Application of OsGA3ox2 gene in regulating rice seed size and drought resistance

Abstract

The application discloses OsGA3ox2 Application of a gene in regulating rice seed size and drought resistance, by overexpressing OsGA3ox2 the gene, an overexpression line is obtained OsGA3ox2 Compared with a wild type plant, OsGA3ox2 the overexpression line has reduced plant height, OsGA3ox2 the overexpression line has increased seed length, seed width and 1000-grain weight. OsGA3ox2 The survival rate of the overexpression line under drought stress at a seedling stage is higher than that of the wild type plant, and OsGA3ox2 the effective ear number, seed setting rate and yield per plant of the overexpression line under drought stress at a tillering stage are all higher than those of the wild type plant. The above results show that OsGA3ox2 the gene positively regulates the size of rice seeds and the drought resistance of rice, and has important significance for improving rice yield and drought resistance breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and molecular breeding technology, specifically involving OsGA3ox2 Application of genes in regulating rice seed size and drought resistance. Background Technology

[0002] Rice is the staple food for more than half of the world's population, and its stable and high yield is crucial for ensuring food security. However, rice production is often constrained by abiotic stresses, with drought being one of the most severe factors leading to yield loss. In crop breeding, there is often a trade-off between yield and stress resistance (such as drought resistance). Traditional breeding methods, while attempting to increase rice yield, often result in a weakening of stress resistance traits such as drought resistance; conversely, focusing on enhancing drought resistance may limit its yield potential. This negative genetic correlation makes it difficult to cultivate breakthrough varieties that synergistically enhance both high yield and high stress resistance through conventional hybridization and selection methods. Although several genes that separately regulate yield or drought resistance have been identified in current technologies, key genetic targets that can simultaneously break this trade-off and exert a synergistic positive regulatory effect on both traits are still rarely reported. This has become a major technical bottleneck in current high-yield and drought-resistant synergistic breeding.

[0003] Gibberellin (GA) is an important hormone regulating plant growth and development; the Green Revolution achieved semi-dwarf breeding by reducing GA levels. Gibberellin 3β-hydroxylase (GA3ox) is a key enzyme in the synthesis of various active GAs, and rice has two GA3ox genes (…). OsGA3ox1 and OsGA3ox2 ),in OsGA3ox2 (Gene ID: LOC_Os01g08220) is a key rate-limiting enzyme in GA synthesis, catalyzing the formation of active GA from GA20 and regulating plant height. OsGA3ox2 The deletion mutation (d18) leads to extreme dwarfing in rice. However, OsGA3ox2 The regulatory effects of overexpression on rice grain size and drought resistance have not been reported before.

[0004] Therefore, discovering and verifying key genes that can simultaneously and positively regulate rice yield-related traits (such as grain size and thousand-grain weight) and drought resistance, and elucidating their mechanisms of action, has important theoretical value and application prospects for developing new molecular breeding strategies and cultivating new rice varieties with synergistic improvement in high yield and drought resistance. Summary of the Invention

[0005] To address the above problems, the purpose of this invention is to provide... OsGA3ox2 The application of genes in regulating rice seed size and drought resistance, through overexpression of rice... OsGA3ox2 Genes, obtained OsGA3ox2Overexpression lines OsGA3ox2 Overexpression lines can significantly increase the grain length, grain width and thousand-grain weight of rice seeds, while also enhancing the drought resistance of rice.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: OsGA3ox2 Application of genes in regulating rice seed size and drought resistance OsGA3ox2 The CDS sequence of the gene is shown in SEQ ID NO:1. OsGA3ox2 The amino acid sequence of the protein encoded by the CDS sequence of the gene is shown in SEQ ID NO:2. OsGA3ox2 Genes are positively regulating the size of rice seeds and the drought resistance of rice.

[0007] Preferably, the positive regulation of rice seed size includes increasing the grain length and grain width of the rice seeds.

[0008] Preferably, the positive regulation of rice seed size also includes increasing the thousand-grain weight of rice seeds.

[0009] Preferably, by overexpressing the OsGA3ox2 Genes, obtained OsGA3ox2 Overexpression lines; compared with wild-type plants, the OsGA3ox2 The overexpression lines showed reduced plant height. OsGA3ox2 Seeds of overexpressing strains showed increased seed length, seed width, and thousand-seed weight.

[0010] Preferably, the OsGA3ox2 The overexpression lines had a higher survival rate than wild-type plants under drought stress during the seedling stage, and the... OsGA3ox2 The overexpression lines showed higher effective panicle number, seed setting rate, and yield per plant than wild-type plants under drought stress during the tillering stage.

[0011] An expression box, including the applications described above. OsGA3ox2 The gene, the expression cassette is used for overexpression of the gene. OsGA3ox2 Gene.

[0012] A recombinant vector comprising the aforementioned expression cassette.

[0013] A recombinant microorganism, comprising the expression cassette or recombinant vector described above.

[0014] A breeding method for transgenic rice, involving overexpression of the aforementioned application in rice. OsGA3ox2 Gene, the method includes: Cloned rice OsGA3ox2 Genes, obtained OsGA3ox2 Cloned fragments of genes; According to the above OsGA3ox2Cloned fragments of genes were used to construct overexpression vectors. The overexpression vector was transformed into rice callus tissue using Agrobacterium-mediated transformation to obtain transgenic plants T0. The transgenic plant T0 was subjected to multiple generations of resistance screening to obtain... OsGA3ox2 Overexpression strains.

[0015] Preferably, the construction of the overexpression vector includes: According to the above OsGA3ox2 Cloned fragments of genes, selected plant expression vectors; The plant expression vector was double-digested with BamH I and Sac I to obtain the digested vector; The OsGA3ox2 The cloned fragment of the gene and the enzyme-digested vector are ligated to obtain the ligation product; The ligation product was heat-shocked and transformed into Escherichia coli DH5α competent cells to obtain the transformed bacterial culture. The transformed bacterial culture was plated on LB agar plates containing kanamycin for screening to obtain single-clone colonies; The monoclonal colonies were identified by PCR and sequenced to obtain the overexpression vector pTCK303-OsGA3ox2.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides the application of the OsGA3ox2 gene in regulating rice seed size and drought resistance. OsGA3ox2 The CDS sequence of the gene is shown in SEQ ID NO:1. OsGA3ox2 The amino acid sequence of the protein encoded by the CDS sequence of the gene is shown in SEQ ID NO:2. OsGA3ox2 Genes positively regulate rice seed size and drought resistance. This is achieved through overexpression. OsGA3ox2 Genes, obtained OsGA3ox2 Overexpression lines, compared to wild-type plants, OsGA3ox2 The overexpression lines had reduced plant height. OsGA3ox2 Seeds of overexpressing strains showed increased seed length, seed width, and thousand-seed weight. OsGA3ox2 The overexpression lines had a higher survival rate than wild-type plants under drought stress during the seedling stage, and OsGA3ox2 Overexpression lines showed higher effective panicle number, seed setting rate, and yield per plant compared to wild-type plants under drought stress during the tillering stage. This invention utilizes overexpression... OsGA3ox2 The gene was analyzed, and its overexpression significantly increased grain length, grain width, and thousand-grain weight in rice seeds, while also enhancing the drought resistance of rice, demonstrating... OsGA3ox2 Genes are important targets for simultaneously improving rice yield and drought resistance. This discovery reveals for the first time... OsGA3ox2Genes, as positive regulators, have a dual function. Their overexpression can break the trade-off between yield and drought resistance, achieving synergistic enhancement of both traits, which is of great significance for improving rice yield and drought-resistant breeding. Attached Figure Description

[0017] Figure 1 For rice OsGA3ox2 Image showing the identification results of gene overexpression materials; Figure 2 for OsGA3ox2 Agronomic traits and statistical results of plant height and seed size of overexpression lines; Figure 3 for OsGA3ox2 Statistical results of agronomic traits and survival rate of overexpression lines under drought stress during the seedling stage; Figure 4 for OsGA3ox2 Statistical results of agronomic and yield traits of overexpression lines under drought stress during the tillering stage. Detailed Implementation

[0018] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the invention are all within the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments, etc., used in the embodiments of the present invention are all commercially available; unless specifically specified, all technical means in the embodiments of the present invention are conventional means well known to those skilled in the art.

[0019] Example 1 Rice OsGA3ox2 Cloning of genes This embodiment uses the rice variety Zhonghua 11 (ZH11) as material, and clones the rice... OsGA3ox2 Genes, Acquisition OsGA3ox2 The specific steps for cloning gene fragments are as follows: (1) Obtain OsGA3ox2 Gene sequence Search using the Rice Genome Annotation Project (RGAP) database, accessible at http: / / rice.uga.edu / index.shtml. OsGA3ox2 Gene (Gene ID: LOC_Os01g08220), obtained OsGA3ox2 The gene sequence, OsGA3ox2 The CDS sequence of the gene is shown in SEQ ID NO:1. OsGA3ox2 The amino acid sequence of the protein encoded by the gene's CDS sequence is shown in SEQ ID NO:2. Search results show that... OsGA3ox2The gene is located at the end of the short arm of rice chromosome 1, corresponding to the D18 locus. OsGA3ox2 The gene-encoded gibberellin 3β-hydroxylase (GA3ox) is a key enzyme in the rice gibberellin (GA) biosynthesis pathway, catalyzing the conversion of inactive gibberellin precursor (GA20) into active gibberellin.

[0020] (2) Obtain total RNA from rice and reverse transcribe it into cDNA. Total RNA was extracted from tissues (such as leaves, stems, or young panicles) of the rice variety Zhonghua 11 (ZH11) using TRIZOL as a template for cloning coding sequences (CDS). TRIZOL is a total RNA extraction reagent containing phenol and guanidine isothiocyanate, whose main function is to lyse cells and efficiently inhibit RNase activity during extraction, thereby protecting RNA from degradation. High-quality total RNA can be isolated from Zhonghua 11 (ZH11) using TRIZOL. Using the extracted total RNA as a template, the total RNA was reverse transcribed into cDNA using the SuperScript™ III first-strand synthesis system (Invitrogen, America). Reverse transcription at a higher temperature effectively reduces non-specific amplification and helps obtain longer cDNA products, ensuring that the total RNA template is free of genomic DNA contamination and has high integrity, thus yielding high-quality cDNA.

[0021] (3) OsGA3ox2 Cloning of genes According to the results obtained in step (1) OsGA3ox2 The gene sequence was determined, and amplification primers GA3ox2-F and GA3ox2-R were designed. A BamH I restriction site was introduced upstream of the amplification primers, and a Sac I restriction site was introduced downstream of the amplification primers.

[0022] The sequences of primers GA3ox2-F and GA3ox2-R are as follows: GA3ox2-F: 5'-CGGGATCCATGCCGACGCCGTCGCACTT-3'; GA3ox2-R: 5'-CGGGAGCTCTTATGCGTGGACGTCGGCGGC-3'.

[0023] Using the cDNA obtained by reverse transcription in step (2) as a template, KOD Neo plus (Toyobo, Japan) was used to process... OsGA3ox2 The gene sequence is amplified by PCR to obtain the PCR product.

[0024] The PCR reaction conditions were as follows: 98℃ pre-denaturation for 30s; 98℃ denaturation for 15s, 60℃ annealing for 15s, 68℃ extension for 1min, for a total of 35 cycles; and a final extension at 68℃ for 10min.

[0025] (4) Gel electrophoresis recovery of target fragments After PCR amplification, the PCR product obtained in step (3) is detected by agarose gel electrophoresis and observed under a gel imaging system. If a single, bright, specific band is observed at the expected size and location, it indicates that the amplification was successful. OsGA3ox2 The target segment of the gene.

[0026] After electrophoresis confirmation, under UV light, use a clean blade to quickly cut off the gel block containing the target DNA fragment (located at the expected band size), removing as much excess gel as possible. Using a DNA recovery kit (TransGold, catalog number EG101-02), follow the product instructions to recover and purify the target DNA fragment from the gel. OsGA3ox2 Cloned fragments of a gene.

[0027] Example 2 Construction of overexpression vector This embodiment is based on the results obtained in Embodiment 1. OsGA3ox2 Cloned fragments of genes were used to construct plant overexpression vectors.

[0028] according to OsGA3ox2 The cloned gene fragment was selected, and the plant expression vector pTCK303 was chosen. The pTCK303 vector was double-digested with restriction endonucleases BamHI and SacI to obtain the digested vector. The digested vector and... OsGA3ox2 Cloned fragments of a gene are ligated to obtain a ligation product.

[0029] The ligation reaction system consisted of: 1 μL of enzyme-digested vector; 5 μL of... OsGA3ox2 Gene clone fragment; 1 μL T4 DNA ligase; 1 μL T4 DNA ligase buffer; 2 μL water; total volume 10 μL; incubate overnight at 16°C.

[0030] The ligation product was heat-shocked and transformed into *E. coli* DH5α competent cells to obtain a transformed bacterial culture. The transformed bacterial culture was plated on LB agar plates containing kanamycin for screening. Single colonies were picked and colony PCR was performed using primers ubi-F and GA3ox2-R to identify positive clones. Plasmids of positive clones were extracted and sequenced. The sequencing results were compared with those obtained in step (1) of Example 1. OsGA3ox2 The gene sequences were compared, and the positive plasmids that were correctly sequenced, i.e., the overexpression vectors, were selected and named pTCK303-OsGA3ox2. They were then stored at -20℃ for later use.

[0031] The colony PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 30 s, 72℃ extension for 45 s, for a total of 25 cycles; 72℃ extension for 5 min, and storage at 4℃.

[0032] The sequences of primers ubi-F and GA3ox2-R are as follows: ubi-F:ccctgccttcatacgctatt; GA3ox2-R: CGGGAGCTCTTATGCGTGGACGTCGGCGGC.

[0033] Example 3 Genetic transformation and identification of positive lines This embodiment is based on the overexpression vector pTCK303-OsGA3ox2 constructed in Example 2. It was introduced into the mature embryo callus tissue of the rice variety Zhonghua 11 (ZH11) by Agrobacterium-mediated genetic transformation. The transgenic plant T0 was obtained by tissue culture regeneration and was identified by qRT-PCR.

[0034] First, the overexpression vector pTCK303-OsGA3ox2 was introduced into Agrobacterium tumefaciens strain EHA105, and then transformed into the callus tissue of rice variety Zhonghua 11 (ZH11) by Agrobacterium-mediated genetic transformation to obtain the transformed callus tissue.

[0035] Next, the transformed callus was transferred to a selection medium containing hygromycin for resistance selection to obtain surviving resistant callus. The resistant callus was then transferred to a differentiation medium for induction of differentiation into seedlings to obtain transgenic seedlings. The transgenic seedlings were then transferred to a rooting medium for induction of rooting to obtain transgenic plants T0.

[0036] The obtained transgenic plants T0 were further detected using real-time quantitative PCR (qRT-PCR). OsGA3ox2 Gene expression levels, screening OsGA3ox2 Significantly increased gene expression levels OsGA3ox2 Overexpression lines ( OsGA3ox2OE-1 and OsGA3ox2OE-2 The identification results are as follows: Figure 1 As shown, the qRT-PCR method was used to detect... OsGA3ox2OE-1 Right now Figure 1 In OE-1 and OsGA3ox2OE-2 Right now Figure 1 In OE-2 of OsGA3ox2 The relative mRNA expression levels of the genes were significantly higher than those of the wild-type plants (WT), indicating that... OsGA3ox2OE-1 and OsGA3ox2OE-2 for OsGA3ox2 Gene overexpression positive lines. Detection was performed using Western blotting. OsGA3ox2 The protein expression levels showed that, compared with wild-type plants (WT), OsGA3ox2OE-1 and OsGA3ox2OE-2 of OsGA3ox2 The protein level (Anti-GA3ox2) was significantly increased, among which... Figure 1 In this context, Anti-actin represents the detection signal of the internal reference protein Actin, serving as a control for the amount of protein loaded. Figure 1 WT, OE-1 and OE-2 The protein loading amounts were basically consistent, indicating that the Western Blot results were reliable.

[0037] To obtain genetically stable overexpression lines, T0 transgenic plants were self-pollinated to obtain T1 generation seeds. Germination screening was performed using a hygromycin-containing medium, and the segregation ratio of resistant to susceptible seedlings was statistically analyzed. Lines with a segregation ratio of 3:1 were preliminarily identified as single-copy insertion lines T1. T1 lines were then self-pollinated to obtain T2 generation seeds, and hygromycin screening was continued. Lines exhibiting no segregation (100% resistance) were selected, which were considered homozygous transgenic lines. Finally, lines confirmed by qRT-PCR were selected. OsGA3ox2 Homozygous T2 lines with significantly increased gene expression and single-copy insertion were used for subsequent seed size and drought resistance phenotypic analysis.

[0038] Example 4 OsGA3ox2 Determination of seed size of overexpression lines Taking the rice variety Zhonghua 11 (ZH11) as an example, wild-type plants (WT) and overexpression lines that grew normally in the field and were harvested were taken. OsGA3ox2OE-1 and OsGA3ox2OE-2 The rice seedlings were selected from plump seeds, with at least 12 plants per line and at least 100 plump seeds per plant. Then, data such as seed length, seed width, and thousand-seed weight were collected using a digital rice seed testing machine (Wuhan Gufeng Optoelectronics, model YTS-5DS).

[0039] The measurement results are as follows Figure 2 As shown, where Figure 2 In OE-1 i.e., overexpression strains OsGA3ox2OE-1 , OE-2 i.e., overexpression strains OsGA3ox2OE-2 , Figure 2 (a) Wild-type plants (WT) and overexpression lines ( OsGA3ox2OE-1 and OsGA3ox2OE-2 Agronomic traits at harvest time. Figure 2 (b) Wild-type plants (WT) and overexpression lines ( OsGA3ox2OE-1 and OsGA3ox2OE-2 Agronomic trait diagram of seed size. Figure 2 (c) Wild-type plants (WT) and overexpression lines ( OsGA3ox2OE-1 and OsGA3ox2OE-2 Plant height. Figure 2 (d), (e), and (f) represent wild-type plants (WT) and overexpression lines, respectively. OsGA3ox2OE-1 and OsGA3ox2OE-2 The seed length, grain width, and 1000-grain weight are specified. In this example, seed length, grain width, and 1000-grain weight refer to the length, width, and weight of each individual seed grain. Figure 2 It was found that the overexpression strain ( OsGA3ox2OE-1 and OsGA3ox2OE-2 The plant height of the overexpressing lines was lower than that of the wild-type plants (WT). OsGA3ox2OE-1 and OsGA3ox2OE- 2 The grain length, grain width, and thousand-grain weight of the α-type rice were all higher than those of the wild-type plant (WT), indicating that overexpression of α-type ... OsGA3ox2 This gene combination significantly increases grain length, width, and thousand-grain weight while reducing rice plant height. This phenotypic combination breaks through the limitations of traditional understanding of this gene, providing a novel genetic resource and breeding strategy for cultivating lodging-resistant, high-yielding rice varieties.

[0040] Example 5 OsGA3ox2 Drought resistance determination of overexpression lines (1) Determination of drought resistance during the seedling stage.

[0041] Wild-type plants (WT) and overexpression lines were collected. OsGA3ox2OE-1 and OsGA3ox2OE-2 150 plump and normal seeds each were disinfected with 3% sodium hypochlorite for 20 minutes, then rinsed three times with clean water to remove all impurities. The seeds were then placed in a 37℃ incubator for germination. Once the seeds showed signs of germination, they were evenly sown in flowerpots. To ensure even moisture distribution, the flowerpots were divided in half; one half was planted with wild-type (WT) plants, and the other half with overexpression lines. OsGA3ox2OE-1 and OsGA3ox2OE-2 Each type of seed was divided into three replicates, with each replicate containing approximately 40 seeds. These were cultured in an artificial climate chamber with a daytime temperature of 30°C, a nighttime temperature of 25°C, and a 16 / 8 light cycle. Once the plants reached the three-leaf-one-heart stage (approximately 2 weeks), water was withheld for 10-20 days. When a particular line was almost completely dried out, the plants were rehydrated for 7 days, and then the survival rate was calculated.

[0042] Statistical results are as follows Figure 3 As shown, Figure 3 In OE-1 i.e., overexpression strains OsGA3ox2OE-1 , OE-2 i.e., overexpression strains OsGA3ox2OE-2 ,in Figure 3 The left image shows a wild-type plant (WT) and an overexpression line (W). OsGA3ox2OE-1 and OsGA3ox2OE-2 Agronomic trait diagrams before and after water withdrawal treatment during the seedling stage (three leaves and one bud). Figure 3 The right side shows wild-type plants (WT) and overexpression lines ( OsGA3ox2OE-1 and OsGA3ox2OE-2 The survival rate of [a substance] after 7 days of rehydration and growth. Figure 3 It was found that the overexpression strain ( OsGA3ox2OE-1 and OsGA3ox2OE-2 The survival rate of seedlings under drought stress was significantly higher than that of wild-type plants (WT), indicating that overexpression... OsGA3ox2 Genes can effectively enhance the drought resistance of rice seedlings.

[0043] (2) Field drought resistance test A field drought resistance trial was conducted in Guangzhou. Water control (protected by a rain shelter) was initiated at the tillering stage, followed by drought treatment until maturity. Three replicate plots were set up for each genotype, with three rows per plot and six plants per row. After maturity, the number of effective panicles, seed setting rate, and yield per plant were assessed.

[0044] The measurement results are as follows Figure 4 As shown, Figure 3 In OE-1 i.e., overexpression strains OsGA3ox2OE-1 , OE-2 i.e., overexpression strains OsGA3ox2OE-2 ,in Figure 4 (a) Wild-type plants (WT) and overexpression lines ( OsGA3ox2OE-1 and OsGA3ox2OE-2 Agronomic traits under drought stress during the tillering stage. Figure 4 (b), (c), and (d) represent wild-type plants (WT) and overexpression lines, respectively. OsGA3ox2OE-1 and OsGA3ox2OE-2 The chart shows the statistical results of the effective panicle number, seed setting rate, and grain yield per plant. From... Figure 4 It was found that the overexpression strain ( OsGA3ox2OE-1 and OsGA3ox2OE-2The number of effective panicles, seed setting rate and yield per plant were significantly higher than those of wild-type plants (WT) under drought stress during the tillering stage. This indicates that the overexpression line not only showed strong drought resistance in the seedling stage, but also maintained a high yield level under drought stress during the reproductive growth stage.

[0045] In summary, this invention achieves its goal through overexpression. OsGA3ox2 The gene was analyzed, and its overexpression significantly increased grain length, grain width, and thousand-grain weight in rice seeds, while also enhancing the drought resistance of rice, demonstrating... OsGA3ox2 The important role of genes in rice seed size and drought resistance. Through overexpression... OsGA3ox2 Genetic modification of rice significantly increases seed size and drought resistance, indicating that... OsGA3ox2 Positive gene regulation of rice seed size and drought resistance is of great significance for improving rice yield and drought-resistant breeding.

[0046] It is understood that the above embodiments only illustrate preferred embodiments of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can freely combine the above technical features without departing from the concept of the present invention, and can also make several modifications and improvements, all of which fall within the protection scope of the present invention. Therefore, all equivalent transformations and modifications made with respect to the scope of the claims of the present invention should fall within the scope of the claims of the present invention.

Claims

1. OsGA3ox2 The application of genes in regulating rice seed size and drought resistance is characterized by, OsGA3ox2 The CDS sequence of the gene is shown in SEQ ID NO:

1. OsGA3ox2 The amino acid sequence of the protein encoded by the CDS sequence of the gene is shown in SEQ ID NO:

2. OsGA3ox2 Genes are positively regulating the size of rice seeds and the drought resistance of rice.

2. The application according to claim 1, characterized in that, The positive regulation of rice seed size includes increasing the length and width of the rice seed.

3. The application according to claim 2, characterized in that, The positive regulation of rice seed size also includes increasing the thousand-grain weight of rice seeds.

4. The application according to claim 1, characterized in that, By overexpressing the above OsGA3ox2 Genes, obtained OsGA3ox2 Overexpression lines; compared with wild-type plants, the OsGA3ox2 The overexpression lines showed reduced plant height. OsGA3ox2 Seeds of overexpressing strains showed increased seed length, seed width, and thousand-seed weight.

5. The application according to claim 4, characterized in that, The OsGA3ox2 The overexpression lines had a higher survival rate than wild-type plants under drought stress during the seedling stage, and the... OsGA3ox2 The overexpression lines showed higher effective panicle number, seed setting rate, and yield per plant than wild-type plants under drought stress during the tillering stage.

6. An expression box, characterized in that, Including the application described in any one of claims 1-5 OsGA3ox2 The gene, the expression cassette is used for overexpression of the gene. OsGA3ox2 Gene.

7. A recombinant vector, characterized in that, Includes the expression box as described in claim 5.

8. A recombinant microorganism comprising the expression cassette of claim 5 or the recombinant vector of claim 6.

9. A method for breeding transgenic rice, characterized in that, Overexpression in rice as described in claim 1 OsGA3ox2 Gene, the method includes: Cloned rice OsGA3ox2 Genes, obtained OsGA3ox2 Cloned fragments of genes; According to the above OsGA3ox2 Cloned fragments of genes were used to construct overexpression vectors. The overexpression vector was transformed into rice callus tissue using Agrobacterium-mediated transformation to obtain transgenic plants T0. The transgenic plant T0 was subjected to multiple generations of resistance screening to obtain... OsGA3ox2 Overexpression strains.

10. The breeding method according to claim 9, characterized in that, The construction of the overexpression vector includes: According to the above OsGA3ox2 Cloned fragments of genes, selected plant expression vectors; The plant expression vector was double-digested with BamH I and Sac I to obtain the digested vector; The OsGA3ox2 The cloned fragment of the gene and the enzyme-digested vector are ligated to obtain the ligation product; The ligation product was heat-shocked and transformed into Escherichia coli DH5α competent cells to obtain the transformed bacterial culture. The transformed bacterial culture was plated on LB agar plates containing kanamycin for screening to obtain single-clone colonies; The monoclonal colonies were identified by PCR and sequenced to obtain the overexpression vector pTCK303-OsGA3ox2.

Images