A rt-pcr quantitative detection kit and method for ptgs1-002 transcript

Abstract

The application provides a RT-PCR quantitative detection kit and method for PTGS1-002 transcript, the kit comprises a high-salt lysis solution, a PTGS1-002 transcript-specific primer pair, a reverse transcription reaction solution, a PCR reaction solution and a PTGS1-002 recombinant plasmid positive standard, wherein the forward primer and the reverse primer are shown as SEQ ID NO. 1 and SEQ ID NO. 2 respectively. During detection, the serum or plasma sample is treated by the high-salt lysis solution combined with ultrasonic treatment, the supernatant is obtained by centrifugation, reverse transcription and fluorescence quantitative PCR amplification are carried out, and the standard curve is established by using the recombinant plasmid standard, and the quantitative result of the PTGS1-002 transcript is obtained according to the Ct value of the sample to be detected. The application can simplify sample pretreatment, realize specific detection and quantification of the PTGS1-002 transcript.

Description

Technical Field

[0001] This invention relates to the fields of nucleic acid detection and molecular biology detection technology, and in particular to an RT-PCR quantitative detection kit and method for the PTGS1-002 transcript. Background Technology

[0002] PTGS1, or prostaglandin intraperoxide synthase 1 (COX-1), plays a role in various physiological and pathological processes. The PTGS1 gene has multiple transcript splicing variants. The PTGS1-002 transcript, with accession number ENST00000223423, contains 11 exons and encodes a 562-amino acid protein. Due to sequence overlap among different PTGS1 transcripts, targeted amplification of the PTGS1-002 transcript and the design of specific primers are necessary to minimize the influence of other PTGS1 transcripts on the detection results.

[0003] Extracellular vesicles (EVs) can carry biomolecules such as RNA. Their lipid bilayer can provide some protection for the RNA within the vesicles, making EVs in bodily fluids such as serum and plasma suitable as sample sources for RNA detection. However, the RNA content within EVs is relatively low, and the RNA is located inside the vesicle membrane. Therefore, EVs usually need to be processed to release the RNA before reverse transcription and PCR detection.

[0004] In current extracellular vesicle RNA detection processes, extracellular vesicles can be separated using methods such as ultracentrifugation before RNA extraction. This process involves numerous steps and is time-consuming. Furthermore, when using RNA extraction reagents to process trace amounts of extracellular vesicle samples, RNA loss may occur during multiple transfers, purifications, and elutions. Therefore, for serum or plasma extracellular vesicle samples, it is necessary to further simplify the sample pretreatment process and improve the efficiency of obtaining the RNA template required for subsequent detection.

[0005] On the other hand, existing detection methods for the PTGS1 gene can be either conventional PCR or relative quantitative PCR. Conventional PCR has limited ability to quantify low-abundance target nucleic acids. Relative quantitative PCR usually relies on internal reference genes to determine the relative expression level of the target gene and cannot directly obtain the absolute copy number of the target transcript. At the same time, since PTGS1 has multiple transcript splicing variants, it is difficult to differentiate and detect the PTGS1-002 transcript if the amplification region and primers lack specificity.

[0006] Therefore, an RT-PCR quantitative detection kit and method for PTGS1-002 transcripts are proposed. Summary of the Invention

[0007] To address the aforementioned shortcomings of existing technologies, this invention provides an RT-PCR quantitative detection kit and method for PTGS1-002 transcripts, which mainly solves the problems of numerous pretreatment steps for serum or plasma extracellular vesicular RNA samples, difficulty in distinguishing PTGS1-002 transcripts from other PTGS1 transcripts, and the inability to directly obtain the absolute copy number of PTGS1-002 transcripts through relative quantification.

[0008] To solve the above-mentioned technical problems, the present invention adopts the following technical solution.

[0009] On the one hand, the present invention provides an RT-PCR quantitative detection kit for PTGS1-002 transcripts, comprising high-salt lysis buffer, PTGS1-002 transcript-specific primer pair, reverse transcription reaction solution, PCR reaction solution and PTGS1-002 recombinant plasmid positive standard.

[0010] The salt concentration in the high-salt pyrolysis solution is 0.5–2 M.

[0011] The PTGS1-002 transcript-specific primer pair includes the forward primer PTGS1-002-F and the reverse primer PTGS1-002-R.

[0012] The nucleotide sequence of the forward primer PTGS1-002-F is shown in SEQ ID NO.1:

[0013] 5'-TGTGTTGATGCACTACCCCC-3'.

[0014] The nucleotide sequence of the reverse primer PTGS1-002-R is shown in SEQ ID NO.2:

[0015] 5'-CCCCACCGATCTTGAAGGAG-3'.

[0016] The PTGS1-002 recombinant plasmid positive standard was used to establish a standard curve between the PTGS1-002 transcript copy number and the Ct value detected by real-time PCR.

[0017] Furthermore, the salt in the high-salt pyrolysis solution is at least one of sodium chloride, potassium chloride, or ammonium chloride, and the high-salt pyrolysis solution also contains 0.1% to 1% SDS or Triton X-100.

[0018] Furthermore, the high-salt lysis buffer contains 1.0 M sodium chloride and 0.5% SDS, with a pH of 7.4.

[0019] Furthermore, the target sequence amplified by the PTGS1-002 transcript-specific primer pair is shown in SEQ ID NO.3, and the amplified fragment length is 390 bp.

[0020] Furthermore, the PTGS1-002 recombinant plasmid positive standard is a pMD-19T recombinant plasmid containing the target sequence shown in SEQ ID NO.3.

[0021] On the other hand, the present invention also provides an RT-PCR quantitative detection method for PTGS1-002 transcripts, comprising the following steps:

[0022] S1. Take the serum or plasma sample to be tested, add a high-salt lysis buffer with a salt concentration of 0.5-2 M and mix. Sonicate the resulting mixture, centrifuge after sonication and take the supernatant to obtain the RNA template.

[0023] S2. Using the RNA template obtained in step S1, perform reverse transcription to obtain cDNA;

[0024] S3. Using the cDNA obtained in step S2 as a template, perform real-time quantitative PCR amplification using the PTGS1-002 transcript-specific primer pair; the PTGS1-002 transcript-specific primer pair includes a forward primer PTGS1-002-F and a reverse primer PTGS1-002-R, the nucleotide sequence of the forward primer PTGS1-002-F is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer PTGS1-002-R is shown in SEQ ID NO.2;

[0025] S4. Establish a standard curve using the PTGS1-002 recombinant plasmid standard, and determine the absolute copy number of the PTGS1-002 transcript in the serum or plasma sample to be tested based on the Ct value and the standard curve.

[0026] Further, in step S1, the salt in the high-salt pyrolysis solution is at least one of sodium chloride, potassium chloride, or ammonium chloride, and the high-salt pyrolysis solution also contains 0.1% to 1% SDS or Triton X-100; the ultrasonic treatment power is 100 to 300 W, and the ultrasonic treatment time is 5 to 30 min.

[0027] Further, in step S1, the high-salt lysis buffer contains 1.0 M sodium chloride and 0.5% SDS, with a pH of 7.4; after the serum or plasma sample is mixed with the high-salt lysis buffer in equal volume, it is sonicated at 200 W for 20 min, with a 5 s interval between every 5 s of sonication, and then centrifuged at 12000 rpm for 10 min, and the supernatant is taken as the RNA template.

[0028] Further, in step S2, the total volume of the reverse transcription reaction is 20 μL, and the reaction system includes 4.0 μL of 5×Reverse Transcription Buffer, 2.0 μL of dNTP Mix, 1.0 μL of Random Primers, 1.0 μL of RNase Inhibitor, 1.0 μL of Reverse Transcriptase, 5.0 μL of RNA template, and nuclease-free water to a final volume of 20 μL; wherein, the concentration of each dNTP in the dNTP Mix is ​​10 mM, and the concentration of the Random Primers is 50 μM.

[0029] The reverse transcription reaction conditions were 25°C for 10 min, 50°C for 45 min, and 85°C for 5 min.

[0030] Further, in step S3, the total volume of the real-time PCR reaction is 20 μL, and the reaction system includes 10.0 μL of 2×SYBR Green qPCR Master Mix, 0.5 μL of 10 μM forward primer PTGS1-002-F, 0.5 μL of 10 μM reverse primer PTGS1-002-R, 2.0 μL of cDNA template, and nuclease-free water to a final volume of 20 μL.

[0031] The fluorescence quantitative PCR reaction conditions were as follows: pre-denaturation at 95℃ for 30 s, followed by 40 cycles, each cycle consisting of denaturation at 95℃ for 10 s, annealing at 60℃ for 30 s, and extension at 72℃ for 30 s, with fluorescence signals collected at the end of the extension step.

[0032] Further, in step S4, the PTGS1-002 recombinant plasmid standard is serially diluted 10-fold and amplified under the same real-time PCR reaction conditions as the test sample. A standard curve is established with the logarithm of the copy number of each gradient standard as the x-axis and the corresponding Ct value as the y-axis. The absolute copy number of the PTGS1-002 transcript is determined based on the Ct value of the test sample.

[0033] The embodiments of the present invention have the following advantages due to the adoption of the above technical solutions:

[0034] I. This invention uses a combination of high-salt lysis buffer and sonication to pre-treat serum or plasma samples. High-salt lysis and sonication promote the release of RNA from extracellular vesicles. The supernatant obtained by centrifugation after sonication can be used as an RNA template for reverse transcription, thereby reducing RNA loss that may occur during extracellular vesicle separation and subsequent RNA extraction, and simplifying the sample pre-treatment process.

[0035] II. The present invention designs primers shown in SEQ ID NO.1 and SEQ ID NO.2 for the PTGS1-002 transcript, and amplifies the 390 bp target sequence shown in SEQ ID NO.3 by means of the primer pair, so that the detection target is limited to the PTGS1-002 transcript, thereby improving the ability to distinguish the PTGS1-002 transcript from other PTGS1 transcripts.

[0036] Third, this invention uses the PTGS1-002 recombinant plasmid standard to establish a standard curve between copy number and Ct value, and calculates the absolute copy number of PTGS1-002 transcripts based on the Ct value of the sample to be tested, thus achieving absolute quantification of PTGS1-002 transcripts without relying on internal reference genes.

[0037] IV. This invention combines ultrasound of serum or plasma samples with high-salt pretreatment, RNA reverse transcription, PTGS1-002-specific fluorescent quantitative PCR amplification, and recombinant plasmid standard curve quantification to form a complete detection process from sample pretreatment to obtaining absolute copy number, which is suitable for the quantitative detection of low-abundance PTGS1-002 transcripts in serum or plasma samples. Attached Figure Description

[0038] Figure 1 This is a verification diagram of the transcript-specific primer PTGS1-002 of this invention.

[0039] Figure 2 This is a fluorescence quantitative PCR amplification curve of the PTGS1-002 recombinant plasmid standard of the present invention after 10-fold serial dilution.

[0040] Figure 3 The absolute fluorescence quantitative PCR standard curve established for the PTGS1-002 recombinant plasmid standard of this invention.

[0041] Figure 4 This is a graph showing the absolute quantitative detection results of the PTGS1-002 transcript in serum samples from the tumor group and the normal group.

[0042] Figure 5 This is a PTGS1-002 transcript fluorescence quantitative PCR amplification curve of sample A under the following conditions: untreated, sonicated only, high-salt treated only, and sonicated combined with high-salt treated.

[0043] Figure 6 This is a PTGS1-002 transcript fluorescence quantitative PCR amplification curve of sample B under the following conditions: untreated, sonicated only, high-salt treated only, and sonicated combined with high-salt treated.

[0044] Figure 7 This is a PTGS1-002 transcript fluorescence quantitative PCR amplification curve of sample C under the following conditions: untreated, sonicated only, high-salt treated only, and sonicated combined with high-salt treated.

[0045] Figure 8 This is a comparison graph showing the Ct values ​​of PTGS1-002 transcripts from samples A, B, and C under different sample pretreatment methods. Detailed Implementation

[0046] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings.

[0047] This invention provides an RT-PCR quantitative detection kit and method for PTGS1-002 transcripts. The kit includes a high-salt lysis buffer, PTGS1-002 transcript-specific primer pairs, reverse transcription reaction solution, PCR reaction solution, and PTGS1-002 recombinant plasmid positive standard. During detection, serum or plasma samples are treated with high-salt lysis buffer and sonicated to release RNA carried by extracellular vesicles. The supernatant is centrifuged and used as an RNA template. After reverse transcription to obtain cDNA, PTGS1-002 transcript-specific primer pairs are used for real-time quantitative PCR amplification. A standard curve is established using PTGS1-002 recombinant plasmid standard. The absolute quantitative result of PTGS1-002 transcripts is obtained based on the Ct value of the sample.

[0048] The PTGS1-002 transcript described in this invention is one of the transcripts of the human PTGS1 gene, with accession number ENST00000223423. The target amplification region of the PTGS1-002 transcript is determined by sequence alignment of different PTGS1 transcripts, and specific primers are designed for the target amplification region to achieve differential detection of the PTGS1-002 transcript.

[0049] Example 1

[0050] This embodiment provides an RT-PCR quantitative detection kit for the PTGS1-002 transcript, including a high-salt lysis buffer, a PTGS1-002 transcript-specific primer pair, a reverse transcription reaction solution, a PCR reaction solution, and a PTGS1-002 recombinant plasmid positive standard.

[0051] In this embodiment, the salt concentration in the high-salt pyrolysis solution is 0.5–2 M, and the salt is at least one of sodium chloride, potassium chloride, or ammonium chloride.

[0052] The high-salt lysis solution may also contain 0.1% to 1% SDS or Triton X-100.

[0053] The high-salt lysis buffer used in this embodiment contains 1.0 M NaCl and 0.5% SDS, with a pH of 7.4. After preparation, the high-salt lysis buffer is filtered through a 0.22 μm filter and stored at 4°C for later use.

[0054] When the high-salt lysis buffer comes into contact with serum or plasma samples, the high-salt environment and surfactants work together to act on the extracellular vesicle membrane structure, and in conjunction with subsequent sonication, the RNA inside the extracellular vesicles is released into the liquid phase.

[0055] In this embodiment, the reference sequence of human PTGS1-002 transcript was obtained from the Ensembl database, accession number ENST00000223423. Sequence alignment was performed on different PTGS1 transcripts, and the target amplification region of PTGS1-002 transcript was determined based on the sequence differences between different transcripts.

[0056] Based on the identified target amplification region, primer design and sequence matching analysis were performed using NCBI Primer-BLAST to obtain the forward primer PTGS1-002-F and the reverse primer PTGS1-002-R.

[0057] The nucleotide sequence of the forward primer PTGS1-002-F is as follows:

[0058] 5'-TGTGTTGATGCACTACCCCC-3',

[0059] Corresponding to SEQ ID NO.1.

[0060] The nucleotide sequence of the reverse primer PTGS1-002-R is as follows:

[0061] 5'-CCCCACCGATCTTGAAGGAG-3',

[0062] Corresponding to SEQ ID NO.2.

[0063] The target sequences amplified by PTGS1-002-F and PTGS1-002-R are shown in SEQ ID NO.3:

[0064] TGTGTTGATGCACTACCCCCGAGGCATCCCGCCCCAGAGCCAGATGGCTGTGGGCCAGGAGGTGTTTGGGCTGCTTCCTGGGCTCATGCTGTATGCCACGCTCTGGCTACGTGAGCACAACCGTGTGTGTGACCTGCTGAAGGCTGAGCACCCCACCTGGGGCGATGAGCAGCTTTTCCAGACGACCCGCCTCAT CCTCATAGGGGAGACCATCAAGATTGTCATCGAGGAGTACGTGCAGCAGCTGAGTGGCTATTTCCTGCAGCTGAAATTTGACCCAGAGCTGCTGTTCGGTGTCCAGTTCCAATACCGCAACCGCATTGCCATGGAGTTCAACCATCTCTACCACTGGCACCCCCTCATGCCTGACTCCTTCAAGATCGGTGGGG.

[0065] The amplified fragment is 390 bp in length.

[0066] The forward and reverse primers were prepared using commercially available nucleic acid synthesis methods and purified by PAGE. Primer sequence matching verification results are as follows: Figure 1 As shown.

[0067] In this embodiment, the reverse transcription reaction solution includes 5×Reverse Transcription Buffer, dNTPMix, Random Primers, RNase Inhibitor, and Reverse Transcriptase.

[0068] The concentration of each dNTP in the dNTP Mix is ​​10 mM, and the concentration of Random Primers is 50 μM.

[0069] In this embodiment, the PCR reaction solution includes 2×SYBR Green qPCR Master Mix. During quantitative real-time PCR detection, the PCR reaction solution, along with PTGS1-002-F and PTGS1-002-R, is added to the reaction system to amplify the PTGS1-002 target region in the cDNA obtained from reverse transcription, and the corresponding Ct value is obtained using the SYBR Green fluorescence signal.

[0070] PTGS1-002-F and PTGS1-002-R were used to amplify the PTGS1-002 target region in cDNA obtained by reverse transcription, and the Ct value corresponding to the amplification process was obtained using SYBR Green fluorescence signal.

[0071] In this embodiment, the PTGS1-002 target sequence fragment shown in SEQ ID NO.4 was artificially synthesized. The artificially synthesized fragment was 1689 bp in length and was cloned into the pMD-19T vector.

[0072] The pMD-19T vector is 2692 bp in length, and the resulting recombinant plasmid is 4381 bp in total length, containing an ampicillin resistance gene.

[0073] The artificially synthesized sequence shown in SEQ ID NO.4 contains the 390 bp PTGS1-002 amplification target sequence shown in SEQ ID NO.3. Therefore, the obtained pMD-19T recombinant plasmid can be used as a positive standard for PTGS1-002 real-time PCR.

[0074] The complete nucleotide sequence of SEQ ID NO.4 is shown in the sequence listing of this application.

[0075] The recombinant plasmids used in this embodiment were synthesized by a commercial biotechnology service provider and provided in lyophilized powder form. Before use, they were dissolved in sterile TE buffer at pH 8.0 to achieve a plasmid concentration of approximately 10 ng / μL. After aliquoting, they were stored at -20°C to avoid repeated freeze-thaw cycles.

[0076] The mass concentration of the recombinant plasmid was determined using an ultra-micro spectrophotometer. In this example, the mass concentration was measured to be 9.6 ng / μL.

[0077] The recombinant plasmid copy concentration is determined based on the plasmid mass concentration and total plasmid length according to the following formula:

[0078]

[0079] in, This indicates the copy concentration of the recombinant plasmid, expressed in copies / μL. This indicates the mass concentration of the recombinant plasmid, in ng / μL. This indicates the total length of the recombinant plasmid, in bp; 6.02 × 10⁻⁶. 23 660 represents Avogadro's constant; 660 represents the average relative molecular mass per base pair of double-stranded DNA.

[0080] Based on the determined recombinant plasmid copy concentration, PTGS1-002 recombinant plasmid standards of different concentrations were prepared for subsequent standard curve establishment.

[0081] In this embodiment, the kit may also include a negative control.

[0082] High-salt lysis buffer, PTGS1-002 transcript-specific primers, reverse transcription reaction solution, PCR reaction solution, PTGS1-002 recombinant plasmid positive standard and negative control were respectively placed in corresponding reagent bottles or tubes and packaged separately.

[0083] When using the kit, the serum or plasma sample to be tested is first treated with high-salt lysis buffer and sonicated to obtain the RNA template. Then, reverse transcription and quantitative real-time PCR are performed sequentially. At the same time, a standard curve is established using recombinant plasmid standards to obtain the quantitative detection results of PTGS1-002 transcripts.

[0084] Example 2

[0085] This embodiment provides an RT-PCR quantitative detection method for the PTGS1-002 transcript, including steps S1 to S4.

[0086] S1. Sample pretreatment and obtaining RNA template

[0087] Take the serum or plasma sample to be tested, add a high-salt lysis buffer with a salt concentration of 0.5–2 M and mix. Sonicate the resulting mixture, centrifuge and collect the supernatant to obtain the RNA template.

[0088] In this embodiment, 200 μL of the serum or plasma sample to be tested was taken and 200 μL of high-salt lysis buffer containing 1.0 M NaCl and 0.5% SDS at pH 7.4 was added and mixed thoroughly.

[0089] The resulting mixture was placed in an ultrasonic disruptor and ultrasonically treated at 200 W power for 20 min, with a 5 s interval between ultrasonic treatments.

[0090] After sonication, centrifuge at 12,000 rpm for 10 min and collect the supernatant as an RNA template.

[0091] The salt in the high-salt pyrolysis solution may also be potassium chloride or ammonium chloride, or two or more of sodium chloride, potassium chloride and ammonium chloride; the high-salt pyrolysis solution may also contain 0.1% to 1% SDS or Triton X-100.

[0092] The ultrasonic processing power can be 100–300 W, and the ultrasonic processing time can be 5–30 min.

[0093] The extracellular vesicle membrane structure in serum or plasma is ruptured and RNA is released through the combined action of high-salt lysis and sonication; the supernatant obtained after centrifugation can be used as an RNA template for subsequent reverse transcription.

[0094] S2. Reverse transcription to obtain cDNA

[0095] The RNA template obtained in step S1 was used for reverse transcription to obtain cDNA.

[0096] In this embodiment, the total volume of the reverse transcription reaction is 20 μL, and the specific reaction system is as follows:

[0097] 5×Reverse Transcription Buffer 4.0 μL dNTP Mix 2.0 μL Random Primers 1.0 μL RNase Inhibitor 1.0 μL Reverse Transcriptase 1.0 μL RNA template 5.0 μL Nuclease-free water Make up to 20 μL

[0098] The concentration of each dNTP in the dNTP Mix is ​​10 mM, and the concentration of Random Primers is 50 μM.

[0099] The conditions for reverse transcription are:

[0100] React at 25℃ for 10 min;

[0101] React at 50℃ for 45 min;

[0102] React at 85℃ for 5 min;

[0103] After the reaction was completed, the sample was stored at 4°C to obtain cDNA.

[0104] Random Primers were used for reverse transcription to convert the RNA template obtained in step S1 into cDNA that could be used for subsequent PTGS1-002 specific PCR amplification.

[0105] S3. Perform PTGS1-002 specific real-time quantitative PCR amplification.

[0106] Using the cDNA obtained in step S2 as a template, real-time PCR amplification was performed using the PTGS1-002-F / PTGS1-002-R primer pair.

[0107] The nucleotide sequence of PTGS1-002-F is shown in SEQ ID NO.1, and the nucleotide sequence of PTGS1-002-R is shown in SEQ ID NO.2. Both amplify the 390 bp target sequence shown in SEQ ID NO.3.

[0108] In this example, the total volume of the real-time PCR reaction is 20 μL, and the specific reaction system is as follows:

[0109] 2×SYBR Green qPCR Master Mix 10.0 μL PTGS1-002-F, 10 μM 0.5 μL PTGS1-002-R, 10 μM 0.5 μL cDNA template 2.0 μL Nuclease-free water Make up to 20 μL

[0110] Each sample to be tested was set up with 3 replicate wells, and a template-free negative control was also set up.

[0111] The reaction conditions for real-time PCR are as follows:

[0112] Pre-denaturation at 95℃ for 30 seconds, 1 cycle;

[0113] Denaturation at 95℃ for 10 seconds;

[0114] Anneal at 60℃ for 30 seconds;

[0115] Extend at 72℃ for 30 seconds;

[0116] The denaturation, annealing and extension processes were performed for a total of 40 cycles, and fluorescence signals were collected at the end of the 72°C extension step in each cycle to obtain the Ct value corresponding to the sample to be tested.

[0117] S4. Establish a standard curve and perform absolute quantification.

[0118] A standard curve was established using the PTGS1-002 recombinant plasmid standard.

[0119] Prepare 10 μL of PTGS1-002 recombinant plasmid standard. 7 copies / μL, and then serially diluted 10-fold with nuclease-free water to obtain 10 copies / μL. 7 10 6 10 5 10 4 10 3 10 2 and 10 1 Standards with seven concentration gradients (copies / μL).

[0120] Using PTGS1-002 recombinant plasmid standards of each gradient as templates, the PTGS1-002-F / PTGS1-002-R primer pairs were used, and the fluorescence quantitative PCR reaction system and amplification conditions in step S3 were followed for detection.

[0121] Figure 2 In the diagram, S1, S2, S3, S4, S5, S6, and S7 correspond to 10 respectively. 7 10 6 10 5 10 4 10 3 10 2 and 10 1 PTGS1-002 recombinant plasmid standard at copies / μL. The Ct values ​​of the corresponding amplification curves changed as the standard copy concentration decreased.

[0122] Log of the number of copies of each standard 10 Using the Ct values ​​as the x-axis and the corresponding Ct values ​​as the y-axis, a linear regression was performed to establish a standard curve for the PTGS1-002 recombinant plasmid. The standard curve is shown below. Figure 3 As shown.

[0123] The correlation coefficient R of the established standard curve 2 When the amplification efficiency is not less than 0.99 and the amplification efficiency is 90% to 110%, it is used for quantitative calculation of the sample to be tested.

[0124] The standard curve relationship is expressed as:

[0125]

[0126] in, This indicates the cycle threshold obtained by quantitative real-time PCR detection; This indicates the copy concentration corresponding to the PTGS1-002 target sequence; This represents the slope of the linear regression curve of the standard curve; This represents the linear regression intercept of the standard curve.

[0127] Obtained from the serum or plasma sample to be tested The absolute quantitative results of PTGS1-002 transcripts in the test samples were determined by using the values ​​and the standard curve established in the same batch.

[0128] Example 3

[0129] To verify the effect of ultrasound combined with high-salt treatment on the release of extracellular vesicle RNA in serum samples, serum samples from three ovarian cancer patients were selected and numbered A, B, and C, respectively.

[0130] Each sample was set up into the following four groups:

[0131] Untreated control group: Serum samples were not subjected to combined ultrasound and high-salt treatment; RNA was extracted directly according to the control method and then subjected to RT-PCR detection.

[0132] Ultrasound only: An equal volume of PBS buffer was added to the serum sample, and the sample was sonicated at 200 W for 20 min, with a 5 s interval between every 5 s of sonication. The supernatant was then centrifuged and collected for testing.

[0133] High-salt group only: Add an equal volume of high-salt lysis buffer containing 1.0 M NaCl and 0.5% SDS to the serum sample, mix thoroughly, let stand at room temperature for 20 min, do not sonicate, then centrifuge and take the supernatant for detection;

[0134] Ultrasound combined with high salt group: An equal volume of high salt lysis buffer containing 1.0 M NaCl and 0.5% SDS was added to the serum sample, and the sample was sonicated at 200 W for 20 min with a 5 s interval between every 5 s of sonication. The supernatant was then centrifuged and the sample was analyzed.

[0135] Each group of samples was tested according to steps S2 to S4 of Example 2, and three repeat wells were set for each treatment group.

[0136] The quantitative PCR amplification curves of samples A, B, and C under the following conditions are respectively: no treatment, sonication only, high salt treatment only, and sonication combined with high salt treatment. Figures 5-7 As shown, the comparison results of Ct values ​​under different sample preprocessing methods are as follows: Figure 8 As shown in the figure; the paired t-test was used to perform statistical analysis on the test results. The ultrasound combined with high salt group was significantly different from the ultrasound only group and the high salt only group (P < 0.05).

[0137] The above results indicate that, under the conditions described in this embodiment, the combined use of ultrasonic treatment and high-salt lysis can increase the amount of PTGS1-002 RNA template subsequently detected, suggesting that the combined treatment can promote the release of extracellular vesicle RNA from serum samples.

[0138] Example 4

[0139] The sensitivity of the detection method of this invention was evaluated using the PTGS1-002 recombinant plasmid standard.

[0140] The PTGS1-002 recombinant plasmid standard was prepared to be 10 7 10 6 10 5 10 4 10 3 10 2 and 10 1 Seven concentration gradients were established using copies / μL, and the fluorescence quantitative PCR system and conditions described in step S3 of Example 2 were used for detection.

[0141] By comparing the fluorescence amplification signals and Ct values ​​corresponding to different standard copy concentrations, the minimum detection concentration of the detection system of this invention can be determined.

[0142] The test results showed that when the concentration of the PTGS1-002 recombinant plasmid standard was 10... 1 Amplification signals can still be obtained even at copies / μL, corresponding to Ct values ​​of approximately 32–35.

[0143] Therefore, under the detection conditions described in this embodiment, the minimum detection concentration of the PTGS1-002 recombinant plasmid standard reaches 10. 1 The copies / μL capacity enables the detection of low-copy-level PTGS1-002 target sequences.

[0144] Example 5

[0145] To verify the recognition ability of the PTGS1-002-F / PTGS1-002-R primer pair for PTGS1-002 transcripts, positive samples containing PTGS1-002 transcripts, samples containing other PTGS1 transcripts, and other non-target gene templates were set up.

[0146] The detection was performed using the PTGS1-002-F / PTGS1-002-R primer pair.

[0147] For RNA-derived templates, reverse transcription was performed according to step S2 of Example 2, followed by quantitative real-time PCR amplification according to step S3; for DNA-derived templates, the same primer pairs were used for quantitative real-time PCR detection.

[0148] The test results showed that only positive samples containing the PTGS1-002 target sequence detected the corresponding specific amplification signal, while other PTGS1 transcript samples and other non-target templates did not detect the corresponding specific amplification signal.

[0149] Combination Figure 1 The primer sequence matching verification results show that the primer pair shown in SEQ ID NO.1 and SEQ ID NO.2 can be used for differential detection of PTGS1-002 transcripts.

[0150] Example 6

[0151] Using 10 7 ~10 1 The repeatability of the detection method was evaluated using PTGS1-002 recombinant plasmid standards at a concentration of copies / μL.

[0152] Each standard concentration gradient was set up with 3 replicate wells. Real-time PCR detection was performed according to the method described in step S3 of Example 2, and the results of each replicate well were recorded. Values ​​were calculated for three replicate wells with the same concentration gradient. The mean and standard deviation of the values.

[0153] The within-group coefficient of variation is calculated using the following formula: ;

[0154] in, Indicates the coefficient of variation; express Standard deviation of the value; express The average value.

[0155] Furthermore, the standard was tested three times independently under the same testing conditions, and the coefficient of variation between groups was calculated based on the results of the three independent tests.

[0156] The results showed that the coefficient of variation within each concentration gradient was less than 1%, and the coefficient of variation between each group was less than 2%.

[0157] The above results demonstrate that the quantitative detection method for PTGS1-002 established in this invention has good repeatability.

[0158] Example 7

[0159] In this embodiment, serum samples were collected from 5 patients with ovarian cancer as the tumor group, and serum samples were collected from 5 healthy individuals as the normal group.

[0160] After all samples were collected, they were allowed to stand at room temperature for 30 min, and then centrifuged at 3000 rpm for 15 min to separate the serum. The upper serum layer was placed in a sterile EP tube and stored at -80℃ for later use.

[0161] Informed consent was obtained for all sample collection and the process was approved by the ethics committee.

[0162] S1. Serum sample pretreatment and RNA template acquisition

[0163] Take 200 μL of each serum sample, add 200 μL of high-salt lysis buffer containing 1.0 M NaCl and 0.5% SDS at pH 7.4, and mix thoroughly.

[0164] The resulting mixture was placed in an ultrasonic disruptor and ultrasonically treated at 200 W for 20 min.

[0165] After sonication, centrifuge at 12,000 rpm for 10 min and collect the supernatant as an RNA template.

[0166] S2. Reverse transcription to obtain cDNA

[0167] Following the reverse transcription reaction system and reaction conditions described in step S2 of Example 2, the RNA template obtained in step S1 was reverse transcribed to obtain cDNA.

[0168] S3, Real-time PCR detection

[0169] Following the reaction system and amplification conditions described in step S3 of Example 2, the obtained cDNA was used as a template for real-time quantitative PCR detection.

[0170] Three replicate wells were set up for each serum sample. The Ct value of each replicate well was recorded, and the average Ct value of the three replicate wells was used for subsequent calculations.

[0171] S4. Establishment of Standard Curve and Absolute Quantification

[0172] Using 10 7 ~10 1The PTGS1-002 recombinant plasmid standard (copies / μL) was tested under the same quantitative real-time PCR conditions, and a standard curve was established.

[0173] The average Ct value of each serum sample to be tested was substituted into the standard curve established in the same batch, and the absolute quantitative result of PTGS1-002 transcript in each sample to be tested was determined according to the correspondence of the standard curve.

[0174] Test results as follows Figure 4 As shown.

[0175] The absolute copy number of PTGS1-002 transcripts in serum samples from the tumor group ranged from 6.14 × 10⁻⁶. 5 ~6.65×10 6 The median number of copies / μL was 2.08 × 10⁻⁶. 6 copies / μL.

[0176] The absolute copy number of PTGS1-002 transcripts in serum samples from the normal control group ranged from below the limit of detection to 1.38 × 10⁻⁶. 4 The median number of copies / μL was 1.34 × 10⁻⁶. 4 copies / μL.

[0177] Statistical analysis showed that the difference in PTGS1-002 transcript detection levels between the tumor group and the normal group was statistically significant (P < 0.01).

[0178] The above results indicate that the ultrasound-based high-salt sample pretreatment, reverse transcription, PTGS1-002-specific fluorescence quantitative PCR amplification, and recombinant plasmid standard curve quantification system established in this invention can be used for the quantitative detection of PTGS1-002 transcripts in actual serum samples.

[0179] Through the above embodiments, the present invention uses a high-salt lysis buffer with a salt concentration of 0.5-2 M combined with sonication to treat serum or plasma samples to obtain an RNA template for reverse transcription; the obtained RNA template is used to reverse transcribe cDNA; the specific primer pair shown in SEQ ID NO.1 and SEQ ID NO.2 is used to amplify the PTGS1-002 target sequence shown in SEQ ID NO.3; and a standard curve is established using a pMD-19T recombinant plasmid standard containing the PTGS1-002 target sequence, thereby forming a complete detection process from sample pretreatment, reverse transcription, specific amplification to absolute quantification.

[0180] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any person skilled in the art can easily conceive of various variations or substitutions within the technical scope disclosed in the present invention, and these should all be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. An RT-PCR quantitative detection kit for PTGS1-002 transcripts, characterized in that, Includes high-salt lysis buffer, PTGS1-002 transcript-specific primer pair, reverse transcription reaction solution, PCR reaction solution, and PTGS1-002 recombinant plasmid positive standard; The salt concentration in the high-salt pyrolysis solution is 0.5–2 M; The PTGS1-002 transcript-specific primer pair includes a forward primer PTGS1-002-F and a reverse primer PTGS1-002-R. The nucleotide sequence of the forward primer PTGS1-002-F is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer PTGS1-002-R is shown in SEQ ID NO.

2. The PTGS1-002 recombinant plasmid positive standard was used to establish a standard curve between the PTGS1-002 transcript copy number and the Ct value detected by real-time PCR.

2. The RT-PCR quantitative detection kit for PTGS1-002 transcripts according to claim 1, characterized in that, The salt in the high-salt pyrolysis solution is at least one of sodium chloride, potassium chloride, or ammonium chloride, and the high-salt pyrolysis solution also contains 0.1% to 1% SDS or Triton X-100.

3. The RT-PCR quantitative detection kit for PTGS1-002 transcripts according to claim 1, characterized in that, The high-salt lysis buffer contains 1.0 M sodium chloride and 0.5% SDS, with a pH of 7.

4.

4. The RT-PCR quantitative detection kit for PTGS1-002 transcripts according to claim 1, characterized in that, The target sequence amplified by the PTGS1-002 transcript-specific primer pair is shown in SEQ ID NO.3, and the amplified fragment length is 390bp.

5. The RT-PCR quantitative detection kit for PTGS1-002 transcripts according to claim 1, characterized in that, The PTGS1-002 recombinant plasmid positive standard is a pMD-19T recombinant plasmid containing the target sequence shown in SEQ ID NO.

3.

6. A method for quantitative detection of PTGS1-002 transcripts by RT-PCR, characterized in that, Includes the following steps: S1. Take the serum or plasma sample to be tested, add a high-salt lysis buffer with a salt concentration of 0.5-2 M and mix. Sonicate the resulting mixture, centrifuge after sonication and take the supernatant to obtain the RNA template. S2. Using the RNA template obtained in step S1, perform reverse transcription to obtain cDNA; S3. Using the cDNA obtained in step S2 as a template, perform real-time quantitative PCR amplification using the PTGS1-002 transcript-specific primer pair. The PTGS1-002 transcript-specific primer pair includes a forward primer PTGS1-002-F and a reverse primer PTGS1-002-R. The nucleotide sequence of the forward primer PTGS1-002-F is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer PTGS1-002-R is shown in SEQ ID NO.

2. S4. Establish a standard curve using the PTGS1-002 recombinant plasmid standard, and determine the absolute copy number of the PTGS1-002 transcript in the serum or plasma sample to be tested based on the Ct value and the standard curve.

7. The RT-PCR quantitative detection method for PTGS1-002 transcripts according to claim 6, characterized in that, In step S1, the salt in the high-salt lysis solution is at least one of sodium chloride, potassium chloride, or ammonium chloride, and the high-salt lysis solution also contains 0.1% to 1% SDS or Triton X-100; the ultrasonic treatment power is 100 to 300 W, and the ultrasonic treatment time is 5 to 30 min.

8. The RT-PCR quantitative detection method for PTGS1-002 transcripts according to claim 6, characterized in that, In step S1, the high-salt lysis buffer contains 1.0 M sodium chloride and 0.5% SDS, with a pH of 7.

4. After the serum or plasma sample is mixed with the high-salt lysis buffer in equal volume, it is sonicated at 200 W for 20 min, with a 5 s interval between every 5 s of sonication. After sonication, it is centrifuged at 12000 rpm for 10 min, and the supernatant is used as the RNA template.

9. The RT-PCR quantitative detection method for PTGS1-002 transcripts according to claim 6, characterized in that, In step S2, the total volume of the reverse transcription reaction is 20 μL. The reaction system includes 4.0 μL of 5×Reverse Transcription Buffer, 2.0 μL of dNTP Mix, 1.0 μL of Random Primers, 1.0 μL of RNase Inhibitor, 1.0 μL of Reverse Transcriptase, 5.0 μL of RNA template, and nuclease-free water to a final volume of 20 μL. The concentration of each dNTP in the dNTP Mix is ​​10 mM, and the concentration of the Random Primers is 50 μM. The reverse transcription reaction conditions are 25℃ for 10 min, 50℃ for 45 min, and 85℃ for 5 min.

10. The RT-PCR quantitative detection method for PTGS1-002 transcripts according to claim 6, characterized in that, In step S3, the total volume of the real-time PCR reaction is 20 μL. The reaction system includes 10.0 μL of 2×SYBR Green qPCR MasterMix, 0.5 μL of 10 μM forward primer PTGS1-002-F, 0.5 μL of 10 μM reverse primer PTGS1-002-R, 2.0 μL of cDNA template, and 20 μL of nuclease-free water. The real-time PCR reaction conditions are 95℃ pre-denaturation for 30 s, followed by 40 cycles. Each cycle includes 95℃ denaturation for 10 s, 60℃ annealing for 30 s, and 72℃ extension for 30 s. The fluorescence signal is collected at the end of the extension step. In step S4, the PTGS1-002 recombinant plasmid standard is serially diluted 10-fold and amplified under the same real-time PCR reaction conditions as the sample to be tested. A standard curve is constructed with the logarithm of the copy number of each gradient standard as the x-axis and the corresponding Ct value as the y-axis.

Images