Molecular marker for identifying gender of hypophthalmichthys nobilis and primer and application thereof

Abstract

The application discloses a molecular marker for identifying the gender of a black carp, a primer thereof and application. Based on high-throughput sequencing and comparative genomics analysis, the application obtains a molecular marker which can be used for identifying the genetic gender of the black carp, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO:1 and SEQ ID NO:2; wherein the two sequences shown as SEQ ID NO:1 and SEQ ID NO:2 are simultaneously contained in the genome of a male black carp; and only the sequence shown as SEQ ID NO:2 is contained in the genome of a female black carp. The application also discloses a primer pair for specifically amplifying the sequence of the molecular marker, a kit containing the primer pair and an identification method. The method adopts the primer pair to perform PCR amplification on the genomic DNA of the black carp, and performs electrophoresis detection on the amplification product; if two bands are amplified, it is a male; and if one band is amplified, it is a female. The identification method provided by the application can early, quickly and accurately identify the genetic gender of the black carp of different specifications and different breeding strains, and the accuracy rate reaches 100%.

Description

Technical Field

[0001] This application relates to the field of silver carp sex identification technology, specifically to a molecular marker for identifying the sex of silver carp, its primers, and their applications. Background Technology

[0002] Silver carp is an important freshwater aquaculture fish, consistently ranking second among freshwater aquaculture fish. As a crucial species for stable production and supply, it provides a large amount of high-quality protein for the general public. Sex determination in silver carp plays a vital role in the breeding of new varieties and in maintaining genetic and ecosystem stability. Early sex determination in silver carp not only enables scientific management of population structure, improving aquaculture efficiency and economic benefits, but also provides a better understanding of natural population dynamics, supporting the development of scientific management strategies.

[0003] Traditional early sex determination in silver carp relied on dissection or microscopic observation, which not only caused fish mortality but was also slow. In adult individuals, especially sexually mature silver carp, sex can be determined by touching the presence of a rough ridge on the pectoral fin. Male individuals have a distinct "rough ridge" on the dorsal surface of the pectoral fin, which feels rough to the touch like sandpaper, while female individuals have a smooth surface without ridges. This method has solved the problem of sex determination in silver carp to some extent, with an accuracy rate of up to 98.9% for silver carp weighing between 300mm and 800mm. However, the accuracy rate is only 53.7% for extreme individuals with a body length less than 300mm or greater than 800mm. Because the sexual maturity cycle of silver carp is as long as 3-4 years, and there are no external secondary sexual characteristics applicable to the entire life cycle, there are no obvious morphological differences between males and females in the embryonic and juvenile stages. Therefore, developing a rapid and accurate sex determination method is crucial.

[0004] With the rapid development of molecular marker technology, molecular markers for genetic sex identification have shown great advantages in fish sex identification due to their stability, speed, and efficiency, and have been widely used in sex identification of species such as yellow catfish, common carp, anchovy, blue arowana, and barbel. In silver carp sex identification, Chang Chongjie et al. published a RAPD molecular marker for identifying the sex of silver carp fry, but this marker can only identify the sex of juvenile fish and has only been validated in one silver carp population. Therefore, developing an accurate and efficient molecular marker for silver carp sex identification applicable to different sizes and populations throughout the entire life cycle is of great importance for the breeding of new silver carp varieties, monitoring of wild populations, and the protection and utilization of germplasm resources. Summary of the Invention

[0005] In view of this, the purpose of this application is to provide a molecular marker for identifying the sex of silver carp, its primers, and its applications. Based on high-throughput sequencing and comparative genomics analysis, this application obtains sequences that differ between male and female silver carp, and designs specific primers based on these sequences for amplification, resulting in a molecular marker that can be used for genetic sex identification of silver carp. When using this molecular marker for sex identification of silver carp, only a small strip of fin needs to be cut, DNA extracted, and PCR amplified. The amplified products are then detected by electrophoresis. The number of target bands in the electrophoretic pattern allows for rapid and accurate differentiation of the genetic sex of the tested individual, with an accuracy rate of 100%.

[0006] To achieve the above objectives, this application provides the following technical solution:

[0007] In a first aspect, this application provides a molecular marker for identifying the sex of silver carp, the nucleotide sequence of which is shown in SEQ ID NO:1 and SEQ ID NO:2; the molecular marker contains two specific nucleotide sequences as shown in SEQ ID NO:1 and SEQ ID NO:2 in the male silver carp genome, while it contains only the nucleotide sequence shown in SEQ ID NO:2 in the female silver carp genome.

[0008] Based on this difference, the sex of silver carp can be accurately distinguished by detecting the number of amplified bands of the molecular marker.

[0009] Secondly, this application provides primer pairs for detecting the molecular markers described in the first aspect, including:

[0010] Upstream primer: CTGAATGCCCGTGCTTGCTC (SEQ ID NO:3);

[0011] Downstream primer: TACAGAGATGCCCTCTGTTG (SEQ ID NO:4).

[0012] Thirdly, this application provides a kit for identifying the sex of silver carp, the kit comprising the primer pair described in the second aspect.

[0013] In some embodiments, the kit also includes PCR Master Mix and ddH2O.

[0014] In some preferred embodiments, the kit further includes control 1 and control 2, wherein control 1 is a liquid preparation containing male silver carp genomic DNA and control 2 is a liquid preparation containing female silver carp genomic DNA.

[0015] Fourthly, this application provides a method for identifying the sex of a silver carp, comprising the following steps:

[0016] (1) Extract genomic DNA from the silver carp to be tested;

[0017] (2) Using the genomic DNA of the silver carp to be tested as a template, PCR amplification was performed using the primer pair described in the second aspect;

[0018] (3) Electrophoresis detection of PCR amplification products: when the amplification products show two bands with lengths of 429 bp and 612 bp respectively, the silver carp to be tested is male; when the amplification products show only one band with a length of 429 bp, the silver carp to be tested is female.

[0019] In some preferred embodiments, in step (1), the genomic DNA is extracted from the fin tissue of the silver carp to be tested.

[0020] In some embodiments, in step (2), the PCR amplification reaction system, with a total volume of 50 μL, includes: 25 μL of 2×PCR Mix, 1.5 μL each of upstream and downstream primers, 2 μL of DNA template, and 20 μL of ddH2O.

[0021] In some embodiments, the PCR amplification procedure in step (2) is as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 59 °C for 30 s, extension at 72 °C for 45 s, 34 cycles; extension at 72 °C for 10 min; cooling to 4 °C.

[0022] Fifthly, this application provides the application of the primer pairs described in the second aspect or the kit described in the third aspect in identifying the sex of silver carp.

[0023] In some preferred embodiments, the silver carp is at least one of Xiangjiang silver carp, Yangtze silver carp, Changfeng silver carp, and Changfeng No. 2 silver carp.

[0024] Compared with the prior art, this application has at least the following beneficial effects:

[0025] 1. The molecular markers for identifying the sex of silver carp provided in this application were obtained through screening using high-throughput sequencing and comparative genomics analysis, and exhibit inherent and stable differences between male and female silver carp. PCR amplification using primers designed targeting these molecular markers enables accurate and rapid identification of the genetic sex of silver carp, with an accuracy rate of up to 100%. This effectively avoids misjudgments that may occur due to individual developmental stage, environmental factors, or other reasons associated with traditional morphological observation or anatomical methods.

[0026] 2. This molecular marker can be stably applied in different sizes and varieties of silver carp (such as Xiangjiang silver carp, Yangtze River silver carp, Changfeng silver carp and the new silver carp strain Changfeng Silver Carp No. 2), showing good universality.

[0027] 3. The identification method provided in this application only requires routine PCR amplification combined with electrophoresis to determine sex, without the need for complex equipment or expensive reagents. The testing time for a single sample is short, making it suitable for rapid screening in simple environments such as fish farms, and especially applicable to sex determination in large-scale aquaculture populations. This application can extract DNA from trace tissues such as fins and blood, causing minimal harm to the fish and enabling non-destructive testing in vivo. Attached Figure Description

[0028] Figure 1 The result is a BLAST comparison of the gene with ID Hm00009 on chromosome 1 of the Dryad database in Example 1, based on TBtools software, with the male T2T reference genome constructed in this application.

[0029] Figure 2 The electrophoretic detection results of male and female Xiangjiang silver carp samples using sex-specific markers in Example 3 are shown.

[0030] Figure 3 The electrophoretic detection results of sex-specific markers for silver carp in Example 4 on male and female Yangtze River silver carp, Changfeng silver carp, and Changfeng silver carp No. 2 samples are shown. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0032] The materials used in the following embodiments are not limited to those listed below, and other similar materials may be used instead. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.

[0033] In this application, unless the context clearly indicates otherwise, the terms “including,” “comprising,” “containing,” “having,” etc., shall be understood as open-ended and mean “including but not limited to.”

[0034] To better understand this teaching and without limiting its scope, all figures and other numerical values ​​used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values ​​that may be adjusted according to the desired performance. At a minimum, each numerical parameter should be interpreted based on the reported significant figures and by applying common rounding techniques.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of this application pertains.

[0036] Example 1: Acquisition of sex-specific markers in silver carp

[0037] Three-year-old sexually mature silver carp from the Xiangjiang River were collected and bred at the Shishou Four Major Freshwater Fish Breeding Farm in Hubei Province. Sexing was determined by gonadal tissue sections. From these, 30 male and 30 female fish (average weight: female 3078.47g, male 2690.50g) were randomly selected, and fin rays were harvested to extract genomic DNA. A second-generation resequencing library was constructed from the extracted genomic DNA of 60 silver carp, and sequencing was performed using the BGI DNBSEQ-T7 platform at a sequencing depth of 30× to obtain whole-genome resequencing data for these individuals. Subsequently, all sequencing data were aligned to a constructed male silver carp T2T-level reference genome using BWA software. The sequencing of this reference genome was commissioned to Wuhan Huaming Biotechnology Co., Ltd.

[0038] To verify the sequence accuracy of the T2T genome constructed in this application, a comparative analysis was performed using the silver carp reference genome published in the Dryad database as a control. The published silver carp reference genome was downloaded from the Dryad database (https: / / doi.org / 10.5061 / dryad.4qrfj6qgm). Based on the genome annotation file information, the gene with ID Hm00009 on chromosome 1 was selected, and its DNA sequence was extracted and compared with the male T2T reference genome constructed in this application using BLAST. The results are as follows: Figure 1 As shown, the target gene sequence shares 99.97% similarity with the region 464144-460710 on chromosome 1 of this T2T reference genome, with an E value significantly lower than 1e-10, and the aligned region highly matches the characteristics of the silver carp genome. These results indicate that the gene sequence is highly conserved, providing strong molecular evidence to confirm that the genome belongs to the silver carp.

[0039] Coverage depth per 1000 bp non-overlapping sliding window sequence was calculated using SAMtools and Deeptools software. Based on the difference in coverage depth between sequencing fragments from male and female individuals, a male-specific fragment located on the TCF12-like gene on chromosome 24 was identified. This fragment is located in the region 25802596-25803207 of chromosome 24. Primers were designed based on the DNA fragment in this region for amplification, ultimately yielding a 612 bp molecular marker suitable for silver carp sex identification. The DNA sequence composition of this region is as follows:

[0040] Male-specific sequence (SEQ ID NO:1):

[0041] CTGAATGCCCGTGCTTGCTC TTTTAACCCTTAATCGGCTTATGGGGTCAATCTGACCCCGCTGACAGTTTCCTTAGTTTATAAAAAAGTGTTCCCTTCATCTCAGAGACATGAAACTCTGTGAATCTTCCTAAAATAATCTATCTAAACATGCACAAAAAGTCT GGGCTTGATTTAGTTGTCCTAGAGGTGTGTAAAAAAAAAAAAAAAAAAATCACGATTTAGTCCTTAGGGGTCTTAGATTGACCCTACTTTGAAAATGAATGGGAAAATTTGTCAAAAATAAATAAATAAATCCAGAATAAA TCCGAAATGTTCTACATTTCCATAAAGGTCCATAAACACAAAATGGAATGAGTGTTCTATCTCTCACACACACACAGACACACACACACACGTGTGTGACTGCAACAGAGGGCATCTCTGTAGAAATTGGCAAATAAAATCAA CAAAACTGGCCTAAATCTGCAAAATTTTACATGTAAATAAAGGTCTGGTCCTTGACCATAAACACAAAGTGGAACGAACGTTTTATCTTATACACAAACACACACACACAAACACACACAGACACACACACGTGTGTGACTG CAACAGAGGGCATC TCTG

[0042] Further analysis of the sequence composition of this region in male and female individuals revealed a difference in sequence length between them. Specifically, male individuals carried both a long sequence (SEQ ID NO:1) and a short sequence (SEQ ID NO:2) in this region, while female individuals carried only the short sequence (SEQ ID NO:2), and the short sequence was completely contained within the long sequence. SEQ ID NO:1 is present only in the male genome and is a male-specific sequence; SEQ ID NO:2 is stably present in both male and female individuals and is a shared sequence.

[0043] Shared sequence for both sexes (SEQ ID NO:2):

[0044] CTGAATGCCCGTGCTTGCTCTTTTAACCCTTAATCGGCTTATGGGGTCAATCTGACCCCGCTGACAGTTTCCTTAGTTTATAAAAAAGTGTTCCCTTCATCTCAGAGACATGAAACTCTGTGAATCTTCCTAAAATAATCTATCTAAACATGCACAAAAAGTCTGGGCTTGATTTAGTTGTCCTAGAGGTGTGTAAAAAAAAAAAAAAAAAAAAA ATCACGATTTAGTCCTTAGGGGTCTTAGATTGACCCTACTTTGAAAATGAATGGGAAAATTTGTCAAAAATAAATAAATAAATCCAGAATAAATCCGAAATGTTCTACATTTCCATAAAGGTCCATAAACACAAAATGGAATGAGTGTTCTATCTCTCACACACACACAGACACACACACACACGTGTGTGACTG CAACAGAGGGCATCTCTGTA

[0045] Finally, a specific molecular marker that can be used for sex identification of silver carp was obtained. The molecular marker consists of two sequences shown in SEQ ID NO:1 and SEQ ID NO:2, and the same pair of primers can be designed for amplification.

[0046] Example 2: Method of using silver carp sex-specific molecular markers

[0047] 2.1 Primer Design and Synthesis

[0048] Specific amplification primers were designed for the specific molecular markers (SEQ ID NO:1 and SEQ ID NO:2) obtained in Example 1:

[0049] Upstream primer: CTGAATGCCCGTGCTTGCTC (SEQ ID NO:3);

[0050] Downstream primer: TACAGAGATGCCCTCTGTTG (SEQ ID NO:4).

[0051] 2.2 Methods for sex determination in silver carp

[0052] (1) Extract genomic DNA from the silver carp to be tested;

[0053] (2) Using the genomic DNA of the silver carp to be tested as a template, PCR amplification was performed using the amplification primers with the above-mentioned specific molecular markers to obtain the amplification products. The PCR system was 50 μL, including 25 μL of 2×PCR Mix, 1.5 μL each of forward and reverse primers, 2 μL of DNA template, and 20 μL of ddH2O. Before amplification, the DNA templates of different individuals were adjusted to the same concentration. The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 45 s, 34 cycles; 72℃ extension for 10 min; cooling to 4℃.

[0054] (3) Perform electrophoresis on the amplification products and determine the sex of the individual to be tested based on the electrophoresis results: if the amplification products contain two bands with lengths of 429 bp and 612 bp respectively, the genetic sex of the individual to be tested is determined to be male; if the amplification products contain only one band with a length of 429 bp, the genetic sex of the individual to be tested is determined to be female.

[0055] Example 3: Application of sex-specific molecular markers in sex identification of Xiangjiang silver carp

[0056] (1) Three-year-old Xiangjiang silver carp were collected from the Shishou Four Major Freshwater Fish Breeding Farm in Hubei Province. Twelve male and 12 female fish (average weight: female 3070.5g, male 2829.75g) were randomly selected from them. The pectoral fins were cut off and preserved in anhydrous ethanol. Genomic DNA was extracted from the fin tissue using the Tian Genomic DNA Extraction Kit. The integrity of the extracted DNA was then detected by 1% agarose gel electrophoresis, and its concentration was determined by ultraviolet spectrophotometer. Samples with poor extraction quality were extracted repeatedly until the DNA quality was qualified.

[0057] (2) Using the extracted genomic DNA as a template, PCR amplification and agarose gel electrophoresis were performed according to the method in Example 2. The electrophoresis results were analyzed to determine the sex of the 24 fish.

[0058] Figure 2 The agarose gel electrophoresis results show that specific bands were amplified in all 12 male silver carp tested. Both males amplified two bands, 612 bp and 429 bp, while all 12 females amplified only one 429 bp band. These results indicate that the molecular markers provided in this application can be used for genetic sex determination in the Xiangjiang silver carp.

[0059] Example 4: Application of sex-specific molecular markers in sex identification of other varieties and populations of silver carp

[0060] To verify the applicability of the developed molecular markers for sex identification in new silver carp varieties and strains, samples of common Yangtze silver carp (average weight: female 14.75g, male 15.64g), Changfeng silver carp (average weight: female 2.28g, male 2.04g), and the new Changfeng silver carp strain No. 2 (average weight: female 1.22g, male 1.07g) were collected from the state-owned Bailuhu Farm in Qianjiang City, Hubei Province. Sex was determined by microscopic observation of the gonads after dissection. Twelve males and twelve females were collected from each silver carp population, and caudal fin tissue was harvested and preserved in pure alcohol.

[0061] Genomic DNA was extracted from the fin rays using the method described in Example 3. After testing the integrity and purity of the DNA, PCR amplification and electrophoresis were performed using the extracted DNA as a template.

[0062] Electrophoresis results of the amplified DNA products of each silver carp population are shown below. Figure 3 Electrophoresis showed that in the three silver carp populations tested, male individuals amplified two bands, 612 bp and 429 bp, while both male and female individuals amplified only one 429 bp band. The molecular markers in this application can also be used for genetic sex determination in Yangtze silver carp, Changfeng silver carp, and the new Changfeng silver carp strain 2.

[0063] The above results indicate that the molecular markers provided in this application can be used for genetic sex identification of silver carp of different sizes and varieties.

[0064] Based on the results of the above embodiments, this application also provides a kit for identifying the genetic sex of silver carp, comprising the aforementioned primer pairs (SEQ ID NO:3, SEQ ID NO:4), as well as PCR MasterMix and ddH2O. In some preferred embodiments, the kit further includes a male control and a female control, wherein the male control is a liquid preparation containing male silver carp genomic DNA, and the female control is a liquid preparation containing female silver carp genomic DNA, to facilitate sex differentiation and identification of the samples to be tested.

[0065] The present application has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present application. The descriptions of the embodiments above are only for the purpose of helping to understand the present application and its core ideas. It should be noted that those skilled in the art can make several improvements and modifications to the present application without departing from the principles of the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. A molecular marker for identifying the sex of silver carp, characterized in that, The nucleotide sequences of the molecular marker are shown in SEQ ID NO:1 and SEQ ID NO:2; the molecular marker contains two specific nucleotide sequences as shown in SEQ ID NO:1 and SEQ ID NO:2 in the male silver carp genome; while it contains only the nucleotide sequence shown in SEQ ID NO:2 in the female silver carp genome.

2. The primer pair for detecting the molecular marker of claim 1, characterized in that, include: Upstream primer: Nucleotide sequence as shown in SEQ ID NO:3; Downstream primer: Nucleotide sequence as shown in SEQ ID NO:

4.

3. A reagent kit for identifying the sex of silver carp, characterized in that, The kit includes the primer pair as described in claim 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes PCR Master Mix and ddH2O.

5. The reagent kit according to claim 4, characterized in that, The kit also includes control 1 and control 2, wherein control 1 is a liquid preparation containing male silver carp genomic DNA and control 2 is a liquid preparation containing female silver carp genomic DNA.

6. A method for identifying the sex of a silver carp, characterized in that, Includes the following steps: (1) Extract genomic DNA from the silver carp to be tested; (2) Using the genomic DNA of the silver carp to be tested as a template, PCR amplification was performed using the primer pair described in claim 2; (3) Electrophoresis detection of PCR amplification products: when the amplification products show two bands with lengths of 429 bp and 612 bp respectively, the silver carp to be tested is male; when the amplification products show only one band with a length of 429 bp, the silver carp to be tested is female.

7. The method according to claim 6, characterized in that, In step (1), the genomic DNA is extracted from the fin tissue of the silver carp to be tested.

8. The method according to claim 6, characterized in that, In step (2), the PCR amplification reaction system, with a total volume of 50 μL, includes: 25 μL of 2×PCR Mix, 1.5 μL each of upstream and downstream primers, 2 μL of DNA template, and 20 μL of ddH2O; the PCR amplification program is as follows: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 59 ℃ annealing for 30 s, 72 ℃ extension for 45 s, 34 cycles; 72 ℃ extension for 10 min; cooling to 4 ℃.

9. The use of the primer pair of claim 2 or the kit of any one of claims 3-5 in identifying the sex of silver carp.

10. The application according to claim 9, characterized in that, The silver carp mentioned is at least one of the following: Xiangjiang silver carp, Yangtze silver carp, Changfeng silver carp, and Changfeng No. 2 silver carp.

Images