Wickerhamiella jfordiae and recombinant bacteria and application thereof

Abstract

The application discloses a Candida viswanathii ZX01, a recombinant bacterium thereof and application of the Candida viswanathii ZX01 in production of long-chain dibasic acid. The Candida viswanathii ZX01 has high long-chain dibasic acid production capacity under low pH conditions (fermentation pH 4.0-5.5). The gene engineering bacterium is obtained by integrating a vgb gene into a genome through a PiggyBac transposition system, and the engineering bacterium can effectively improve long-chain dibasic acid yield, production rate, molar conversion rate and oxygen uptake efficiency. The method of the application significantly reduces energy consumption cost in production of long-chain dibasic acid.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a strain of Candida virescens, and also to recombinant bacteria constructed using this strain and their applications. Background Technology

[0002] Long-chain dicarboxylic acids are ortho-carboxylic acids with ten or more carbon atoms. Currently, the most frequently reported applications include sebacic acid, undecanoic acid, lauryl acid, tridecanoic acid, tetradecanoic acid, and pentadecanoic acid, which are important raw materials for the synthesis of polyamides, engineering plastics, high-grade fragrances, and high-grade lubricants. Compared to the harsh reaction conditions of traditional chemical methods such as high temperature and high pressure, the main method for large-scale production of long-chain dicarboxylic acids is currently microbial fermentation using petroleum or coal-derived alkanes, fatty acids, and their derivatives as raw materials. The strains currently used for fermentation are mainly derived from Candida tropicalis and Candida virescens.

[0003] With the elongation of the carbon chain in long-chain dicarboxylic acids, the flexibility of long-chain polyamide materials increases, resulting in significant advantages in the synthesis of high-performance nylon engineering plastics, hot melt adhesives for clothing, and advanced coatings. However, the currently reported *Candida viviparus* strains are produced using long-chain fatty acids or esters, monohexanes, etc., as raw materials (patent application numbers 202411081003.2; 201910556964.7; 201910556961.3), and employ a traditional fed-batch neutralizing agent fermentation process. This often requires the addition of large amounts of alkali solutions (such as sodium hydroxide) for neutralization, leading to industry problems such as large volumes of saline wastewater and high extraction costs in the downstream extraction process.

[0004] Therefore, there is an urgent need for a low-alkali-neutralized Candida virescens yeast to reduce the discharge of saline wastewater and sodium sulfate residue, thereby lowering the cost of long-chain dicarboxylic acids. Summary of the Invention

[0005] In view of this, one objective of the present invention is to provide Candida viswanathii ZX01 (accession number CCTCC M 20251049); a second objective of the present invention is to provide a recombinant strain based on Candida viswanathii ZX01; a third objective of the present invention is to provide the application of the recombinant strain of said Candida viswanathii ZX01 in the fermentation production of long-chain dicarboxylic acids; and a fourth objective of the present invention is to provide a method for preparing long-chain dicarboxylic acids.

[0006] To achieve the above objectives, the present invention provides the following technical solution: 1. A strain of Candida viswanathii ZX01, which is deposited at the China Center for Type Culture Collection, with accession number CCTCC NO: M20251049.

[0007] The present invention preferably describes the application of the *Candida viride* ZX01 in the fermentation production of sebacic acid, undecanoic acid, lauryl acid, tridecanoic acid, tetradecanoic acid, and pentadecanoic acid, and it exhibits a preference for the synthesis of C13-C15 carbon chain dicarboxylic acids.

[0008] 2. A recombinant strain based on Candida viswanathii ZX01, wherein the recombinant strain expresses the vgb gene of hysterosclerotic hemoglobin in Candida viswanathii.

[0009] Preferably, the nucleic acid sequence of the vgb gene is shown in SEQ ID NO.21.

[0010] In a preferred embodiment of the present invention, the method of expressing the *Vibrio hygroscopicus* hemoglobin gene *vgb* includes: increasing the copy number of the encoding gene *vgb*.

[0011] Preferably, in this invention, the copy number of the encoding gene vgb is increased by transforming the strain into an expression vector carrying the vgb gene.

[0012] 3. Application of the recombinant strain of Candida viviparous ZX01 in the fermentation production of long-chain dicarboxylic acids.

[0013] Preferably, the long-chain dicarboxylic acid of the present invention is a C13-C15 carbon chain dicarboxylic acid.

[0014] 4. A method for preparing long-chain dicarboxylic acids, wherein the Candida albicans ZX01 or the recombinant strain is fermented and cultured to obtain long-chain dicarboxylic acids.

[0015] The beneficial effects of this invention are as follows: This invention screened a strain of Candida viswanathii that can produce high-concentration long-chain dicarboxylic acids using liquid wax oil n-alkanes as a carbon source; in addition, based on the industry problems of large-scale production of long-chain dicarboxylic acids, a genetically engineered strain of Candida viswanathii was constructed, which reduced the requirements for aeration and stirring speed, reduced alkane volatilization, and achieved efficient production of long-chain dicarboxylic acids while reducing production costs.

[0016] Biological Preservation Candida viswanathii is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M 20251049, located at Wuhan University, Wuhan, Hubei Province, China, on May 14, 2025. It is classified and named Candida viswanathii. Attached Figure Description

[0017] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration: Figure 1 The diagrams show the colony and cell morphology of Candida virescens, as well as the phylogenetic trees for ITS and 28S rDNA. A is the colony diagram, B is the cell morphology diagram, C is the ITS phylogenetic tree, and D is the 28S rDNA phylogenetic tree. Figure 2 Test on the preference of Candida vesiculosus ZX01 for different alkanes; Figure 3 Figure showing the results of producing dodecacarboxylic acid from Candida virescens fermenter ZX01; Figure 4 The image shows the results of antibiotic screening; where: A is G418, B is hygromycin B, C is glufosinate, and D is norsylmycin. Figure 5 The image shows the construction results of the free expression plasmid; where: A is the image of the egfp gene expression plasmid, and B is the fluorescence detection result of the egfp gene free expression strain; Figure 6 Figure 1 shows the results of shake-flask fermentation of dodecacarboxylic acid by the original strain ZX01 and the recombinant strain expressing the vgb gene in free. Figure 7 Figure showing the results of shake-flask fermentation screening of engineered strains by VGB-integrated strains; Figure 8 Figure showing the results of fermentation in a fermenter to produce dodecadicarboxylic acid by an engineered strain of vgb-integrated expression gene. Detailed Implementation

[0018] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0019] Example 1: Screening and performance testing of Candida viviparous yeast Samples were collected from coal seams in the Tianfu Coal Mine area of ​​Beibei District, Chongqing. The samples were suspended in sterile PBS in sterile test tubes, thoroughly mixed, and allowed to stand for 30 min. The supernatant was then inoculated into YPD enrichment medium (glucose replaced with n-dodecane, and 50-100 μg / mL chloramphenicol and gentamicin added) containing n-dodecane. The medium was incubated at 30℃ with shaking at 250 rpm for 48 h. The samples were then diluted to 10⁻⁶. -3 10 -4 10 -5 10 -6 Diluted solutions of chloramphenicol and gentamicin (containing 50-100 μg / mL chloramphenicol and gentamicin) were prepared and spread onto YPD solid plates. Single colonies were obtained by incubation at 30°C for 48 h. Single colonies exhibiting the colony and cell characteristics of *Candida virescens* were selected and cultured, then inoculated into fermentation medium containing n-dodecane. After incubation at 30°C and 250 rpm for 48 h with shaking, the dodecanoic acid content in the fermentation broth was analyzed by gas chromatography. The strain with the highest dodecanoic acid production was selected for repeated isolation and culture to obtain purified single colonies of yeast.

[0020] The purified single colonies obtained from isolation were identified by ITS sequence sequencing and compared with the ITS reference sequence (GenBank ID MK394122.1). Simultaneously, the 28S rDNA region of this strain was sequenced, and the results were compared using BLAST to identify the strain as belonging to *Candida viswanathii*. Figure 1 (C and D). The ITS and 28S rDNA base sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2. The strain obtained from the identification results was deposited at the China Center for Type Culture Collection (CCTCC M 20251049), located at Wuhan University, Wuhan, Hubei Province, China, on May 14, 2025, and classified as *Candida viswanathii*.

[0021] ITS (SEQ ID NO.1) tttccgtaggtgaacctgcggaaggatcattactgatttgcttaattgcaccacatgtgtttttcattgaacaactgctttggcggggggacaccctagtctcgccgccagaggtcacaactaaacaaaactttttattaccagtcaaacgattatactaatagtcaaaactttcaacaacggatctcttggttctcgcatcgatgaagaacgcagcgaaatgcgatacgtaatatgaattgcagatattcgtgaatcatcgaatctttgaacgcacattgcgccctttggtattccaaagggcatgcctgtttgagcgtcatttctccctcaagcccccgggtttggtgttgagcaatacgcttcggtttgtttgaaagacgtacgtggagactatattagcgacttaggttctaccaaaaacgcttgtgcagtcggcccaccacagcttttctaacttttgacctcaaatcaggtaggactacccgctgaacttaagcatatcaataagcggagga 28S rDNA(SEQ ID NO.2) aagaaaccaacagggattgccttagtagcggcgagtgaagcggcaaaagctcaaatttgaaatctggctctttcagagtccgagttgtaatttgaagaaggtatctttgggcctggctcttgtctatgtttcttggaacagaacgtcacagagggtgagaatcccgtgcgatgagatgacccaggtccgtgtaaagttccttcgacgagtcgagttgtttgggaatgcagctctaagtgggtggtaaattccatctaaagctaaatattggcgagagaccgatagcgaacaagtacagtgatggaaagatgaaaagaactttgaaaagagagtgaaaaagtacgtgaaattgttgaaagggaagggcttgagatcagacttggcattttgcatgttgcttcttcgggggcggcctctgcggtttgtcgggccagcatcagtttgggcggtaggacaatcgcgcgggaacgtggcacggcctcggttgtgtgttatagcccgtgtggatactgccagcctagactgaggactgcggtttatacctaggatgttggcataatgatcttaagtcgcccgtcttgaaacacggaccaaggagtctaacgtctatgcgagtgtttgggtgtaaaacccgtacgcgtaatgaaagtgaacgtaggtgggggccctctcgggggtgcaccatcgaccgatcctgatgtcttcggatggatttgagtaagagcatagctgttgggacccgaaagatggtgaactatgcctgaatagggtgaagccagaggaaactctggtggaggctcgtagcggttctgacgtgcaaatcgatcgtcgaatttgggtataggggcgaaagactaatcgaacca Colony morphology and cell characteristics: The screened Candida viswanathii ZX01 was diluted 10 -6 times, then spread on YPD plate, and cultured at 30°C for 48-72 h before observing its colony morphology ( Figure 1A). The results showed that the colonies of *Candida viride* ZX01 were round, with a smooth, moist surface, regular, raised edges, and a milky white color. Furthermore, the cell morphology was oval or cylindrical, and budding was observed. Figure 1 B).

[0022] Fermentation characteristics: The *Candida virescens* ZX01 bacterial suspension obtained above was diluted and spread onto YPD solid plates (1% yeast extract, 2% peptone, 2% glucose, 2% agar powder). After incubation at 30℃ for 48-72 h, single colonies were picked and inoculated into test tubes of YPD slant medium. After incubation at 30℃ for 48-72 h, this was used as the working seed slant. The slant culture was scraped into Erlenmeyer flasks containing YPD liquid medium and incubated at 30℃ and 250 rpm with shaking for 24 h. Then, 1-2% of the culture was inoculated into Erlenmeyer flasks with baffles containing 200 mL of YPD liquid medium and incubated at 30℃ and 250 rpm with shaking for 24 h. This was the seed culture.

[0023] Performance testing with different substrates: After 24 hours of fermentation, different n-alkane substrates (C9-C20) were added to the fermentation medium in four separate additions, and the fermentation of the strains was tested. For example... Figure 2 As shown, ZX01 exhibits optimal fermentation performance using C13-C15 n-alkanes as substrates, achieving yields of 29.3 g / L for tridecanoic acid, 27.5 g / L for tetradecanoic acid, and 28 g / L for pentadecanoic acid, compared to only 11.8 g / L for decadecanoic acid and 14.9 g / L for dodecadecanoic acid, demonstrating a preference for the synthesis of C13-C15 carbon chain dicarboxylic acids.

[0024] Fermentation tank culture: The seed culture was inoculated at 10% in a fermenter (fermentation medium components: glucose 50 g / L, yeast extract 10 g / L, corn steep liquor 10 g / L, potassium dihydrogen phosphate 8 g / L, ammonium nitrate 3 g / L, sodium chloride 3 g / L, calcium carbonate 10 g / L), with pH 6.0 and a rotation speed of 500 rpm for 18-24 h. When glucose was depleted, glucose was added at a rate of 1-5 g / L·h, and 10-40 g / L dodecane was added every 6-12 h to initiate acid-producing fermentation at pH 5.0 for 140-170 h. Samples were taken periodically to analyze the fermentation products.

[0025] The results are as follows Figure 3As shown, after fermentation, dodecanoic acid precipitated into the culture medium and adhered to the inner wall of the fermenter, resulting in a milky white viscous liquid. From 24 to 144 h, the dodecanoic acid yield showed a linear increasing trend, reaching a production rate of 1.67 g / L·h and a yield of 241 g / L. Fermentation terminated at 168 h, with a biomass of 47.2 g / L, a dodecanoic acid production rate decreasing to 1.50 g / L·h, and a final yield of 253 g / L (5.4 g / g DCW), achieving a molar conversion rate of 63.0%. The average dissolved oxygen level from 12 to 168 h was 9.1. These results demonstrate that this strain can utilize long-chain alkanes to produce high-concentration dodecanoic acid, but the acid production process requires a large amount of oxygen to maintain its production efficiency.

[0026] Example 2: Construction of an energy system for reconstructing the electron transport chain in Candida viviparous. First, to determine the sensitivity of *Candida virescens* ZX01 to common screening marker antibiotics (G418, hygromycin B, glufosinate, and norsinolate) and to determine the optimal screening concentration for subsequent genetic transformation experiments, a solid culture medium gradient concentration method was used. Figure 4 As shown, *Candida virescens* ZX01 was not sensitive to G418 and glufosinate, and these two antibiotics could not be used for screening. Hygromycin B and norsylmycin showed no growth at concentrations of 600 μg / mL and 200 μg / mL, respectively; therefore, these two antibiotics were selected as positive screening antibiotics for subsequent genetic transformation experiments.

[0027] Furthermore, pCT-tRNA (#133813, Addgene) was modified into a free expression plasmid of Candida vesiculosus ZX01. First, the norsinoxin resistance gene SAT1 of pCT-tRNA was deleted by PCR and the plasmid was linearized (primers pCT-tRNA-F / pCT-tRNA-R). The hygromycin B resistance gene hyg (SEQ ID NO.3) synthesized by Sangon Biotech was amplified using primers hygR-F / hygR-R. Then, hyg was ligated into the linearized vector using Gibson Assembly to obtain the plasmid pCTH-tRNA.

[0028] pCT-tRNA-F: 5'-gaatatacgtcgttattttgtgttatacact-3'; pCT-tRNA-R: 5'-agatccggtaattctagcaatcg-3'; hygR-F: 5'-attgctagaattaccggatctatgaaaaagcctgaactcaccg-3'; hygR-R: 5'-acaaaataacgacgtatattcctatttctttgccctcggacg-3'.

[0029] Using the above plasmid pCTH-tRNA as a template, the hygromycin B resistance gene expression cassette was amplified with primers P1-F / P1-R, and some elements of the ARS2, ori, and AmpR expression cassettes were amplified with primers P2-F / P2-R. The two sequences were then linked together using the Gibson Assembly method to obtain the free expression plasmid backbone pCTHO.

[0030] P1-F: 5'-tgtgaaataccgcacagatgcgtccaactggtggatcagtatcg-3'; P1-R: 5'-ttgtcgactctagaggatccggtaccgagctcccgcggtcacataaccacaaggtgccc-3'; P2-F: 5'-ccggatcctctagagtcgacaagcttgaattcgctagcattaattgcgttgcgctcact-3'; P2-R: 5'-gcatctgtgcggtatttcacac-3'; hyg (SEQ ID NO.3) Using the aforementioned plasmid pCTHO as a backbone, a green fluorescent protein expression plasmid was constructed to verify its functionality. The pCTHO plasmid was linearized by double digestion with restriction endonucleases SacII and HindIII (Thermo Fisher Scientific). Using ZX01 genomic DNA as a template, the promoter P was amplified using primers PALDH2-F(egfp) / PALDH2-F(egfp). ALDH2 (SEQ ID NO.4), the terminator T was amplified using primers TTDH1-F(egfp) / TTDH1-R(egfp). TDH1 (SEQ ID NO.5). The green fluorescent protein gene egfp (SEQ ID NO.6) synthesized by Sangon Biotech was amplified using primers eGFP-F / eGFP-R. The promoter P was then amplified using the Gibson Assembly method. ALDH2 egfp and terminator T TDH1 The sequence was ligated with a linearized vector to obtain the recombinant plasmid pCTHO-P ALDH2 -egfp ( Figure 5 A).

[0031] PALDH2-F(egfp):5'-cttgtggttatgtgaccgcggacacaaccttggttcttgatatcaa-3'; PALDH2-R(egfp):5'-ggatccgcttggaggaagctgaggtataa-3'; eGFP-F: 5'-cagcttcctccaagcggatccatggtctccaagggtgaggaat-3'; eGFP-R: 5'-gagtttgttggataggtcgacctacttgtacaattcgtccataccc-3'; TTDH1-F(egfp):5'-gtcgacctatccaacaaactctaggggttgt-3'; TTDH1-R(egfp):5'-aatgctagcgaattcaagctttctggtttagaagtagggactgtatg-3'; P ALDH2 (SEQ ID NO.4) acacaaccttggttcttgatatcaaaggtaccataacctaaataggaaatttaattcccgtctcgtctttcactatctccgctatttgcgaattaagcttacagatattacccgcactactgctaacagccctgagacatgtaacctaaattaatcccttgtaactcaacctccatggcacggttacgaagaaattgttgtgttctcgagagagggtgaagttatcgaggatacggggataagttcctgcggaacggaatggaggtgctgagagacaggtattgtctcactcgtaaacacaaaggtctagcaggaaagtcttggaaagttcaataggcgtcttggaaaagaccacaggggacagatatgagatgagatggtagctcaacccttatcaactcgatagacgacttgaagagtatgaagtcacctctggctgacgaaagacaggactattacgacgtcgcttatttgaagtgatgaattagacttcgattacgggtggaaggatcaaacaaaatgccaatcagggtcagatcgacctggcgatatcgttatcactacgaaataatgacaatctagacaaccaggagatcatgacccgcttcctgtctgccatgccatggtcggttttaggatagcggaagataaaaagaaccttcaggggggtagtgtgggagcaagaatgcggaaaaatattcaccttttgatagtcgtgcacagtgcccaaattgtggataaataaattgtctcctcatttcatgacacaaaacacacattacactcagtactttttcacaagcaagaagatcaccaacaccaacaccaacaaacaatactaaactttttacctaaacctcctcgccctcctcgccctctctcccccccacaggaatcccacaatttgtataaataacccatcacattcctcctttttctacttccacattttttctttatacctcagcttcctccaagc TTDH1 (SEQ ID NO.5) ctatccaacaaactctaggggttgtgctttttgaaaaaaacatataggttttattgaaatagccacaatgtctgttgagaggacatttgatttgttttatattatcgtatatgtaccctggaatatattgcgttttttaacaaaagacaaacaacggtctttagtttttttttcaatcaatcaatgttcgtgatcgtagagagaaggagaaaaaaagagtaaacataaacaaacatctttctttttacaaacgagtagcaacagccatgtcacaagatgccatacagtccctacttctaaaccaga egfp(SEQ ID NO.6) atggtctccaagggtgaggaattgttcaccggtgtcgtcccaattttggtcgaattggacggtgacgtcaacggtcacaagttttccgtgtccggtgaaggtgagggtgacgctacctacggcaagttgaccctcaagttcatctgtaccaccggcaagttgccagttccatggccaact ttggtcaccactctcacctacggtgtccaatgtttctccagatacccagaccatatgaagcaacacgacttcttcaagtccgccatgccagaaggttacgtccaagaacgtaccatcttcttcaaggacgacggcaactacaagacccgtgccgaagtgaagttcgaaggggacaccttg gtcaacagaatcgaattgaagggtatcgacttcaaggaggatggtaacatcttgggtcacaagttggaatacaactacaattcccataacgtctacatcatggccgacaagcaaaagaacggtatcaaggttaacttcaagatcagacacaacatcgaggacggttccgtccagttggcc gaccactaccagcagaacaccccaattggcgacggtccagtccttttgccagacaaccactacttgtccacccagtccgctttgtccaaggacccaaacgaaaagagagaccacatggtcttgttggaattcgttatgctgccggtattaccttgggtatggacgaattgtacaagtag The recombinant plasmid pCTHO-P ALDH2 -egfp was transferred into Candida albicans ZX01, and after selection with hygromycin B, single colonies were picked and cultured. Cells in the logarithmic growth phase were collected, washed twice with PBS, and then the fluorescence intensity was detected using a microplate reader. Figure 5 B). The results showed that the recombinant plasmid pCTHO-P TDH1 -egfp was successfully expressed in yeast cells, proving that the free expression system was successfully constructed.

[0032] Example 3: Construction and application of Candida viviparous genetically engineered strains using free vgb expression. Fermentation processes such as those involving *Candida virescens* and *Candida tropicalis*, which convert long-chain alkanes into long-chain dicarboxylic acids, require a large supply of oxygen. This necessitates high stirring speeds and high aeration rates, resulting in high energy costs and losses due to alkane volatilization. *Vibrio hygroscopicus* hemoglobin VHb is a protein with oxygen-binding capacity and a high oxygen dissociation rate, enhancing oxygen binding, transport, and utilization, thus benefiting biological growth, protein synthesis, and metabolite synthesis. Therefore, the VHb protein gene (vgb) expression vector was first constructed using a free expression plasmid, as illustrated in the following example: The plasmid pCTHO-P was mediated using restriction endonucleases BamHI and SalI. ALDH2 -egfp was linearized by double enzyme digestion, and egfp was removed. The vgb gene (SEQ ID NO.7) synthesized by Sangon Biotech Co., Ltd. was amplified using primers VGB-PADLH2-F / VGB-PADLH2-R, and cloned into the above linearized vector to obtain the recombinant plasmid pCTHO-P. ALDH2 -vgb. The recombinant plasmid was transformed into Candida virescens ZX01, and the recombinant strain ZX01-pCTHO-vgb was obtained by hygromycin B screening.

[0033] VGB-PADLH2-F: 5'-agcttcctccaagcggatccatgttggaccaacagaccat-3'; VGB-PADLH2-R: 5'-agtttgttggataggtcgacctattcaacggcttgagcgt-3'; vgb (SEQ ID NO.7) atgttggaccaacagaccattaacatcatcaaggctaccgttccagttttgaaggaacacggtgtcaccattaccaccaccttctacaagaacttgttcgctaagcaccc agaagttagaccattgttcgacatgggtagacaagaatccttggaacaaccaaaggccttggctatgaccgtcttggctgctgctcaaaacatcgaaaacttgccagcta tcttgccagctgtcaagaagatcgctgtcaagcactgtcaagctggtgtcgccgctgcccactacccaatcgttggtcaagaattgttgggtgccatcaaggaagtcttg ggtgacgccgccactgacgacatcttggacgcctggggtaaagcctacggtgttatcgctgacgttttcatccaagttgaagccgacttgtacgctcaagccgttgaatag Shake-flask fermentation tests were conducted on the original strain ZX01 and the recombinant strain. Specific examples are as follows: The recombinant strain *Candida viride* ZX01-pCTHO-vgb and the starting strain *Candida viride* ZX01 were diluted and spread onto YPD solid plates (1% yeast extract, 2% peptone, 2% glucose, 2% agar powder). After incubation at 30℃ for 48-72 h, single colonies were picked and inoculated into YPD slant culture medium in test tubes. After incubation at 30℃ for 48-72 h, this was used as the working seed slant. The slant culture was scraped into Erlenmeyer flasks containing YPD liquid culture medium and incubated at 30℃ with shaking at 250 rpm for 24 h. Then, 1-2% of the culture was inoculated into Erlenmeyer flasks with baffles containing 200 mL of YPD liquid culture medium and incubated at 30℃ with shaking at 250 rpm for 24 h. This was the seed culture.

[0034] Shake-flask fermentation: The seed culture was inoculated at 10% into baffled shake flasks containing a final volume of 200 mL (fermentation medium components: glucose 50 g / L, yeast extract 10 g / L, corn steep liquor 10 g / L, potassium dihydrogen phosphate 8 g / L, ammonium nitrate 3 g / L, sodium chloride 3 g / L, calcium carbonate 10 g / L). Culture conditions were pH 6.0, 250 rpm, for 24 h. During the acid production phase, 1-5 g / L glucose was added every 12-24 h, and 10-40 g / L dodecane was added every 6-12 h, for a total culture time of 144 h.

[0035] The results are as follows Figure 6 As shown, expression of vgb significantly increased the yield and molar conversion rate of dodecanoic acid, by 27% and 35% respectively compared with the starting strain. These results demonstrate that vgb expression significantly promotes the synthesis of long-chain dicarboxylic acids by this strain.

[0036] Example 4: Construction of a genetically engineered strain of Candida viviparous yeast by integrating vgb into the genome. Free plasmids are only used for rapid and convenient verification of heterologous gene function. Since recombinant strains require expensive antibiotics to maintain plasmid presence, they are unsuitable as production fermentation strains. Therefore, a genetically engineered strain was constructed by integrating the vgb gene into the genome. The PiggyBac transposon system was used to integrate the vgb gene into the genome, achieving stable expression of multiple copies of the gene. A specific implementation example is as follows: First, using plasmid pCTHO as a template, the ori element and AmpR expression cassette were amplified using primers P3-F / P3-R. Then, the ori element synthesized by Sangon Biotech was amplified using primers PTEF1-F / frt1-R. TEF1 -3×SV40-PiggyBac-T TEF1 The left (5') inverted repeat-frt sequence of piggyBac (SEQ ID NO.8) contains the transposase gene PiggyBac sequence and the 5'-end repeat sequence of the transposon, with three nuclear localization signal peptides SV40 NLS added to the 5' end of PiggyBac, and a frt sequence. The right (3') inverted repeat sequence of frt-piggyBac (SEQ ID NO.9) synthesized by Sangon Biotech was amplified using primers frt2-F / 3ITR-R, which contains a second frt sequence and the 3'-end repeat sequence of the transposon. Using pCT-tRNA plasmid as a template, the norovirus resistance gene SAT1 expression cassette was amplified using primers PCdTEF1-F / TMgPGK1-R. The above sequences were recombined using Gibson Assembly to obtain the PiggyBac transposon plasmid pPB-frt-SAT1-PBLR.

[0037] P3-F: 5'-tcgcgaaacatgtgagcaaaaggccag-3'; P3-R: 5'-gcacttttcggggaaatgtg-3'; PTEF1-F: 5'-gcacatttccccgaaaagtgctcgcgagacatggaggcccagaatacc-3'; frt1-R:5’-atactgatccaccagttggacgaagttcctatactttctagagaataggaact-3’; PCdTEF1-F:5’-gtccaactggtggatcagtatcg-3’; TMgPGK1-R:5’-tcacataaccacaaggtgccc-3’; frt2-F:5’-gggcaccttgtggttatgtgagaagttcctattccgaagttcctatt-3’; 3ITR-R:5’-ttttgctcacatgtttcgcgattaaccctagaaagataatcatattgtgac-3’; P TEF1 -3×SV40-PiggyBac-T TEF1 -piggyBac left (5') inverted repeat-frt(SEQID NO.8) frt-piggyBac right (3') inverted repeat(SEQ ID NO.9) Gaagttcctattccgaagttcctattctctagaaagtataggaacttccccggggaattcgacgtcccgcggccgctgtatccatatgaccatgattaccccgggtctagaggatccgtcgacacgcgtagatctcgagtttgttactttatagaagaaattttgagtttttgtttttttttaataa ataaataaacataaataaattgtttgttgaatttattattagtatgtaagtgtaaatataataaaacttaatatctattcaaattaataaataaacctcgatatacagaccgataaaacacatgcgtcaattttacgcatgattatctttaacgtacgtcacaatatgattatctttctagggttaa The plasmid pPB-frt-SAT1-PBLR was linearized by double digestion with restriction endonucleases EcoRI and NotI. The plasmid pCTHO-P was then used for further linearization. ALDH2 Using vgb as a template, the vgb expression cassette was amplified with primers PALDH2-F1 / TTHD1-R1. The vgb expression cassette was cloned into the restriction enzyme sites EcoRI and NotI using GibsonAssembly to obtain the recombinant plasmid pPB-frt-SAT1-vgb-PBLR. The frt sequence carried was removed to facilitate subsequent research to eliminate the antibiotic resistance marker.

[0038] PALDH2-F1: 5'-aagtataggaacttcgaattcacacaaccttggttcttgatatcaa-3' TTHD1-R1: 5'-tcatatggatacagcggccgctctggtttagaagtagggactgtatg-3' The recombinant plasmid was transformed into *Candida virescens* ZX01, and positive transformants were obtained through noroside resistance screening. Eleven positive transformants were selected and subjected to shake-flask fermentation using dodecane as the carbon source. Figure 7As shown, four strains exhibited higher molar conversion rates of dodecanoic acid compared to the starting strain. Specifically, ZX01-vgb-4 and ZX01-vgb-10 showed increases in dodecanoic acid production of 19% and 21%, respectively, and increases in molar conversion rates of 26% and 12%, respectively, compared to the starting strain. ZX01-vgb-4 was activated and tested in a 5-L fermenter. Figure 8 As shown, with an initial volume of 2.0 L and a fermentation pH controlled at 5.0, the dodecanoic acid yield showed a linear increasing trend during the 24-120 h fermentation period, reaching a production rate of 2.27 g / L·h and a yield of 272 g / L. After 120 h, due to the gradual increase in viscosity, the biomass reached 47.5 g / L at the end of fermentation (168 h), the dodecanoic acid production rate decreased to 1.90 g / L·h, and the final yield reached 320 g / L (6.7 g / g DCW), with a tank volume ratio of 1.03 and a molar conversion rate of 74.0%. The dodecanoic acid yield, production rate, and molar conversion rate were increased by 26%, 26%, and 18%, respectively, compared to the starting strain in Example 1. The average dissolved oxygen from 12 to 168 h was 14.6, an increase of 61% compared to the starting strain in Example 1. The results showed that the vgb integrated expression strain significantly improved the dicarboxylic acid production rate and molar conversion rate, while reducing dissolved oxygen requirements.

[0039] Example 5: Application of genome-integrated expression of vgb in the fermentation production of sebacic acid by Candida virescens. After activation, ZX01-vgb-4 was tested in a 5-L fermenter with an initial volume of 2.0L. The fermentation medium was the same as in Example 1, using decane as the raw material. When glucose was depleted, 10-40 g / L of decane was added every 6-12 h to carry out acid production fermentation. The fermentation pH was controlled at 4.2. After 168 h of cultivation, the final sebacic acid yield reached 174 g / L, the volume ratio of the fermenter to the container was 1.01, and the molar conversion rate reached 70.2%.

[0040] Example 6: Application of genome-integrated expression of vgb in the fermentation production of undecanoic acid by Candida virescens. After activation, ZX01-vgb-4 was tested in a 5-L fermenter with an initial volume of 2.0L. The fermentation medium was the same as in Example 1, using undecane as the raw material. When glucose was depleted, 10-40 g / L of undecane was added every 6-12 h to carry out acid-producing fermentation. The fermentation pH was controlled at 4.6, and the culture time was 156 h. The final yield of undecanedicarboxylic acid reached 328 g / L, with a tank volume ratio of 1.06 and a molar conversion rate of 77.3%.

[0041] Example 7: Application of genome-integrated expression of vgb in the fermentation production of tridecanoic acid by Candida virescens. After activation, ZX01-vgb-4 was tested in a 5-L fermenter with an initial volume of 2.0L. The fermentation medium was the same as in Example 1, using tridecane as the raw material. When glucose was depleted, 10-40 g / L of tridecane was added every 6-12 h to carry out acid production fermentation. The fermentation pH was controlled at 5.1, and the culture time was 144 h. The final yield of tridecanoic acid reached 334 g / L, the volume ratio of the fermenter to the container was 1.08, and the molar conversion rate reached 80.6%.

[0042] Example 8: Application of genome-integrated expression of vgb in the fermentation production of tetradecanoic acid by Candida virescens. After activation, ZX01-vgb-4 was tested in a 5-L fermenter with an initial volume of 2.0L. The fermentation medium was the same as in Example 1, using tetradecane as the raw material. When glucose was depleted, 10-40 g / L tetradecane was added every 6-12 h to carry out acid-producing fermentation. The fermentation pH was controlled at 5.3, and the culture time was 144 h. The final yield of tetradecanoic acid reached 339 g / L, the volume ratio of the fermenter to the container was 1.04, and the molar conversion rate reached 81.9%.

[0043] Example 9: Application of genome-integrated expression of vgb in the fermentation production of pentadecanoic acid by Candida virescens. After activation, ZX01-vgb-4 was tested in a 5-L fermenter with an initial volume of 2.0L. The fermentation medium was the same as in Example 1, using pentadecane as the raw material. When glucose was depleted, 10-40 g / L pentadecane was added every 6-12 h to carry out acid production fermentation. The fermentation pH was controlled at 5.5, and the culture time was 144 h. The final yield of pentadecanoic acid reached 325 g / L, the volume ratio of the fermenter to the container was 1.05, and the molar conversion rate reached 82.8%.

[0044] The above-described embodiments are merely preferred embodiments provided to fully illustrate the present invention, and the scope of protection of the present invention is not limited thereto. Furthermore, the VGB modification method can also be applied to the production of dicarboxylic acids using one or more of other Candida species, such as *Candida tropicalis*, *Yarrowia lipolytica*, and *Candida sake*, using alkanes of different chain lengths, fatty acids, or fatty acid esters as raw materials. All equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims.

Claims

1. The application of a strain of Candida viswanathii ZX01 in the production of long-chain dicarboxylic acids, characterized by: The *Candida viviparous* ZX01 strain is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M20251049.

2. The application of Candida viscera ZX01 as described in claim 1 in the fermentation production of long-chain dicarboxylic acids.

3. The application according to claim 2, characterized in that: The long-chain dicarboxylic acid is an ortho-dicarboxylic acid with ten to fifteen carbon atoms.

4. The recombinant strain based on Candida viswanathii ZX01 according to claim 1, characterized in that: The genetically engineered bacteria expressed the vgb gene of the bacterium *Candida viviparus* hemoglobin in *Candida viviparus*.

5. The recombinant strain of Candida viswanathii ZX01 according to claim 4, characterized in that: The nucleic acid sequence of the vgb gene is shown in SEQ ID NO.

21.

6. The recombinant strain of Candida viswanathii ZX01 as described in claim 4, characterized in that: The method of expressing the *Vibrio hystericus* hemoglobin gene *vgb* includes increasing the copy number of the encoding gene *vgb*.

7. The recombinant strain of Candida viswanathii ZX01 according to claim 6, characterized in that: The copy number of the encoding gene vgb is increased by transforming the strain into an expression vector carrying the vgb gene.

8. The application of the genetically engineered Candidae ZX01 strain as described in claim 3 in the fermentation production of long-chain dicarboxylic acids.

9. The application according to claim 2, characterized in that: The long-chain dicarboxylic acid is sebacic acid or undecanoic acid. Lauric acid, tridecanoic acid, tetradecanoic acid and pentadecanoic acid.

10. A method for preparing long-chain dicarboxylic acids, characterized in that: Long-chain dicarboxylic acids were obtained by fermenting and culturing the *Candida virescens* ZX01 of claim 1 or the recombinant strain of claim 4.

Images