Recombinant shewanella strain for efficiently producing coproporphyrin and construction method and application thereof

Abstract

The present application relates to the field of synthetic biology and genetic engineering technology, in particular to a recombinant shewanella strain for efficiently producing coproporphyrin, a construction method and application thereof. Based on the strong natural porphyrin accumulation ability of the wild type shewanella strain, the present application realizes the biosynthesis of coproporphyrin by synergistically overexpressing the key genes hemA, hemL, gltX, hemB, hemC, hemD and hemE in the endogenous porphyrin synthesis pathway. On this basis, the synthesis capacity of coproporphyrin is further improved by introducing an antioxidant module, weakening the bypass metabolic consumption, modifying the key regulatory genes and optimizing the gene expression regulation strategy, and finally a high-yield engineering strain is obtained. The present application provides a feasible technical solution for the construction of coproporphyrin biosynthesis strain, and expands the application of shewanella strain in the production of porphyrin compounds.

Description

Technical Field

[0001] This invention relates to the fields of synthetic biology and genetic engineering, and in particular to recombinant Sheva strains for the efficient production of coprophyrin, their construction methods, and applications. Background Technology

[0002] Porphyrins are a class of tetrapyrrole compounds formed by four pyrrole subunits linked by methylene bridges. As important cofactors in organisms, porphyrins play an indispensable role in various life forms, widely participating in core biochemical and physiological processes such as respiration, photosynthesis, and various enzymatic reactions. In applications, porphyrins also exhibit excellent performance; for example, copper(II) coproporphyrin can be used as a sensitizer in dye-sensitized solar cells, while zinc(II) coproporphyrin combines excellent supramolecular photosensitizer properties with potent antibacterial activity.

[0003] In industrial production, porphyrin compounds are still mainly produced through chemical synthesis. However, this method generally suffers from problems such as harsh reaction conditions, reliance on toxic or volatile organic solvents and strong acids, cumbersome synthesis steps, and low product yields, which can easily lead to serious environmental and safety hazards. Therefore, a more economical, sustainable, and efficient method for producing porphyrins is needed. Summary of the Invention

[0004] In view of this, the present invention provides a method for constructing a recombinant Shewan strain that produces coprophyrin efficiently, solving the following technical problems: the coprophyrin synthesis pathway in wild-type Shewan strains is unclear; the coprophyrin yield is low and difficult to meet application requirements; there are limiting factors such as bypass competition and oxidative stress in the metabolic pathway.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] In a first aspect, the present invention provides the use of overexpression of hemA, hemL, gltX, hemB, hemC, hemD and hemE in any of the following:

[0007] (I) Constructing engineered Shewanella strains that efficiently synthesize coproporphyrin; and / or

[0008] (II) Increase coprophyte production.

[0009] In some specific embodiments of the present invention, katE and / or sodB are also introduced.

[0010] In some specific embodiments of the present invention, silencing cysG and / or hemX is also included.

[0011] In some specific embodiments of the present invention, gark, focA and / or proA are also introduced.

[0012] In some specific embodiments of the present invention, the RBS regions of seven key genes, namely hemA, hemL, gltX, hemB, hemC, hemD and hemE, are respectively replaced and optimized.

[0013] The RBS region of hemA:

[0014] (I) Having a nucleotide sequence as shown in SEQ ID No. 62; and / or

[0015] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0016] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0017] The plurality is at least two;

[0018] The RBS region of the hemL:

[0019] (I) Having a nucleotide sequence as shown in SEQ ID No. 59; and / or

[0020] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0021] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0022] The plurality is at least two;

[0023] The RBS region of gltX:

[0024] (I) Having a nucleotide sequence as shown in SEQ ID No. 64; and / or

[0025] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0026] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0027] The plurality is at least two;

[0028] The RBS region of hemB2:

[0029] (I) Having a nucleotide sequence as shown in SEQ ID No. 46; and / or

[0030] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0031] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0032] The plurality is at least two;

[0033] The RBS region of hemC:

[0034] (I) Having a nucleotide sequence as shown in SEQ ID No. 49; and / or

[0035] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0036] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0037] The plurality is at least two;

[0038] The RBS region of the hemD:

[0039] (I) Having a nucleotide sequence as shown in any of SEQ ID No. 51-53; and / or

[0040] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0041] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0042] The plurality is at least two;

[0043] The RBS region of hemE:

[0044] (I) Having a nucleotide sequence as shown in SEQ ID No. 56; and / or

[0045] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0046] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0047] The plurality is at least two.

[0048] In a second aspect, the present invention also provides gene elements, including overexpressed hemA, hemL, gltX, hemB, hemC, hemD, and hemE.

[0049] In some specific embodiments of the present invention, the gene element further includes katE and / or sodB.

[0050] In some specific embodiments of the present invention, the gene element further includes sgRNA targeting cysG and / or hemX;

[0051] Preferably, the genomic DNA sequence corresponding to the sgRNA targeting cysG is as follows:

[0052] (I) Having a nucleotide sequence as shown in SEQ ID No. 41 or 42; and / or

[0053] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0054] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0055] The plurality is at least two;

[0056] Preferably, the genomic DNA sequence corresponding to the sgRNA targeting hemX is as follows:

[0057] (I) Having a nucleotide sequence as shown in SEQ ID No. 43 or 44; and / or

[0058] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0059] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0060] The plurality is at least two;

[0061] In some specific embodiments of the present invention, the gene element further includes gark, focA and / or proA.

[0062] In some specific embodiments of the present invention, the gene element further includes the replacement and optimization of the RBS regions of seven key genes: hemA, hemL, gltX, hemB, hemC, hemD, and hemE.

[0063] The RBS region of hemA has:

[0064] (I) The upstream primer has a nucleotide sequence as shown in SEQ ID No. 62; and / or

[0065] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0066] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0067] The plurality is at least two;

[0068] The RBS region of the hemL:

[0069] (I) Having a nucleotide sequence as shown in SEQ ID No. 59; and / or

[0070] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0071] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0072] The plurality is at least two;

[0073] The RBS region of gltX:

[0074] (I) Having a nucleotide sequence as shown in SEQ ID No. 64; and / or

[0075] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0076] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0077] The plurality is at least two;

[0078] The RBS region of hemB2:

[0079] (I) Having a nucleotide sequence as shown in SEQ ID No. 46; and / or

[0080] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0081] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0082] The plurality is at least two;

[0083] The RBS region of hemC:

[0084] (I) Having a nucleotide sequence as shown in SEQ ID No. 49; and / or

[0085] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0086] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0087] The plurality is at least two;

[0088] The RBS region of the hemD:

[0089] (I) Having a nucleotide sequence as shown in any of SEQ ID No. 51-53; and / or

[0090] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0091] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0092] The plurality is at least two;

[0093] The RBS region of hemE:

[0094] (I) Having a nucleotide sequence as shown in SEQ ID No. 56; and / or

[0095] (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or

[0096] (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II);

[0097] The plurality is at least two.

[0098] Thirdly, the present invention also provides a module for expressing the aforementioned gene element.

[0099] Fourthly, the present invention also provides a plasmid comprising the aforementioned module.

[0100] In some specific embodiments of the present invention, the plasmids include synthetic pathway expression plasmids, antioxidant module plasmids, base editing plasmids, GAP module plasmids, and / or RBS optimized plasmids;

[0101] Preferably, the synthetic pathway expression plasmid includes the precursor enhancement plasmid pYYDT-hemALG and the core synthetic module plasmid p15A-hemBCDE.

[0102] Preferably, the antioxidant module plasmid includes the antioxidant module integrator plasmid pYYDT-hemALGKS; the antioxidant module integrator plasmid pYYDT-hemALGKS assembles katE and sodB into an antioxidant expression module through a stepwise splicing method, and inserts it downstream of the pYYDT-hemALG vector, so that the resulting recombinant plasmid simultaneously carries hemA, hemL, gltX, katE and sodB expression units;

[0103] Preferably, the base editing plasmids include the cysG-targeting plasmid pFC-cysG and / or the hemX-targeting plasmid pFC-hemX;

[0104] Preferably, the GAP module plasmid includes the recombinant plasmid p15A-hemBCDEGAP carrying hemBCDE and the GAP module; the GAP module includes gark, focA and proA derived from the Shewanella genome;

[0105] Preferably, the RBS optimized plasmids include the pColE-hemALGKS-RBS series plasmids and / or the pYYDT-hemBCDEGAP-RBS series plasmids;

[0106] More preferably, the construction method of the pColE-hemALGKS-RBS series plasmids includes: using the constructed pYYDT-hemALGKS as a template, amplifying the hemALGKS module; replacing the optimized RBS designed for hemA, hemL and gltX with the upstream regions of the corresponding genes respectively, and completing the assembly by Gibson seamless cloning to construct the pColE-hemALGKS-RBS series plasmids;

[0107] More preferably, the construction method of the pYYDT-hemBCDEGAP-RBS series plasmids includes: using the hemBCDEGAP expression module in p15A-hemBCDEGAP as a template source, transferring it into the pYYDT vector backbone, and optimizing the RBS sequences of hemB, hemC, hemD and hemE respectively; constructing single-gene RBS replacement plasmids, and introducing the optimized RBS sequences into the upstream regions of each target gene through Gibson splicing or other methods to construct the pYYDT-hemBCDEGAP-RBS series plasmids.

[0108] Fifthly, the present invention also provides a host, including the plasmid described above.

[0109] In some specific embodiments of the present invention, the host includes microorganisms;

[0110] Preferably, the microorganism includes Shewanella;

[0111] More preferably, the chassis strain of the host includes Shewanella oneidensis MR-1.

[0112] In a sixth aspect, the present invention also provides a method for constructing an engineered strain, wherein the plasmid is transformed into a chassis strain to obtain the engineered strain;

[0113] Preferably, the chassis strain includes Shewanella oneidensis MR-1.

[0114] In a seventh aspect, the present invention also provides the use of any of the following in the synthesis of porphyrin compounds:

[0115] (I) the aforementioned module; and / or

[0116] (II) The plasmids mentioned above;

[0117] (III) The aforementioned host; and / or

[0118] (IV) The engineered strains obtained by the construction method described above;

[0119] Preferably, the porphyrin compound includes coprophyrin.

[0120] Eighthly, the present invention also provides a method for synthesizing porphyrin compounds, characterized in that it includes taking the host or the engineered strain obtained by the construction method, culturing, and collecting the culture.

[0121] In some specific embodiments of the present invention, 5-ALA is added during the culture process;

[0122] Preferably, 5-ALA at a final concentration of 1 g / L is added to the culture system at 36 h, 48 h, and 72 h during the culture process.

[0123] Compared with the prior art, the present invention has the following significant advantages:

[0124] 1. For the first time, key genes of the coprophyte biosynthesis pathway were completely located and identified in Shewanella, systematically elucidating the genetic basis of this pathway in Shewanella and providing clear targets for subsequent metabolic engineering.

[0125] 2. The biological functions of genes related to downstream and bypass metabolism of coprophyte were thoroughly analyzed. Knockout experiments clarified their interference effects and regulatory mechanisms on metabolic pathways, providing a theoretical basis for reducing byproduct accumulation and enhancing pathway efficiency.

[0126] 3. A highly efficient Shewanella strain for synthesizing coprophyte was successfully constructed, with the yield significantly increased from 152.69±3.52 mg / L of the original strain to 1906.84±39.21 mg / L, an increase of more than 12 times, demonstrating significant potential for industrial application. Attached Figure Description

[0127] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0128] Figure 1 Diagram showing the coprophytic metabolic pathway in Sheva strains;

[0129] Figure 2 Schematic diagram of plasmid elements, the core module for coprophyte production;

[0130] Figure 3 This shows the sequencing sites after gene knockout using CRISPR-FrCas9;

[0131] Figure 4 Show the RBS project replacement sequence;

[0132] Figure 5 Indicating intracellular reactive oxygen species levels in strains at different fermentation times;

[0133] Figure 6 The effects of different engineered strains on coproporphyrin production are shown. Detailed Implementation

[0134] This invention discloses a recombinant Sheva strain for efficient production of coprophyrin, its construction method, and its applications. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0135] Shewanella strains, as a class of microorganisms capable of naturally accumulating porphyrins, possess not only a unique substrate utilization spectrum but also a strong extracellular electron transfer capacity, thus demonstrating promising application potential in the field of microbial electrosynthesis. Importantly, recent studies have confirmed that Shewanella strains can efficiently synthesize 5-ALA via the C5 pathway, a key precursor in the biosynthesis of porphyrin compounds. Based on these characteristics and research foundation, Shewanella strains should also exhibit excellent performance in the downstream biosynthesis of porphyrin compounds, and are expected to become a novel, highly efficient chassis microorganism in this field, opening up a new pathway for the green biomanufacturing of porphyrin compounds.

[0136] This invention can be achieved through the following technical solutions:

[0137] On the one hand, this invention uses genetic engineering to directionally enrich the metabolic flux of Shewanella strains into the porphyrin synthesis pathway, thereby achieving efficient accumulation of coprophyrin. Specifically, this includes overexpressing the hemA, hemL, gltX, hemB, hemC, hemD, and hemE genes derived from the wild-type Shewanella strain genome, enhancing the metabolic flux of key steps in the porphyrin synthesis pathway, and improving the biosynthetic capacity of coprophyrin.

[0138] On the other hand, this invention further constructs engineered strains for efficient production of coproporphyrin and expands its applications. Specifically, this includes:

[0139] (1) Based on the above, an antioxidant module is introduced to alleviate the adverse effects of oxidative stress on cell growth during metabolic enhancement, thereby enhancing the biomass accumulation and fermentation stability of the strain.

[0140] (2) The cysG and hemX genes were silenced at the genome level using the cytosine base editor CRISPR-FrCas9 to reduce the competitive consumption of bypass metabolism on the synthesis of the target product.

[0141] (3) By regulating the translation intensity of each key gene through RBS engineering, the balanced expression of key enzymes in the pathway can be achieved, thereby further improving the synthesis efficiency of coprophyte.

[0142] The raw materials and experimental methods involved in this invention are as follows:

[0143] 1. Strains and Culture Conditions: The strain used was the wild-type *Shewanella oneidensis* MR-1, preserved in the laboratory (https: / / www.atcc.org / products / 700550). The culture temperature was 30℃, and the rotation speed was 200 r / min. The culture medium used was 2×YT medium, composed of: 16 g / L tryptone, 10 g / L yeast extract, and 5 g / L NaCl. Antibiotics were added according to the plasmid type to maintain plasmid stability, including chloramphenicol at 20 mg / L and kanamycin at 50 mg / L. Fermentation was carried out under dark or low-light conditions.

[0144] 2. Induction conditions: After inoculation and culture of the engineered bacteria, when the bacterial OD600 was approximately 0.6, IPTG was added to induce expression at a final concentration of 0.5 mM. Samples were taken for analysis at 36 h, 48 h, 72 h, and 96 h, with 96 h serving as the endpoint detection time.

[0145] 3. The target gene was obtained by PCR amplification, and the recombinant plasmid was assembled using the Gibson seamless cloning method. The assembly product was transformed into competent E. coli cells, and positive recombinants were obtained through antibiotic selection, colony PCR, and sequencing verification. Specific conditions are as follows:

[0146] ① Colony PCR: Colony PCR was performed using Novizan Taq DNA polymerase. The reaction system (25 μL) was as follows: 2×Mix enzyme: 12.5 μL, upstream primer (20 μM): 0.5 μL, downstream primer (20 μM): 0.5 μL, bacterial template: 2 μL, and ddH2O was added to 25 μL. The PCR program was as follows: 95℃ for 20 min, 33 cycles (95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min), 72℃ for 10 min, and incubation at 4℃.

[0147] ② Fragment amplification (high-fidelity PCR): PrimeSTAR high-fidelity DNA polymerase was used. The reaction system (25 μL) was as follows: 5×Buffer: 5 μL, dNTP: 1 μL, upstream primer (20 μM): 0.5 μL, downstream primer (20 μM): 0.5 μL, template DNA: approximately 5 ng, PrimeSTAR enzyme: 0.25 μL, ddH2O to a final volume of 25 μL. The PCR program was as follows: 98℃ for 2 min, 33 cycles (98℃ for 10 s, 55℃ for 15 s, 72℃ (1 min / kb), 72℃ for 10 min, 4℃ incubation).

[0148] ③ Assembly was performed using Sangon Gibson Assembly reagent: reaction temperature: 50℃, reaction time: 1.5–2 h, and the preferred molar ratio of carrier to insert fragment was 1:2–1:3.

[0149] 4. After the recombinant plasmids were assembled, they were all introduced into *E. coli* turbo competent cells using chemical transformation. The specific steps were as follows: The ligation product was added to pre-cooled *E. coli* turbo competent cells, gently mixed, and placed on ice for 30 min; then heat-shocked at 42℃ for 90 s, and immediately placed on ice for 2 min; then 500 μL of antibiotic-free 2×YT liquid medium was added, and the cells were revived and cultured at 37℃ and 200 r / min for 45–60 min; after revival, the bacterial culture was spread on solid medium plates containing the appropriate antibiotics and incubated upside down at 37℃ for 12–16 h; after single colonies grew, single colonies were picked for colony PCR and sequencing verification to obtain positive recombinants.

[0150] 5. Successfully validated plasmids will be introduced into the host bacteria via electroporation: Electroporation cup specifications: 0.2 cm, voltage: 2.47 kV. Immediately after electroporation, 2xYT medium will be added for recovery culture for 1-2 h, followed by resistance screening. Capacitance and resistance parameters can be set using conventional electroporation conditions in the art without affecting the implementation effect of this invention.

[0151] 6. Coprophyte was detected by high performance liquid chromatography (HPLC): chromatographic column: Agilent C18 reversed-phase column, mobile phase: 75% methanol + 25% 0.1% formic acid aqueous solution, flow rate: 0.6 mL / min, detection wavelength: 390 nm, column temperature: 35℃, injection volume: 10 μL. The coprophyte content was quantitatively analyzed by external standard method.

[0152] 7. Intracellular Reactive Oxygen Species (ROS) Detection: Intracellular ROS levels in bacteria at different fermentation stages were measured using a method based on 2',7'-dichlorofluorescein diacetate (DCFH-DA) (Nanjing Jiancheng reagent kit). Fermentation broth samples were collected at 36h, 48h, 72h, and 96h, centrifuged at 5000 rpm for 5 min, and washed three times with sterile PBS buffer. Subsequently, under light-protected conditions, the DCFH-DA fluorescent probe (final concentration 10 μM) was added to the diluted bacterial culture. The bacterial culture-fluorescent probe mixture was incubated in the dark at 30℃ for 1 h, with shaking to mix every 5-10 min during incubation. After incubation, the mixture was centrifuged at 5000 g for 5 min, washed three times consecutively with sterile PBS buffer, and finally resuspended with a certain volume of sterile PBS buffer. An appropriate amount of bacterial suspension treated with fluorescent dye was uniformly added to a 96-well microplate. The fluorescence intensity of the cell suspension was monitored using a microplate reader (BioTek Instruments Co., USA) at an excitation wavelength of 488 nm and an emission wavelength of 525 nm. To eliminate the influence of differences in cell mass between samples at different fermentation stages on the fluorescence signal, the total protein content of each sample was determined using a BCA protein quantification kit (Sangon Biotech, China), and the ROS fluorescence results were normalized to the total protein content. Specifically, the bacterial resuspension from the same batch as the ROS detection sample was lysed, centrifuged at 12000 g for 10 min, and the supernatant was used as the protein sample. Simultaneously, BSA standards were prepared to plot a standard curve. BCA working solution was added according to the kit instructions, and after incubation at 37℃ for 30 min, the absorbance was measured at 562 nm, and the sample protein concentration was calculated. Finally, the fluorescence intensity obtained from DCFH-DA detection was converted to the total protein content, and the result was expressed as relative fluorescence intensity / protein content.

[0153] Unless otherwise specified, the following examples all used the same experimental conditions described above. Statistical analysis was performed using WPS Office and Origin 2023 software. Differences between groups were assessed using a two-tailed t-test, with a significance threshold set at p < 0.05.

[0154] hemA (as shown in SEQ ID No. 1)

[0155] agagacgccaagaatctagaaaagagtcag

[0156] aaagaggagaaatactag

[0157] gltx (as shown in SEQ ID No. 3) agacgactttatataggtta

[0158] katE (as shown in SEQ ID No. 4) tttcagtaataaattaaggagacgagttca

[0159] tatgcaaattaataataaaggagagtagca atgtcattcgaattacctgcactaccatatgctaaagatgctctggcaccgcacatttctgcggaaaccatcgagtatcactacggcaagcaccatcagacttatgtcactaacctgaacaacctgattaaaggtaccgcgtttgaaggtaaatcactggaagagattattcgcagctctgaaggtggcgtattcaacaacgcagctcaggtctggaaccatactttctactggaactgcctggcaccgaacgccggtggcgaaccgactggaaaagtcgctgaagctatcgccgcatcttttggcagctttgccgatttcaaagcgcagtttactgatgcagcgatcaaaaactttggttctggctggacctggctggtgaaaaacagcgatggcaaactggctatcgtttcaacctctaacgcgggtactccgctgaccaccgatgcgactccgctgctgaccgttgatgtctgggaacacgcttattacatcgactatcgcaatgcacgtcctggctatctggagcacttctgggcgctggtgaactgggaattcgtagcgaaaaatctcgctgcataa

[0160] hemB (as shown in SEQ ID No. 6)

[0161] tttcacacaggaaacagct

[0162] hemC (as shown in SEQ ID No. 7)

[0163] ctaagatctcggatggaaactaggcatgtctgaaaaccgcatacgtatcgctacccgcaagagtccgctggccatgtggcaagcagaatttgttaaagcagaattagaacgcattcaccctggtattgtggtggagctattgccaatgagcactaagggcgatgttatcttagacacgccattagctaaagtcggtggcaaaggcttgttcgttaaagaactcgaagtcgccatgctggaagatcaagccgacatcgcggtgcactcaatgaaagacgtgcctgtagatttccccgaaggattaggactggaagtcatttgtgagcgtgaagatcctcgcgatgcttttgtctccaatatttataagtcgatcagtgagttgccacttggtgccacggttggtacttctagcctgcgccgtcagtgccaactgcgtgcttcccgtcccgatcttatcatcaaagatctgcgtggcaacgtaggtactcgcctcgcgaaactcgataacggtgaatacgatgcgattattcttgccgcggcaggcttaatccgcctgaagttatctgagcgtatcgccagctttatctctgccgaagagtccttacccgcaaacggtcaaggtgctgtcggtatcgaatgtcgcaccaatgatgagcgcgttaaagcattattagcgccattagaacacttagagacacgctaccgcgtgatcgccgagcgcgcgatgaatactcgccttgaaggtggttgccaagtccctattggcgcctttgccgaaattgatggtgatgagatgacactgcgcggattagtgggtaacccagatggcagtgaaatcatcgaaggcgtgatcaccggtcctaagaccgaagccacgcaattaggtgttgcccttgcggaagaactactcagcaaaggcgccaaaagcatcctcgatgctgtttacgccaaagcctaa

[0164] hemD (as shown in SEQ ID No.8)

[0165] gtcg atgaaagtcttactgacgcgccccgaggggcgcaatcagtccatggtcgatgccttgaatgaaagaggcatcgaacactgcgttacgccactactttgtgttgaggcgacaccggctctacctcctgaaacctcacatccactcgctaatgtcgatatggttgtctgtatcagcgccaatgcggttagctttgctgacgatacgtttaaagccaatgatgccaacgttaaaggctggccaaaagtgccttatttcgctgtagggcatgccacttgggaagcactacaacaaatcgacatcgatgcccttgaggcgcccgatgattgccagcagactgaagggttactaactctacctacgctgcaacacatccaaggcaaaaagattaccattattcgcggtgttggtggccgtgaagcgctcgctgaacaactgacatctagaggcgcacaggtgcgctattgggaagtctatcaacgtgcttgtccgccgctggatggcactattatcacccaacagtggatagacttagggatagatactgtcgtggtgacaagcggagaagtactggataatctgattaatctagtgccaaaagagttatttgcatggctgcgctcatgtcatatcatagtccccagtaaccgagtagaagctcaagctcatgcctttggtataacccaagtcaccaatgccaatgccgccaacagcaaagccgtgctaaacgcccttaaactctaa

[0166] hemE (as shown in SEQ ID No. 9)

[0167]

[0168] garK (as shown in SEQ ID No. 10)

[0169] cgcccaaaaaagctgtaggattttga

[0170] focA (as shown in SEQ ID No. 11)

[0171] caagttcgcgttcgtttatctggtttaggagtttagttatgaaagactcacactctaacgcctcacaggcgtcggcgaatggccatgagtcagtgccggtttcttcacactttagctgttattatcaagctgaaatttatggcaaaagcaaagtggttaaagcgccttggcaatcctttggtttagcggtgtttgcgggcgcctttattgccttagcgtttgtgttttacctgacggtaacgacgggcgcaggtgatagtgcatggggcttagtacgtcttgtgggcgggatagcctttagcttagggttaattttggtggtgatttgcggcggtgagctgtttaccagttcagtcttaagcagcgtagcttgggcgcaaaaacaagtgaccaccagtgagttgctcaaatgctggacgcgagtttatctgggtaactttgttggcgccatgttgatggtcggcttaattatggctgcggggttatacgaactcgatggtggtaattggggcttaaatgcattgaaagtggctcagcataaactgcatcatacttggatacaggcatttagcttaggtattttatgcaacatgctggtctgccttggtatttggatgacctttgccagtcgcgaatcgctaaccaaagcgattttattgatccttcctgtggccatgtttgtcagtagcggctttgagcacagtattgcaaacctgtttatggtgccatttgggataacaattcaagctgtggcaagtcctgagttttttgcctccttgggtgttacccaagaacaatttgccgatttaaccgtggcaaacttcatcttcaaaaatttaattccggtgaccttaggcaacatcgtcggcggtggggtgatagtcggcctcggttattggtggattgagcagggtcaaattgctttacccgatccgcaaaaatcccatcaaccccattttttcgcgtcaccactgcatactgaaaaggtgaaaaaaagccaagagagcaaatag

[0172] proA (as shown in SEQ ID No. 12)

[0173] cgacagctcttcacgttaaaagc

[0174] Table 1

[0175]

[0176]

[0177]

[0178] The recombinant Sheva strain for efficient coprophyte production, its construction method, and the raw materials and reagents used in its application provided by this invention are all commercially available.

[0179] The present invention will be further illustrated below with reference to the embodiments:

[0180] Example 1: Construction of related expression plasmids and editing plasmids

[0181] To achieve enhanced expression of the coprophyte synthesis pathway, alleviate host oxidative stress, precisely edit genes related to bypass metabolism, and further optimize the translation level of key enzymes, this embodiment sequentially constructs expression plasmids for the synthesis pathway, antioxidant modules, base editing, GAP modules, and RBS optimization. Unless otherwise specified, all target genes involved were amplified from the corresponding donor genomes by PCR. All recombinant plasmids were assembled using the Gibson seamless cloning method and validated through transformation of *E. coli* turbo competent cells, resistance selection, colony PCR, and Sanger sequencing.

[0182] 1. Construction of expression plasmids for synthetic pathways

[0183] 1.1 Construction of precursor enhancement plasmid pYYDT-hemALG

[0184] To enhance the supply of 5-aminolevulinic acid (5-ALA) and its upstream metabolic precursors, an upstream precursor enhancement module expression plasmid was constructed using the pYYDT vector as a backbone. First, a linearized vector backbone was obtained by PCR amplification using the pYYDT plasmid as a template. Then, the coding sequences of the hemA, hemL, and gltX genes were amplified using Shewanella genomic DNA as a template.

[0185] hemA, hemL, and gltX were placed under the same promoter regulation, and a multi-gene tandem expression cassette hemA-hemL-gltX was constructed by overlapping PCR. Ribosome binding sites and spacer sequences were set between each gene, as shown in SEQ ID No. 1~12. The spacer sequence is before the start codon ATG, which will not be described in detail below.

[0186] Subsequently, the expression cassette and the linearized vector were assembled using Gibson, transformed into E. coli, and after resistance screening, colony PCR and sequencing verification, the recombinant plasmid pYYDT-hemALG was obtained.

[0187] 1.2 Construction of the core synthesis module plasmid p15A-hemBCDE

[0188] To enhance the conversion of 5-ALA to downstream porphyrin intermediates in the main pathway of coprophyte synthesis, a core synthesis module expression plasmid was constructed using the p15A replicon vector as a backbone. First, a linearized vector backbone was obtained by PCR amplification using the p15A vector as a template. Then, using Shewanella genomic DNA as a template, the complete coding sequences of the hemB, hemC, hemD, and hemE genes were amplified, respectively.

[0189] Among them, hemB, hemC, hemD, and hemE encode key enzymes in the main pathway of coprophyte synthesis. Using overlap PCR, hemB, hemC, hemD, and hemE were assembled into a polycistronic expression cassette, hemB-hemC-hemD-hemE, in a predetermined order and placed downstream of the lac promoter. Ribosome binding sites and appropriate spacer sequences were also established between each gene to ensure the expression efficiency of each gene within the same transcription unit.

[0190] The obtained hemBCDE expression cassette was seamlessly assembled with the linearized p15A backbone using Gibson technology. The assembly product was transformed into E. coli turbo competent cells, and positive clones were then screened on appropriate antibiotic plates. Colony PCR and sequencing were performed on the obtained single clones to confirm that the inserted fragment sequence was correct, the orientation was correct, and all gene reading frames were complete. The recombinant plasmid was then extracted, named p15A-hemBCDE, and reserved for later use.

[0191] 2. Construction of antioxidant module plasmids

[0192] Construction of antioxidant module integrator plasmid pYYDT-hemALGKS

[0193] During the enhancement of coprophyte synthesis, increased metabolic flux is often accompanied by the accumulation of intracellular reactive oxygen species, which adversely affects cell growth and stable product synthesis. To enhance the host's antioxidant defense capabilities, the antioxidant genes katE and sodB were further introduced into the existing precursor enhancement plasmid pYYDT-hemALG to construct a composite expression plasmid carrying both a precursor enhancement module and an antioxidant module.

[0194] Specifically, using pYYDT-hemALG as a template, a linearized vector fragment was obtained by inverse PCR amplification; using E. coli genomic DNA as a template, the coding sequences of the katE and sodB genes were amplified respectively, and homologous overlapping sequences matching the vector insertion sites were introduced at both ends during primer design. katE encodes catalase, and sodB encodes superoxide dismutase; both can synergistically alleviate oxidative stress generated in the host under high-throughput metabolic conditions.

[0195] Subsequently, katE and sodB were assembled into an antioxidant expression module using a stepwise splicing method and inserted downstream of the pYYDT-hemALG vector, resulting in a recombinant plasmid carrying expression units of hemA, hemL, gltX, katE, and sodB simultaneously. After assembly via Gibson seamless cloning, the resulting product was transformed into *E. coli* turbo competent cells, and positive clones were screened on appropriate antibiotic plates. After verification by colony PCR and sequencing, the recombinant plasmid was extracted, named pYYDT-hemALGKS, and reserved for later use.

[0196] 3. Construction of base editing plasmids

[0197] 3.1 Construction of cysG-targeted editing plasmid pFC-cysG

[0198] A specific sgRNA for the CRISPR-FrCas9 base editing system was designed targeting the coprophyte synthesis bypass metabolism-related gene cysG. This sgRNA targets key functional regions within the cysG coding region, ensuring its target sequence meets the FrCas9 system's PAM sequence recognition requirements, while simultaneously placing the target cytosine within the effective editing window to achieve precise attenuation or inactivation of the cysG gene function.

[0199] Using a CRISPR-FrCas9 editing vector as a backbone, a designed and synthesized cysG-targeting sgRNA fragment was inserted into the corresponding sgRNA expression cassette position using the Gibson seamless cloning method to construct the cysG-targeting base editing plasmid pFC-cysG. The assembly product was transformed into E. coli turbo competent cells, and positive clones were selected after antibiotic selection. The plasmid was then extracted after verifying the correctness of the sgRNA sequence by colony PCR and sequencing.

[0200] 3.2 Construction of hemX-targeted editing plasmid pFC-hemX

[0201] Using a method similar to that used for cysG targeted editing plasmids, a specific sgRNA was designed targeting the coprophyte synthesis bypass metabolism gene hemX. This sgRNA was positioned at a key functional region within the hemX coding area and met the PAM and editing window requirements of the FrCas9 editing system. Using a CRISPR-FrCas9 editing vector as a backbone, the hemX-targeting sgRNA fragment was inserted via the Gibson seamless cloning method to construct the hemX-targeting editing plasmid pFC-hemX.

[0202] The resulting assembly product was transformed into E. coli turbo competent cells. After being screened for resistance, verified by colony PCR and sequencing, the recombinant plasmid was extracted for later use.

[0203] 4. Construction of GAP module plasmids

[0204] Construction of recombinant plasmid p15A-hemBCDEGAP carrying hemBCDE and GAP modules

[0205] To further optimize carbon flux allocation and improve the synthesis capability of the target product, a GAP module was introduced based on the core synthesis module plasmid p15A-hemBCDE. The GAP module includes the gark, focA, and proA genes derived from the Shewanella genome.

[0206] Specifically, using Shewanella genomic DNA as a template, the coding sequences of the gark, focA, and proA genes were amplified, and homologous overlapping sequences matching the vector insertion sites were introduced at both ends of the primers. Using p15A-hemBCDE as a template, a linearized vector backbone was obtained by inverse PCR amplification. Subsequently, the gark, focA, and proA genes were inserted into the p15A-hemBCDE plasmid using the Gibson seamless cloning method, thereby constructing the recombinant plasmid p15A-hemBCDEGAP, which simultaneously carries hemB, hemC, hemD, hemE, gark, focA, and proA.

[0207] The assembly product was transformed into *E. coli* turbo competent cells. After antibiotic selection, positive clones were selected, and the correctness of the inserted fragment sequence, orientation, and order was verified by colony PCR and sequencing. After verification, the recombinant plasmid was extracted for later use.

[0208] 5. Construction of RBS optimized plasmids

[0209] 5.1 RBS Optimization Strategy

[0210] To further improve the expression coordination and translation efficiency of key enzymes within the pathway, the RBS regions of seven key genes—hemA, hemL, gltX, hemB2, hemC, hemD, and hemE—were optimized through substitution. In this step, a novel dual-plasmid combination was employed: a plasmid carrying the hemALGKS module was constructed using pColE as the vector backbone, and a plasmid carrying the hemBCDEGAP module was constructed using pYYDT as the vector backbone.

[0211] Table 2

[0212]

[0213]

[0214] Specifically, based on the host expression characteristics of Shewanella, the functional location of each target gene in the metabolic pathway, and the expected translation intensity, three ribosome binding site sequences with different intensities were designed for the above seven genes, and the original RBS region upstream of the start codon of each gene was replaced by Gibson assembly.

[0215] 5.2 Construction of pColE-hemALGKS-RBS series plasmids

[0216] In the precursor enhancement and antioxidant module optimization section, plasmids carrying expression modules for hemA, hemL, gltX, katE, and sodB were constructed using the pColE vector as a backbone. First, a linearized backbone was amplified using the pColE vector as a template; simultaneously, the hemALGKS module was amplified using the previously constructed pYYDT-hemALGKS as a template or from the corresponding DNA fragments. Subsequently, optimized RBSs designed for hemA, hemL, and gltX were replaced with the upstream regions of their respective genes, and assembly was completed using Gibson seamless cloning, resulting in a series of optimized pColE-hemALGKS-RBS plasmids.

[0217] The assembly product was transformed into E. coli turbo competent cells, and after resistance selection, colony PCR and sequencing verification, the optimized plasmid with the correct sequence was obtained for later use.

[0218] 5.3 Construction of the pYYDT-hemBCDEGAP-RBS series plasmids

[0219] In the core synthesis and GAP module optimization section, the hemBCDEGAP expression module in p15A-hemBCDEGAP was used as a template source and transformed into the pYYDT vector backbone. The RBS sequences of hemB, hemC, hemD, and hemE were optimized through substitution. Single-gene RBS substitution plasmids were constructed, and the optimized RBS sequences were introduced into the upstream regions of each target gene using methods such as Gibson splicing, resulting in a series of pYYDT-hemBCDEGAP-RBS optimized plasmids.

[0220] The assembly product was transformed into E. coli turbo competent cells. After antibiotic selection and verification of positive clones by colony PCR and sequencing, the correct RBS optimized plasmid was obtained for later use.

[0221] Example 2 Construction of engineered strains

[0222] Based on the expression plasmids and editing plasmids constructed in Example 1, Shewanella engineered strains with different combinations of metabolic modules were further constructed. Unless otherwise specified, all strain transformations were performed using electroporation, and the resulting positive clones were verified by corresponding antibiotic plate selection and colony PCR.

[0223] 1. Construction of the synthetic pathway enhanced engineered strain SOCP-M1

[0224] The precursor enhancer plasmid pYYDT-hemALG and the core synthesis module plasmid p15A-hemBCDE were co-transformed into wild-type Shewanella chassis strains. After electroporation, the bacterial culture was plated on solid medium containing the corresponding antibiotics for screening. After single colonies grew on the plates, positive single clones were picked to obtain the engineered strain carrying both the hemALG precursor enhancer module and the hemBCDE core synthesis module, which was named SOCP-M1.

[0225] 2. Construction of the antioxidant module engineered strain SOCP-M2

[0226] The composite plasmid pYYDT-hemALGKS and the core synthesis module plasmid p15A-hemBCDE were co-transformed into Shewanella chassis strains. After screening with appropriate double antibiotics, positive clones were selected to obtain an engineered strain carrying the hemALG precursor enhancement module, the katE / sodB antioxidant module, and the hemBCDE core synthesis module, which was named SOCP-M2.

[0227] 3. Construction of base-editing strains SOCP-M3(c) and SOCP-M3(x)

[0228] pFC-cysG and pFC-hemX were electroporated into the engineered strain SOCP-M2, respectively, and transformants were obtained by screening under corresponding antibiotic resistance conditions. After selecting positive clones, the genomic region near the target site was amplified, and the base editing results were verified by Sanger sequencing.

[0229] Sequencing confirmed the presence of cysG-targeted editing strains and hemX-targeted editing strains, which were named SOCP-M3(c) and SOCP-M3(x), respectively. SOCP-M3(c) is a cysG gene-editing engineered strain, and SOCP-M3(x) is a hemX gene-editing engineered strain.

[0230] 4. Construction of GAP module engineered strain SOCP-M4

[0231] The p15A-hemBCDEGAP constructed in Example 1 was introduced into the Shewanella chassis strain for screening. Positive clones were picked on the corresponding resistance plates to obtain an engineered strain carrying the core synthesis module and GAP module, which was named SOCP-M4.

[0232] 5. Construction of the RBS-optimized engineered strain SOCP-M5 series

[0233] The pColE-hemALGKS-RBS series plasmids and pYYDT-hemBCDEGAP-RBS series plasmids constructed in Example 1 were co-transformed into Shewanella chassis strains according to a pre-defined combination. After screening for positive transformants on double-antibody plates, single clones were picked for colony PCR, and key sites were sequenced to verify that the designed RBS substitution sequence had been correctly introduced into the corresponding expression plasmid.

[0234] Based on different RBS combinations, a series of optimized engineered strains with different translation intensities and module expression ratios can be obtained, which are uniformly named the SOCP-M5 series, such as SOCP-M5-B1, SOCP-M5-B2, and SOCP-M5-B3 (corresponding to the RBS sequences in Table 2, respectively).

[0235] Example 3: Induction Fermentation and Production Validation of Engineered Strains

[0236] To evaluate the coprophyte synthesis capacity and related physiological phenotypes of the above-mentioned engineered strains, shake-flask fermentation was performed on different engineered strains to verify their synthesis, and the intracellular oxidative stress level and target product accumulation were detected.

[0237] 1. Production Validation of SOCP-M1

[0238] Positive monoclonal strains of the engineered strain SOCP-M1 were inoculated into liquid culture medium (such as the 2×YT medium described in the full text) containing the corresponding antibiotics (such as chloramphenicol at 20 mg / L and kanamycin at 50 mg / L as mentioned above) for fermentation experiments (culture temperature 30℃, rotation speed 200 r / min). In this experiment, after the precursor enhancement module hemALG and the core synthesis module hemBCDE were introduced for synergistic expression, the fermentation broth color changed, and the accumulation of coprophytic porphyrin was detected. The coprophytic porphyrin yield under overexpression conditions was determined to be 152.69 mg·L⁻¹. -1 In contrast, the wild-type strain produced less coprophyte and could not be detected by liquid chromatography under these detection conditions.

[0239] 2. Production Validation of SOCP-M2

[0240] The engineered strain SOCP-M2 was subjected to shake-flask fermentation under the same culture and induction conditions as SOCP-M1 (culture temperature 30℃, rotation speed 200 r / min). Figure 5 As shown, after further introducing the antioxidant modules katE and sodB on top of the precursor enhancement module and core synthesis module, the intracellular oxidative stress level of the strain decreased, the cellular physiological state was improved, and the synthesis process of the target product became more stable. Figure 6 As shown, SOCP-M2 exhibited superior coprophyte accumulation compared to SOCP-M1, with a concentration of 485.99 mg·L⁻¹. -1 This indicates that the introduction of the antioxidant module helps alleviate stress damage caused by high-throughput metabolism.

[0241] 3. Production Validation of SOCP-M3(c) and SOCP-M3(x)

[0242] The engineered strains SOCP-M3(c) and SOCP-M3(x) were validated by shake-flask fermentation (culture temperature 30℃, rotation speed 200 r / min), and the results are as follows. Figure 6 As shown, base editing of the bypass metabolism-related genes cysG or hemX altered the coprophyte accumulation levels in the strains. Among them, strain SOCP-M3(c) exhibited a higher coprophyte yield of 575.42 mg·L⁻¹. -1 .

[0243] Table 3 Figure 5 raw data

[0244]

[0245] Table 4 Figure 6 raw data

[0246]

[0247] 4. Production Validation of SOCP-M4

[0248] The engineered strain SOCP-M4, carrying the hemBCDE and GAP modules, was validated by shake-flask fermentation at 30℃ and 200 r / min, and compared with engineered strains of the basic synthetic pathway. Results are as follows: Figure 6 As shown, by further introducing gark, focA, and proA into the core synthesis module, the metabolic network of the host bacterium was further regulated. The supply of related precursors and the allocation of carbon flux were more favorable for the synthesis of the target product. The coprophyte yield of the strain was further increased compared with that of strain M3, reaching 958.04 mg·L⁻¹. -1 This indicates that the introduction of the GAP module has a positive effect on improving the synthesis capability of the target product.

[0249] 5. Production validation of the SOCP-M5 series strains

[0250] The RBS sequences of hemA, hemL, gltX, hemB, hemC, hemD, and hemE were optimized and then screened by shake-flask fermentation at 30℃ and 200 r / min. Among them, the D3-L3 double RBS replacement strain showed a higher accumulation level of the target product (1525.52 mg·L⁻¹) than the control strain M4 without RBS replacement. -1 This indicates that by regulating the translation intensity of key enzymes, the expression matching between upstream and downstream modules in the pathway can be further improved, metabolic bottlenecks can be reduced, and thus the efficiency of comatoporphyrin synthesis can be enhanced.

[0251] 6. Verification of the promoting effect of exogenous 5-ALA supplementation on coproporphyrin synthesis

[0252] To further verify the limiting effect of precursor supply on coprophyte synthesis and to investigate the promoting effect of exogenous feeding strategy on the accumulation of target products, a 5-ALA feeding experiment was conducted on the selected engineered strain during shake-flask fermentation. Specifically, the strain was inoculated into a fermentation medium containing the corresponding antibiotics (the medium used was 2×YT medium, with the composition of: 16 g / L tryptone, 10 g / L yeast extract, and 5 g / L NaCl. Antibiotics were added according to the plasmid type to maintain plasmid stability, with chloramphenicol at 20 mg / L and kanamycin at 50 mg / L). 5-ALA was added to the culture system at a final concentration of 1 g / L at 36 h, 48 h, and 72 h, and the culture was continued until the end of fermentation, at which point the growth of the strain and the coprophyte yield were detected.

[0253] like Figure 6As shown, after further supplementing with exogenous 5-ALA based on the original engineering modifications, the coprophyte production of the strain was further increased to 1906.84 mg·L⁻¹. -1 This indicates that precursor supply remains a crucial factor affecting the efficient synthesis of coprophyrins. Exogenous feeding can effectively enhance the availability of precursors in the pathway, thereby increasing the downstream porphyrin synthesis flux and promoting the accumulation of target products. These results further demonstrate that combining metabolic engineering with a feeding strategy in the fermentation process can help further improve the biosynthetic level of coprophyrins.

[0254] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of overexpression of hemA, hemL, gltX, hemB, hemC, hemD, and hemE in any of the following: (I) Constructing engineered Shewanella strains that efficiently synthesize coproporphyrin; and / or (II) Increase coprophyte production.

2. The application as described in claim 1, characterized in that, This also includes the introduction of katE and / or sodB; and / or This also includes silencing cysG and / or hemX; and / or This also includes the introduction of gark, focA, and / or proA; and / or It also includes optimization by replacing the RBS regions of seven key genes: hemA, hemL, gltX, hemB, hemC, hemD, and hemE. Preferably, the RBS region of hemA is: (I) Having a nucleotide sequence as shown in SEQ ID No. 62; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the RBS region of the hemL is: (I) Having a nucleotide sequence as shown in SEQ ID No. 59; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the RBS region of the gltX is: (I) Having a nucleotide sequence as shown in SEQ ID No. 64; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the RBS region of hemB2 is: (I) Having a nucleotide sequence as shown in SEQ ID No. 46; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the RBS region of the hemC is: (I) Having a nucleotide sequence as shown in SEQ ID No. 49; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the RBS region of the hemD is: (I) Having a nucleotide sequence as shown in any of SEQ ID No. 51-53; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the RBS region of the hemE is: (I) Having a nucleotide sequence as shown in SEQ ID No. 56; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two.

3. A gene element, characterized in that, This includes overexpressed hemA, hemL, gltX, hemB, hemC, hemD, and hemE.

4. The gene element as described in claim 3, characterized in that, Also includes katE and / or sodB; and / or It also includes sgRNAs that target cysG and / or hemX; Preferably, the genomic DNA sequence corresponding to the sgRNA targeting cysG is as follows: (I) Having a nucleotide sequence as shown in SEQ ID No. 41 or 42; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the genomic DNA sequence corresponding to the sgRNA targeting hemX is as follows: (I) Having a nucleotide sequence as shown in SEQ ID No. 43 or 44; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the gene element further includes gark, focA, and / or proA; Preferably, the gene element further includes the replacement and optimization of the RBS regions of seven key genes: hemA, hemL, gltX, hemB, hemC, hemD, and hemE. Preferably, the RBS region of hemA has: (I) The upstream primer has a nucleotide sequence as shown in SEQ ID No. 62; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the RBS region of the hemL is: (I) Having a nucleotide sequence as shown in SEQ ID No. 59; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the RBS region of the gltX is: (I) Having a nucleotide sequence as shown in SEQ ID No. 64; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the RBS region of hemB2 is: (I) Having a nucleotide sequence as shown in SEQ ID No. 46; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the RBS region of the hemC is: (I) Having a nucleotide sequence as shown in SEQ ID No. 49; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the RBS region of the hemD is: (I) Having a nucleotide sequence as shown in any of SEQ ID No. 51-53; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two; Preferably, the RBS region of the hemE is: (I) Having a nucleotide sequence as shown in SEQ ID No. 56; and / or (II) A nucleotide sequence having the nucleotide sequence shown in (I) obtained by substitution, deletion, or addition of one or more bases, and having the same function as the nucleotide sequence shown in (I); and / or (III) Having a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence shown in (I) or (II); The plurality is at least two.

5. A module, characterized in that, Express the gene element as described in claim 3 or 4.

6. A plasmid, characterized in that, Includes the module as described in claim 5.

7. The plasmid as described in claim 6, characterized in that, This includes synthetic pathway expression plasmids, antioxidant module plasmids, base editing plasmids, GAP module plasmids, and / or RBS optimized plasmids; Preferably, the synthetic pathway expression plasmid includes the precursor enhancement plasmid pYYDT-hemALG and the core synthetic module plasmid p15A-hemBCDE. Preferably, the antioxidant module plasmid includes the antioxidant module integrator plasmid pYYDT-hemALGKS; the antioxidant module integrator plasmid pYYDT-hemALGKS assembles katE and sodB into an antioxidant expression module through a stepwise splicing method, and inserts it downstream of the pYYDT-hemALG vector, so that the resulting recombinant plasmid simultaneously carries hemA, hemL, gltX, katE and sodB expression units; Preferably, the base editing plasmids include the cysG-targeting plasmid pFC-cysG and / or the hemX-targeting plasmid pFC-hemX; Preferably, the GAP module plasmid includes the recombinant plasmid p15A-hemBCDEGAP carrying hemBCDE and the GAP module; the GAP module includes gark, focA and proA derived from the Shewanella genome; Preferably, the RBS optimized plasmids include the pColE-hemALGKS-RBS series plasmids and / or the pYYDT-hemBCDEGAP-RBS series plasmids; More preferably, the construction method of the pColE-hemALGKS-RBS series plasmids includes: using the constructed pYYDT-hemALGKS as a template, amplifying the hemALGKS module; replacing the optimized RBS designed for hemA, hemL and gltX with the upstream regions of the corresponding genes respectively, and completing the assembly by Gibson seamless cloning to construct the pColE-hemALGKS-RBS series plasmids; More preferably, the construction method of the pYYDT-hemBCDEGAP-RBS series plasmids includes: using the hemBCDEGAP expression module in p15A-hemBCDEGAP as a template source, transferring it into the pYYDT vector backbone, and optimizing the RBS sequences of hemB, hemC, hemD and hemE respectively; constructing single-gene RBS replacement plasmids, and introducing the optimized RBS sequences into the upstream regions of each target gene through Gibson splicing or other methods to construct the pYYDT-hemBCDEGAP-RBS series plasmids.

8. The host, characterized in that, Including the plasmids as described in claim 6 or 7; Preferably, the host includes microorganisms; Preferably, the microorganism includes Shewanella; More preferably, the chassis strain of the host includes Shewanella oneidensis MR-1.

9. A method for constructing engineered bacterial strains, characterized in that, The plasmid as described in claim 6 or 7 is transformed into the chassis strain to obtain the engineered strain; Preferably, the chassis strain includes Shewanella oneidensis MR-1.

10. Any of the following applications in the synthesis of porphyrin compounds: (I) The module as described in claim 5; and / or (II) The plasmid as described in claim 6 or 7; (III) The host as described in claim 8; and / or (IV) The engineered strain obtained by the construction method as described in claim 9; Preferably, the porphyrin compound includes coprophyrin.

11. A method for synthesizing porphyrin compounds, characterized in that, This includes taking the host as described in claim 8 or the engineered strain obtained by the construction method as described in claim 9, culturing it, and collecting the culture; Preferably, 5-ALA is added during the culture process; Preferably, 5-ALA at a final concentration of 1 g / L is added to the culture system at 36 h, 48 h, and 72 h during the culture process.

Images