature to induce Vir gene expression. Healthy Tobacco Benzovia plants were selected, and the Agrobacterium suspension was injected into the abaxial surface of the leaves using a needle-free injector. After culturing under suitable light and temperature conditions for a certain period (to ensure sufficient expression of the exogenous protein), the same osmosis area was injected with a buffer containing cis-OPDA substrate for feeding. After further culturing, the leaves were harvested and flash-frozen in liquid nitrogen for subsequent product extraction. Agrobacterium transformed with the empty vector pEAQ-HT was used as a negative control.

[0052] 4.3 Product Extraction and Detection After the reaction, tobacco leaves were harvested, rapidly frozen in liquid nitrogen, and then ground. Subsequently, ethyl acetate was added for ultrasonic extraction, the supernatant was collected by centrifugation, concentrated, reconstituted, and filtered through a microporous membrane. The extract was analyzed by liquid chromatography-tandem mass spectrometry (LC-MS / MS). In negative ion mode and multiple reaction monitoring (MRM) mode, the characteristics of the target products (3,7-ddh-JA, cis-Jasmone) and substrate (cis-OPDA) were used for qualitative analysis based on their characteristic precursor and product ions. The 3,7-ddh-JA standard was purchased from Cayman Chemical; the cis-Jasmone standard was purchased from Sigma-Aldrich (Catalog No. W259306); and the cis-OPDA standard was purchased from TargetMol (Catalog No. T33808-500 μg).

[0053] Table 4. Product synthesis of different gene combinations in each chassis

[0054] As shown in Table 4, only combinations A and B yielded detectable 3,7-ddh-JA and cis-Jasmone, while combinations C and D did not. These results indicate that only combinations with the TcACX3 gene derived from pyrethrum can produce 3,7-ddh-JA and cis-Jasmone.

[0055] Example 5: Whole-cell catalytic synthesis of 3,7-ddh-JA and cis-Jasmone in a microbial chassis using a combination of multi-source β-oxidation genes and TcACX3. 5.1 Sources of experimental materials and carriers The expression vectors and host bacteria sources of the microbial chassis used in this embodiment are shown in Table 5 below: Table 5. Information on expression vectors and host bacteria sources for microbial chassis.

[0056] 5.2 Experimental Design and Gene Combination In this embodiment, the β-oxidation pathway was reconstructed through whole-cell catalysis in four microbial chassis: Escherichia coli, Saccharomyces cerevisiae, Yersinia lipolytica, and Bacillus subtilis, to verify the catalytic function of the four gene combinations (combinations A, B, C, and D) in Example 4.

[0057] 5.3 Construction of Microbial Expression Vectors Targeting the genetic characteristics of different microbial chassis, multi-gene co-expression strategies were designed respectively: (1) Escherichia coli: The four genes were cloned into the multiple cloning sites of the two vectors using a dual plasmid co-expression system (pETDuet-1 and pRSFDuet-1) and expressed using the T7 promoter.

[0058] (2) Saccharomyces cerevisiae: The expression of four genes was driven by the bidirectional promoter vector (pESC-URA) using the galactose-inducible promoter (PGAL1 / PGAL10) in both directions.

[0059] (3) Yeast lipophila: The polycistronic expression vector (pINA1296) was used to drive gene expression using a strong constitutive promoter (TEF). Genes were linked by 2A self-cleaving peptide sequences to achieve co-translational separation of multiple proteins.

[0060] (4) Bacillus subtilis: A single plasmid polycistronic operon structure (pMA5) was used to tandem four genes downstream of an inducible promoter (Pspac), with ribosome binding sites (SD sequences) preserved between the genes.

[0061] All the recombinant plasmids were constructed using conventional molecular biology methods and, after being verified by sequencing, were transformed into their respective host cells.

[0062] 5.4 Strains Culture and Whole-Cell Catalytic Reactions Each recombinant strain was cultured in a medium containing the corresponding antibiotic until the logarithmic growth phase. Depending on the type of promoter used, an appropriate inducer (such as IPTG or galactose) was added or the carbon source was changed, and expression was induced at a suitable temperature. After induction, the bacterial cells were collected by centrifugation and washed with buffer for later use. Simultaneously, empty vector-transformed strains were prepared for each chassis as negative controls.

[0063] The collected induced bacterial cells were resuspended in a solution containing essential cofactors (such as CoA, ATP, Mg). 2+ The cis-OPDA substrate was added to the catalytic buffer (etc.) and the reaction system was subjected to whole-cell catalytic reaction at 25 °C and 220 rpm for 24 hours. After the reaction, the supernatant was collected by centrifugation, the reaction was terminated by adding ethyl acetate, and the product was extracted. Qualitative and quantitative analysis was performed by LC-MS / MS (detection conditions were the same as in Example 4.3). The results are shown in Table 6 below: Table 6. Statistical analysis of whole-cell catalytic results of various gene combinations in four microbial chassis.

[0064] The results are shown in Table 6 above. Among the five gene combinations, only combinations A and B successfully transformed cis-OPDA into 3,7-ddh-JA and cis-Jasmone in four prokaryotic and eukaryotic microbial chassis, while these transformations were not detected in the negative control and combinations C and D.

[0065] Based on the results of Examples 4 and 5, both gene combinations A and B can catalyze the production of 3,7-ddh-JA and cis-Jasmone from cis-OPDA, demonstrating that TcACX3 can work synergistically with β-oxidation pathway enzymes from different sources, exhibiting good compatibility. Furthermore, both plant chassis (Nicotiana benthamiana) and four microbial chassis cells (Escherichia coli, Saccharomyces cerevisiae, Yersinia lipolytica, and Bacillus subtilis) can serve as whole-cell catalysts to achieve this reaction, proving the strong chassis universality of this multi-enzyme catalytic system. These experimental results provide feasibility verification for constructing a biosynthetic pathway for jasmonic acid compounds using synthetic biology methods, laying the foundation for subsequent industrial production.

[0066] Example 6: Heterologous expression and fermentation synthesis of cis-Jasmone in a microbial chassis using a combination of multi-source β-oxidation genes and TcACX3. 6.1 Sources of Experimental Materials and Carriers The experimental materials and carriers are the same as those in 5.1 of Example 5.

[0067] 6.2 Experimental Design and Gene Combination This embodiment verifies the catalytic function of the four gene combinations (combinations A, B, C, and D) in Example 4 using a heterologous expression fermentation method in four microbial chassis: *Escherichia coli*, *Saccharomyces cerevisiae*, *Yersinia lipolyticis*, and *Bacillus subtilis*. This method involves inducing the expression of the target gene in the recombinant strains during fermentation, while simultaneously adding the substrate cis-OPDA to the culture medium, allowing the host cells to directly utilize cofactors produced by their own metabolism to convert cis-OPDA into 3,7-ddh-JA and cis-Jasmone during growth. Combinations A and B have already been shown to possess catalytic activity in Example 5.

[0068] 6.3 Construction of Microbial Expression Vectors The specific experimental procedures are the same as in Example 5.3. After the recombinant plasmids were verified to be correct by sequencing, they were transformed into the corresponding host cells to obtain recombinant host cells.

[0069] 6.4 Heterologous expression fermentation 6.4.1 Seed culture Each recombinant host cell (and the empty vector control strain) was inoculated into 5 mL of the corresponding liquid culture medium (containing antibiotics) and cultured overnight with shaking at a suitable temperature. Escherichia coli: LB medium, 37°C, 220 rpm; Saccharomyces cerevisiae: SD-URA medium, 30℃, 220 rpm; Yersinia lipophila: YNB-Leu medium, 28℃, 220 rpm; Bacillus subtilis: LB medium (containing Kana), 37°C, 220 rpm.

[0070] 6.4.2 Fermentation Culture and Induction Transfer the seed culture at an inoculation rate of 1-2% to 50 mL of fresh culture medium (containing antibiotics) and continue culturing until mid-log phase (OD2). 600 (≈0.6-0.8). Inducer should be added according to the promoter type of each vector: Escherichia coli: IPTG final concentration 0.5 mM; Saccharomyces cerevisiae: Replace with YPGal medium (containing 2% galactose); Yeast extract: No additional induction required (constitutive expression); Bacillus subtilis: IPTG final concentration 0.5 mM.

[0071] While adding the inducer, add cis-OPDA substrate to the culture medium to a final concentration of 100 μM, and continue culturing for 24-48 hours (adjust according to the growth rate of the strain). Take samples every 12 hours during this period.

[0072] 6.4.3 Product Extraction and Detection After fermentation, the supernatant of the fermentation broth was collected, extracted with an equal volume of ethyl acetate, vortexed, centrifuged, and the organic phase was evaporated to dryness and reconstituted with methanol. Qualitative and quantitative analysis was performed using LC-MS / MS under the same conditions as in Example 4, section 4.3. The fermentation broth of the strain transformed with the empty vector was used as a negative control. The detection results are shown in Table 7. Table 7. Statistical analysis of fermentation results of different gene combinations in four microbial chassis.

[0073] This embodiment successfully verified the synthesis of cis-Jasmone via heterologous expression fermentation of TcACX3 and β-oxidation pathway enzymes from different sources (combinations A and B) in four microbial chassis (Escherichia coli, Saccharomyces cerevisiae, Yersinia lipolyticis, and Bacillus subtilis). Compared with whole-cell catalysis, heterologous expression fermentation eliminates the steps of cell collection and resuspension, simplifying the operation process and making it more suitable for industrial-scale production. The above results demonstrate that host cells integrating the expression of TcACX3 and β-oxidation pathway enzyme genes can achieve efficient synthesis of cis-Jasmone using both whole-cell catalysis and heterologous expression fermentation methods, exhibiting good potential for industrial application.

[0074] Example 7 Cloning, expression, and functional verification of mutants TcACX3_V90, TcACX3_V85, and TcACX3_V80 To investigate the effect of the conservation of the TcACX3 gene sequence on its catalytic function, this embodiment, based on Example 3, performed site-directed mutagenesis on the TcACX3 gene to obtain mutants with 90% (TcACX3_V90), 85% (TcACX3_V85), and 80% (TcACX3_V80) amino acid sequence identity with the protein encoded by the TcACX3 gene (SEQ ID NO. 2). These mutants were obtained through whole-gene synthesis and constructed into the pET-28a(+) expression vector. The methods for obtaining the remaining genes (AtACS, AtMFP, AtKAT, AtACX), constructing the expression vectors, and purifying the proteins were the same as in Example 3.

[0075] 7.1 Mutant Design and Synthesis Based on the wild-type TcACX3 gene sequence (obtained from transcriptome sequencing results), its three-dimensional structure and functional domains were analyzed using bioinformatics tools (UniProt, PyMOL, AlphaFold), and key active sites, substrate binding regions, and surface mutagenic regions were located.

[0076] Point mutation schemes were designed to target 90%, 85%, and 80% sequence identity: (1) TcACX3_V90: retains key functional domains, replaces non-conserved residues on the surface (such as Asp→Glu, Val→Ile and other conserved substitutions), and mutates about 10% of amino acid sites.

[0077] (2) TcACX3_V85: Based on TcACX3_V90, semi-conservative substitutions (such as Lys→Arg, Tyr→Phe) are further introduced to ensure that the key functional domains remain unchanged and about 15% of the amino acid sites are mutated.

[0078] (3) TcACX3_V80: Based on TcACX3_V85, a limited number of moderately conserved regions are replaced, all known catalytic sites are avoided, and about 20% of amino acid sites are mutated.

[0079] Subsequently, the gene sequences of mutants TcACX3_V90, TcACX3_V85, and TcACX3_V80 (their nucleotide sequences are shown in SEQ ID NO. 6-8, respectively) were obtained by whole-genome synthesis (Genscript) and cloned into the pET-28a(+) vector. The sequence correctness was verified by sequencing.

[0080] 7.2 Construction of mutant plasmids and protein expression The synthesized mutant gene sequences were ligated into the pET-28a(+) expression vector using the Gibson assembly method, transformed into *E. coli* DH5α competent cells, plated on LA plates containing Kana antibiotic, and incubated overnight at 37°C. Single clones were picked, inoculated into Kana-LB liquid medium, and plasmids were extracted and sequenced for verification, yielding the correct recombinant plasmids pET-28a(+)-TcACX3_V90, pET-28a(+)-TcACX3_V85, and pET-28a(+)-TcACX3_V80.

[0081] Subsequently, the verified recombinant plasmid was transformed into the Rosetta DE3 expression strain, plated on Kana-LA plates, and cultured at 37°C. Single colonies were picked and inoculated into Kana-LB liquid medium, cultured at 37°C and 220 rpm until OD600 = 0.6-0.8, then IPTG (final concentration 0.1 mM) was added, and expression was induced at 18°C ​​and 220 rpm for 18 h. The bacterial cells were collected, sonicated, and purified by nickel column affinity chromatography to obtain the recombinant proteins TcACX3_V90, TcACX3_V85, and TcACX3_V80 with the 6×His tag. The protein concentrations were measured and stored at -80°C for later use.

[0082] 7.3 In vitro enzymatic reaction and product detection The purified TcACX3 mutant protein was subjected to in vitro enzymatic reactions with AtACS, AtMFP, and AtKAT, respectively. The reaction system was the same as in Example 3.5: 50 mM ATP, 50 μM acetyl-CoA, 5% MgCl2, 50 μM cis-OPDA, 5 μg of each protein, and incubated at 25℃ and 220 rpm for 18 h. Wild-type TcACX3 was used as a positive control, and the AtACS+AtMFP+AtKAT combination (containing no ACX) was used as a negative control.

[0083] The specific reaction combinations are shown in Table 8: Table 8. Functional validation of TcACX3 mutant protein combinations

[0084] After the reaction was complete, 10 μL of 1 M HCl was added to adjust the pH to 5, followed by extraction with 500 μL of ethyl acetate. The organic phase was collected. The product was detected by liquid chromatography-mass spectrometry (LC-MS), and the characteristic ion fragment EIC = [M+H] was found. + =165 (corresponding to cis-Jasmone). The results showed that the positive control group exhibited significant cis-Jasmone formation with a retention time consistent with the standard; however, the negative control group did not detect the cis-Jasmone product. In the experimental groups, combination 1 (TcACX3_V90 group) showed a detectable cis-Jasmone signal, with a peak area approximately 82% of that of the negative control group 1; while combination 2 (TcACX3_V85) showed only a weak cis-Jasmone signal, and combination 3 (TcACX3_V80) had an even lower signal value, indicating that the mutant almost completely lost its ability to catalyze the conversion of cis-OPDA to cis-Jasmone.

[0085] The above results demonstrate that the conservation of the TcACX3 gene sequence is crucial to its catalytic function: high activity is maintained when sequence identity is ≥90%, activity decreases significantly when identity drops to 85%, and function is completely lost when identity is ≤80%. These results prove that through rationally designed point mutations, TcACX3 variants with differentiated sequences can be obtained while maintaining core function, making them suitable for patent protection and practical applications. They also provide a basis for sequence tolerance in the engineering modification of key enzymes in the pyrethroid biosynthetic pathway.

[0086] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A pyrethrum TcACX3 gene, its homologs, or variants thereof, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.1, or is a sequence that has at least 85% identity with the nucleotide sequence shown in SEQ ID NO.

1.

2. A protein encoded by the pyrethrum TcACX3 gene, characterized in that, Its amino acid sequence is shown in SEQ ID NO. 2; or it is an amino acid sequence that has at least 85% identity with the amino acid sequence shown in SEQ ID NO. 2, and contains the conserved region shown by amino acids 17-132, 134-247 and 478-655 in SEQ ID NO. 2, and has acyl-CoA oxidase activity.

3. A gene combination, characterized in that, Including the pyrethrum TcACX3 gene as described in claim 1, its homologs or variants thereof; The gene ACS encodes acetyl-CoA ligase; MFP, a gene encoding the activity of multifunctional proteins; And the gene KAT that encodes 3-ketoacyl-CoA thiolytic enzyme.

4. The gene combination according to claim 3, characterized in that, The gene ACS encoding acetyl-CoA ligase includes the TcACS gene from pyrethrum or the AtACS gene from Arabidopsis thaliana; the nucleotide sequence of the TcACS gene is as shown in SEQ ID NO.3, or is a sequence with at least 85% identity to the nucleotide sequence shown in SEQ ID NO.3; And / or, the gene MFP encoding multifunctional protein activity includes the TcMFP gene from pyrethrum or the AtMFP gene from Arabidopsis thaliana; the nucleotide sequence of the TcMFP gene is as shown in SEQ ID NO.4, or is a sequence having at least 85% identity with the nucleotide sequence shown in SEQ ID NO.4; And / or, the gene KAT encoding 3-ketoacyl-CoA thiolytic enzyme comprises the TcKAT gene derived from pyrethrum or the AtKAT gene derived from Arabidopsis thaliana; the nucleotide sequence of the TcKAT gene is as shown in SEQ ID NO.5, or is a sequence having at least 85% identity with the nucleotide sequence shown in SEQ ID NO.

5.

5. The gene combination according to claim 3 or 4, characterized in that, Each gene in the gene combination is independently controlled by a constitutive promoter or an inducible promoter.

6. A device for production cis Jasmone's recombinant host cell, characterized by... The host cell contains the gene combination as described in any one of claims 3-5 and expresses the following four enzymes: (a) The protein encoded by the pyrethrum TcACX3 gene; (b) Proteins possessing acetyl-CoA ligase activity; (c) Proteins with multifunctional protein activity; (d) Proteins with 3-ketoacyl-CoA thiolytic activity; The host cell is selected from any one of the following: tobacco benthamiana, Escherichia coli, Saccharomyces cerevisiae, Yersinia lipolytica, and Bacillus subtilis.

7. The use of the pyrethrum TcACX3 gene as described in claim 1, its homologs or variants thereof, the protein encoded by the pyrethrum TcACX3 gene as described in claim 2, the gene combination as described in any one of claims 3-5, or the recombinant host cell as described in claim 6 in the synthesis of cis-Jasmone.

8. A method for producing cis-Jasmone, characterized in that, This includes whole-cell catalysis or heterologous expression fermentation; The whole-cell catalysis includes using a cell expressing a protein encoded by a combination of genes as described in any one of claims 3-5 as a whole-cell catalyst to catalyze the production of cis-Jasmone by contacting it with dodecaoxadienoic acid. The heterologous expression fermentation includes culturing a host cell containing a gene combination as described in any one of claims 3-5, and isolating cis-Jasmone from the culture.

9. The method according to claim 8, characterized in that, The heterologous expression fermentation includes the following steps: inoculating a host cell containing the gene combination as described in any one of claims 3-5 into a fermentation medium, fermenting and culturing under suitable conditions, inducing the expression of each gene in the gene combination, so that the host cell converts dodecaoxadienoic acid into cis-Jasmone during growth, and separating and purifying cis-Jasmone from the fermentation product.

10. The method according to claim 8, characterized in that, The whole-cell catalysis includes the following steps: mixing cells expressing the protein encoded by the gene combination as described in any one of claims 3-5 with a reaction system containing dodecaoxadienoic acid to carry out a whole-cell catalytic reaction; then separating and purifying cis-Jasmone from the reaction product; wherein the conditions for the whole-cell catalytic reaction are: temperature 25-37℃, pH 6.0-8.0, and reaction time 24-72 hours.

Images