Application of apatx3 gene in regulating andsystolic synthesis of andrographolide

Abstract

The application discloses application of ApATX3 gene in regulation and control of andrographolide synthesis and belongs to the technical field of genetic engineering. Andrographis natural plant lactone accumulation is low, and large-scale production is limited. At present, the number of andrographolide regulation and control genes reported is limited, and the related molecular regulation and control mechanism and gene interaction network are not clear, so it is difficult to efficiently realize directional improvement of andrographolide content. The application finds that ApATX3 gene of andrographis has a regulation and control function in andrographolide biosynthesis, fills the deficiency of existing metabolic regulation and control mechanism research. Through utilization of ApATX3 gene, precise improvement of andrographolide content is realized, a bottleneck of endogenous accumulation in germplasm is broken through, and new gene resources and theoretical basis are provided for breeding of new andrographis germplasm with high lactone content.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of the ApATX3 gene in regulating andrographolide synthesis. Background Technology

[0002] Andrographis paniculata is a traditional Chinese medicinal herb with significant development potential, widely used in both traditional Chinese medicine and modern medicine. Andrographolide, a unique diterpenoid secondary metabolite active ingredient found in the plant, is the core active ingredient responsible for its pharmacological functions, including clearing heat and detoxifying, anti-inflammation, antiviral, antitumor, and cardiovascular protection. It possesses extremely high medicinal and industrial value.

[0003] Currently, the industrial production of andrographolide mainly relies on extraction from plant materials. However, the accumulation of andrographolide in both wild and cultivated Andrographis paniculata is low, severely limiting its large-scale production and widespread application. Conducting precise genetic improvement of Andrographis paniculata to increase the yield of andrographolide plays a crucial role in the subsequent industrial application of andrographolide extraction.

[0004] The biosynthesis and accumulation of andrographolide is a complex, multi-gene regulated trait, synergistically regulated by multiple functional genes and transcription factors. Therefore, in molecular breeding, precise improvement can be achieved through key gene discovery and molecular breeding techniques. In recent years, several genes, such as ApTrihelix1 and ApDof29, have been cloned and their functions verified, confirming that andrographolide levels can be increased in vivo through the regulation of key genes. However, the molecular regulatory mechanism of andrographolide is not yet fully elucidated, and the interactions and regulatory networks among various functional genes remain unclear. Therefore, further discovery and identification of key functional genes related to andrographolide are of significant research importance for refining the theory of andrographolide metabolic regulation, cultivating high-lactone-content andrographis paniculata germplasm, and promoting the efficient industrial production of andrographolide. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the ApATX3 gene in regulating andrographolide synthesis, so as to solve the problems existing in the prior art.

[0006] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of this invention is the application of the ApATX3 gene or a recombinant vector, recombinant expression cassette or recombinant bacteria containing the ApATX3 gene in increasing the content of andrographolide in Andrographis paniculata plants.

[0007] The second technical solution of the present invention is a method for increasing the content of andrographolide in Andrographis paniculata plants, comprising the step of introducing the ApATX3 gene or a recombinant vector, recombinant expression cassette or recombinant bacteria containing the ApATX3 gene into the Andrographis paniculata plants, so as to overexpress the ApATX3 gene in the Andrographis paniculata plants.

[0008] The third technical solution of the present invention is the application of the ApATX3 gene or a recombinant vector, recombinant expression cassette or recombinant bacteria containing the ApATX3 gene in the cultivation of new Andrographis paniculata varieties with increased andrographolide content, wherein the nucleotide sequence of the ApATX3 gene is shown in SEQ ID NO.1.

[0009] The fourth technical solution of the present invention is a method for cultivating a new variety of Andrographis paniculata with increased andrographolide content, comprising the following steps: introducing the ApATX3 gene into the target plant, thereby obtaining the variety; the nucleotide sequence of the ApATX3 gene is shown in SEQ ID NO.1.

[0010] Based on the above technical solution, the present invention has the following technical effects: This invention discovers the regulatory function of the ApATX3 gene in andrographolide biosynthesis in Andrographis paniculata, filling a gap in existing research on metabolic regulatory mechanisms. By utilizing the ApATX3 gene, the content of andrographolide can be precisely increased, breaking through the bottleneck of endogenous accumulation in germplasm, and providing new genetic resources and theoretical basis for breeding new Andrographis paniculata germplasm with high lactone content. Attached Figure Description

[0011] Figure 1 This is a schematic diagram of the OEFlag vector used for overexpression.

[0012] Figure 2 This is a schematic diagram of the pLY156 vector used in virus-induced gene silencing (VIGS) experiments.

[0013] Figure 3 This is an auxiliary plasmid vector for pTRV1 used in virus-induced gene silencing (VIGS) experiments.

[0014] Figure 4 This study validated the function of ApATX3 in regulating andrographolide. In A, transformation of *Andrographis paniculata* leaves with the overexpression vector ApATX3 significantly increased andrographolide content. In B, transformation of *Andrographis paniculata* leaves with the viral interference vector pLY156-ApATX3 interfered with the ApATX3 gene, downregulating andrographolide content. An asterisk (*) indicates a significant difference compared to the control (p<0.05). Ctr: Control. pTRV1 is an helper plasmid. Detailed Implementation

[0015] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0016] The OEFlag vector used in this invention was modified by our laboratory based on the pCAMBIA1302 vector backbone (https: / / www.snapgene.com / plasmids / plant_vectors / pCAMBIA1302). Compared with the original vector, the original mGFP5 fragment was replaced with the stronger signal tdtomato, and a 35S:MCS:3Flag expression cassette (which was inserted using gene synthesis) was inserted between HindIII and EcoRI to insert the exogenous gene, thus forming the OEFlag vector.

[0017] This invention provides the application of the ApATX3 gene or a recombinant vector containing the ApATX3 gene, a recombinant expression cassette, or a recombinant bacterium in increasing the content of andrographolide in Andrographis paniculata plants.

[0018] In some specific implementations, the nucleotide sequence of the ApATX3 gene is shown in SEQ ID NO.1.

[0019] This invention also provides a method for increasing the content of andrographolide in Andrographis paniculata plants, including the step of introducing the ApATX3 gene or a recombinant vector, recombinant expression cassette or recombinant bacteria containing the ApATX3 gene into the Andrographis paniculata plants, so that the ApATX3 gene is overexpressed in the Andrographis paniculata plants.

[0020] In some specific implementations, the nucleotide sequence of the ApATX3 gene is shown in SEQ ID NO.1.

[0021] This invention also provides the application of the ApATX3 gene or a recombinant vector containing the ApATX3 gene, a recombinant expression cassette or a recombinant bacterium in the cultivation of new Andrographis paniculata varieties with increased andrographolide content, wherein the nucleotide sequence of the ApATX3 gene is shown in SEQ ID NO.1.

[0022] This invention also provides a method for cultivating a new Andrographis paniculata variety with increased andrographolide content, comprising the following steps: introducing the ApATX3 gene into the target plant; the nucleotide sequence of the ApATX3 gene is shown in SEQ ID NO.1.

[0023] In some specific implementation schemes, the ApATX3 gene is introduced into the target plant via a recombinant vector containing the ApATX3 gene, a recombinant expression cassette, or a recombinant bacterium.

[0024] Example 1 1. Plant materials The germplasm of *Hylocereus undatus* provided for testing was SW001 (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_004354405.1 / ).

[0025] 2. Cloning of the ApATX3 gene from Andrographis paniculata Based on the ATX3 mRNA information submitted to NCBI (accession number XM_051289223.1), the full-length CDS sequence of ATX3 (bases 360-3458) was obtained and named ApATX3. Its complete sequence is as follows: aggaggcatcacctgtgaaaaatgatgacagtgtaaaagagaca actggttcaagtcaggagtcggaatacaatatctcacagaatataattgataaaagtaaaagtactgaagtctgtg acagctgtggcctgatgtttccatgcaaaatgatcaaaaaagtgactgatgcaagagctaattctcattctctctg tgaacattgcattaagttgcgaaaatcaaaaaaatgctgtcgcatttgcaataaaaattcgcagcattctgaaggc ggcagttggatctgttgtgatggttgtgatgtttgggt

[0026] 3. Construction of the ApATX3 overexpression vector (OEFlag-ApATX3) (1) Based on the above sequence, design primers for the overexpression vector of ApATX3.

[0027] OE-ATX3-F (SEQ ID NO.2): GGTCGACGGTATCGATAatgattgggaaacggccgagcaa; OE-ATX3-R (SEQ ID NO. 3): TGGTGGGAGCTCTGTCGGAgtttaggaatttcctgcagttgg.

[0028] The steps for performing a PCR reaction are as follows: The PCR reaction system was prepared as follows: 10 μL PCR Mix (GenStar, catalog number A012-101), 1 μL Andrographis paniculata cDNA template, 1 μL OE-ATX3-F primer, 1 μL OE-ATX3-R primer, and 7 μL water.

[0029] Set up the PCR program: pre-denature at 95℃ for 5 min, then enter the cyclic amplification phase: 95℃ 30s → 60℃ 30s → 72℃ 120s, cycle 35 times, and finally incubate at 72℃ for 5 min. The PCR products are then excised and recovered from the gel.

[0030] (2) Overexpression vector OEFlag binary vector ( Figure 1 The main steps for performing a double enzyme digestion reaction are as follows: Prepare the digestion system: 1 μL restriction enzyme buffer (rCutSmart buffer, NEB, catalog number B6004V), 1 μL OEFlag vector, 1 μL Hind III enzyme (NEB, catalog number R3104V), 1 μL BamHI enzyme (NEB, catalog number R3136V), and 6 μL water. Incubate the prepared digestion system at 37°C for 60 min.

[0031] (3) The ApATX3 fragment recovered in the above steps was ligated into the OEFlag binary vector. The main steps are as follows: 4 μL of ApATX3 amplification product, 1 μL of double-digested OEFlag binary vector, and 5 μL of 2X Assembly Mix (Takegold, catalog number CU101) were reacted at 50 ℃ for 15 min to construct the OEFlag-ApATX3 overexpression vector. The vector was stored at -20 ℃.

[0032] 4. Construction of the virus-induced gene silencing vector for ApATX3 (pLY156-ApATX3) (1) Based on the CDS sequence of ApATX3 above, primers were designed, and suitable fragments were selected for PCR. The primer sequences are as follows: pLY156-ApATX3-F (SEQ ID NO.4):TGAGTAAGGTTACCGAATTC aggaggcatcacctgtg; pLY156-ApATX3-R (SEQ ID NO.5): ACGCGTGAGCTCGGTACC acccaaacatcacaaccatc.

[0033] The PCR reaction steps are as follows: The PCR reaction system was prepared as follows: 10 μL PCR Mix (GenStar catalog number A012-101), 1 μL Andrographis paniculata cDNA template, 1 μL pLY156-ApATX3-F primer, 1 μL pLY156-ApATX3-R primer, and 7 μL water.

[0034] Set up the PCR program: pre-denature at 95℃ for 5 min, then enter the cyclic amplification phase: 95℃ 30s → 60℃ 30s → 72℃ 30s, cycle 35 times, and finally incubate at 72℃ for 5 min. The PCR products are then excised and recovered from the gel.

[0035] (2) The virus-induced gene silencing vector pLY156 (https: / / doi.org / 10.1093 / hr / uhag118) was digested with enzymes. The main steps are as follows: Prepare the enzyme digestion system: 1 μL restriction enzyme buffer (rCutSmart buffer, NEB, catalog number B6004V), 1 μL pLY156 vector, 1 μL EcoRI enzyme (NEB, catalog number R3101V), 1 μL KpnI enzyme (NEB, catalog number R3142V), and 6 μL water. The prepared enzyme digestion system was placed at 37℃ and reacted for 60 min.

[0036] (3) The ApATX3 fragment was ligated into the digested pLY156 vector. The main steps were as follows: 4 μL of ApATX3 amplification product, 1 μL of double-digested pLY156 binary vector, and 5 μL of 2X Assembly Mix (TransGold, catalog number CU101). The mixture was reacted at 50 ℃ for 15 min to construct the pLY156-ApATX3 vector for virus-induced gene silencing experiments. The vector was stored at -20 ℃.

[0037] 5. Functional verification experiment of ApATX3 (1) The OEFlag-ApATX3 overexpression vector, the pLY156-ApATX3 vector, the empty OEFlag and pLY156 vectors, and the pTRV1 helper plasmid from the virus-induced gene silencing experiment were used to express the OEFlag-ApATX3 overexpression vector, the pLY156-ApATX3 vector, the empty OEFlag and pLY156 vectors, and the pTRV1 helper plasmid from the Figure 3 The bacteria were transformed into GV3101 Agrobacterium competent cells. Colonies identified by antibiotic selection and PCR were inoculated into cells containing 50 μg / mL of [agent / inotropic agent]. –1 Kanamycin and 50 μg·mL –1 Incubate overnight in LB liquid medium with rifampicin at 28 °C and 200 rpm, then transfer to fresh LB liquid medium to OD. 600 The bacterial cells were collected by centrifugation to approximately 1.0, resuspended in osmotic buffer (10 mM MgCl2, 10 mM MES, pH=5.6, 100 mM acetylsylcholine) and adjusted to OD. 600 The value is 1.0, and it should be left to stand at room temperature for about 2-4 hours.

[0038] (2) Selected Andrographis paniculata plants at the 4-leaf stage, and infected them by vacuum permeation. After culturing under normal greenhouse growth conditions for 10 days, samples were taken, quick-frozen in liquid nitrogen, and the andrographolide content of the transformed plants was detected. The control combination of the transformed strains was: (1) OEFlag-ApATX3 overexpression and OEFlag empty vector; (2) pLY156-ApATX3 / pTRV1 (1:1 mixture) (virus-induced gene silencing vector-helper plasmid) and pLY156 / pTRV1 (1:1 mixture) (empty vector-helper plasmid) ( Figure 4 ).

[0039] 6. Determination of andrographolide content in transformed plants and control plants (HPLC method).

[0040] (1) Preparation of andrographolide standard solution: Take an appropriate amount of andrographolide reference standard, accurately weigh it, and add 50% methanol to prepare a solution containing 1 mg in 1 mL.

[0041] (2) Sample preparation of transformed Andrographis paniculata plants: The transformed Andrographis paniculata plants were dried in an oven at 60℃ and ground into powder. 0.04 g was dissolved in 1.0 mL of 50% methanol, sonicated, centrifuged at 15000 rpm for 10 min, and the supernatant was filtered through a 0.22 μm nylon membrane and injected into the HPLC system.

[0042] HPLC chromatographic conditions: Agilent Zorbax SB-C18 column (4.6 × 150 mm; 5 μm); mobile phase: acetonitrile (A) - water (B) gradient elution (0–8 min, 21%–25% A; 8–14 min, 25%–27% A; 14–20 min, 27%–55% A; 20–25 min, 55%–85% A; 25–30 min, 85% A); flow rate: 1 mL·min⁻¹; column temperature: 25 ℃; detection wavelength: 205 nm; injection volume: 5 μL.

[0043] The results are as follows Figure 4 As shown, transformation of Andrographis paniculata leaves with the overexpression vector ApATX3 significantly increased the content of andrographolide. Transformation of Andrographis paniculata leaves with the viral interference vector pLY156-ApATX3 interfered with the ApATX3 gene, resulting in a downregulation of andrographolide content.

[0044] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. Application of the ApATX3 gene or recombinant vectors, recombinant expression cassettes or recombinant bacteria containing the ApATX3 gene in increasing the content of andrographolide in Andrographis paniculata plants.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the ApATX3 gene is shown in SEQ ID NO.

1.

3. A method for increasing the content of andrographolide in Andrographis paniculata plants, characterized in that, The method includes the steps of introducing the ApATX3 gene or a recombinant vector, recombinant expression cassette or recombinant bacteria containing the ApATX3 gene into Andrographis paniculata plants, so that the ApATX3 gene is overexpressed in the Andrographis paniculata plants.

4. The method according to claim 3, characterized in that, The nucleotide sequence of the ApATX3 gene is shown in SEQ ID NO.

1.

5. The application of the ApATX3 gene or recombinant vectors, recombinant expression cassettes, or recombinant bacteria containing the ApATX3 gene in cultivating new Andrographis paniculata varieties with increased andrographolide content, characterized in that... The nucleotide sequence of the ApATX3 gene is shown in SEQ ID NO.

1.

6. A method for cultivating a new Andrographis paniculata variety with increased andrographolide content, characterized in that, Includes the following steps: The ApATX3 gene is introduced into the target plant to obtain the desired result; the nucleotide sequence of the ApATX3 gene is shown in SEQ ID NO.

1.

7. The method according to claim 6, characterized in that, The ApATX3 gene is introduced into the target plant via a recombinant vector, recombinant expression cassette, or recombinant bacteria containing the ApATX3 gene.

Images