A snp marker related to head shape of rice fish and application thereof

Abstract

The application discloses a SNP marker related to head shape of rice field eel and application thereof, and belongs to the technical field of aquatic molecular breeding. The SNP marker is located at the 56904310th base of the 4th chromosome of the rice field eel, the mutation type is C / T, is named as Chr4:56904310 C>T, and the preferred genotype is TT; the head width of the rice field eel individual carrying the genotype is significantly smaller than that of the CT and CC genotype individuals. The application further provides a primer pair for amplifying and detecting the SNP marker and a kit containing the primer pair, and simultaneously discloses a detection method and application. The SNP marker is closely related to the head shape of the rice field eel, can be applied to the breeding of the rice field eel, and realizes precision breeding.

Description

Technical Field

[0001] This invention belongs to the field of aquatic molecular breeding technology, specifically relating to the identification of a SNP marker related to the head shape of the yellow eel and its application. Background Technology

[0002] Yellow eel ( Monopterus albus The yellow eel (Sinocyclocheilus spp.) is a freshwater bony fish that inhabits rice paddies, swamps, and mudflats, and is widely distributed in East Asia, South Asia, and Southeast Asia. Yellow eels have delicious and nutritious flesh, making them highly valuable economically and popular with consumers. They are one of my country's most commercially valuable "specialty freshwater fish." Although in recent years, more and more feed additives have been proven to promote efficient yellow eel farming and increase market supply, the juvenile and even adult yellow eels currently used for farming still mainly come from wild catches.

[0003] Traditionally, the selection of superior phenotypic traits has primarily been achieved through population selection or artificial intervention in the aquaculture environment. This process is not only time-consuming but also makes it difficult to guarantee the uniformity of traits across the entire population. Rapidly developing genomic resources and technologies have revealed the molecular mechanisms behind economic and productive traits, while genetically modified individuals obtained through gene editing offer convenience for targeted breeding to meet the needs of aquaculture. Genome-wide association studies (GWAS) are considered an effective strategy for analyzing and identifying marker genes associated with complex target phenotypic traits.

[0004] Therefore, it is necessary to research and develop more precise and effective breeding methods for swamp eels based on genomic resources. Summary of the Invention

[0005] The technical problem to be solved by this invention is to fill the gap in the research on the economic trait of head shape in swamp eels. It provides an SNP marker related to head shape in swamp eels and its application, which can be applied to the breeding of swamp eels to achieve precision breeding.

[0006] To achieve the above objectives, the present invention adopts the following technical solution.

[0007] The first aspect of the present invention is to provide an SNP marker related to the head shape of the swamp eel, wherein the SNP marker is located at the 56904310th base of chromosome 4, the mutation type is C / T, and it is named Chr4:56904310 C>T; specifically, the SNP site is located at the 84 bp site of the sequence shown in SEQ ID NO:1, and its preferred genotype is TT.

[0008] A second aspect of the present invention is to provide a primer pair for amplifying or detecting the above-mentioned SNP marker, wherein the nucleotide sequences of the primer pair are as shown in SEQ ID NO:2 and SEQ ID NO:3; Forward primer: SEQ ID NO:2 (5'-3')TTTTTTGGAGCGACTGTAATCCC Reverse primer: SEQ ID NO:3 (5'-3') ACACAGTGAACTTTCTCTGAGTGTTCT.

[0009] A third aspect of the present invention is to provide a kit for amplifying or detecting the head shape of a swamp eel, wherein the kit comprises the primer pairs shown above as SEQ ID NO:2 and SEQ ID NO:3; and reagents for PCR amplification.

[0010] A fourth aspect of the present invention is to provide the application of the above-mentioned SNPs related to the head shape of the swamp eel, the above-mentioned primer pairs as shown in SEQ ID NO:2 and SEQ ID NO:3, and the above-mentioned kit for amplifying or detecting the head shape of the swamp eel, for detecting the head shape trait of the swamp eel; specifically, the application includes the following steps: (1) Take muscle tissue from the head of the eel to be tested for the purpose of extracting genomic DNA from the eel; (2) Using the genomic DNA of the yellow eel as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO:2 and SEQ ID NO:3 to obtain the amplification product; (3) The amplified products were subjected to Sanger sequencing to determine the genotype of the individual eel Chr4:56904310 C>T; The preferred genotype is TT, and the head width of individuals carrying this genotype is significantly smaller than that of individuals carrying the CT and CC genotypes.

[0011] The fifth aspect of the present invention provides the application of the above-mentioned SNPs related to the head shape of the swamp eel in the breeding of swamp eels.

[0012] A sixth aspect of the present invention provides a method for detecting the head shape of a swamp eel, the method comprising the following steps: (1) Take muscle tissue from the head of the swamp eel to be tested for the extraction of swamp eel genomic DNA; (2) Using the genomic DNA of the yellow eel as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO:2 and SEQ ID NO:3 to obtain the amplification product; (3) The amplified products were subjected to Sanger sequencing to determine the genotype of the individual eel Chr4:56904310 C>T; The preferred genotype is TT, and the head width of individuals carrying this genotype is significantly smaller than that of individuals carrying the CT and CC genotypes.

[0013] Advantages and innovations of the present invention: This invention provides a SNP marker for identifying head shape related to swamp eels and its application. Using the primers provided in this invention, PCR amplification of swamp eel genomic DNA allows for rapid identification of the genotype (Chr4:56904310 C>T) in individual swamp eels based on the amplified fragments, and head shape can be determined based on the genotype. The SNP marker provided by this invention can be applied to the artificial breeding of swamp eels to obtain head shape traits in specific strains, ultimately achieving precision breeding of swamp eels. Attached Figure Description

[0014] Figure 1 This is a Manhattan plot from the GWAS analysis of the head shape trait of the yellow eel in Example 1 of this application.

[0015] Figure 2 This is a statistical result diagram of the head width of different genotype eels (Chr4:56904310 C>T) in Example 1 of this application.

[0016] Figure 3 The size of the genomic DNA of the yellow eel containing the target SNP was amplified using the nucleotide sequence shown in SEQ ID NO:2-3 in Example 2 of this application.

[0017] Figure 4 This is a statistical result diagram of the head width of different genotype eels (Chr4:56904310 C>T) in Example 2 of this application. Detailed Implementation

[0018] The following examples are merely illustrative of the invention and should not be construed as limiting it. Any modifications or substitutions made to the methods, steps, or conditions of the invention without departing from its spirit and essence are within the scope of the invention. Experimental methods not specifically described in the examples, and reagents and materials not specified in the examples, are performed according to conventional conditions in the art, and all reagents used are commercially available.

[0019] Example 1: Screening of SNP markers related to head shape traits in individual yellow eels 1.1 Sample Collection The population used was a biomimetic breeding population from the Zhuangxing Comprehensive Experimental Station of the Shanghai Academy of Agricultural Sciences. A mixed family of yellow eels was constructed and cultured in the same pond. After 10 months of culture, 200 experimental fish were randomly captured, and the head width of each fish was measured and recorded. At the same time, tail muscle tissue of the experimental fish was collected for genomic DNA extraction.

[0020] 1.2 Genomic DNA Extraction Genomic DNA was extracted from muscle using the Dneasy Blood & Tissue Kit (brand: QIAGEN, catalog number: 69504) according to the manufacturer's instructions. DNA quality and concentration were determined by 0.8% agarose gel electrophoresis and a Qubit 4.0 bioanalyzer.

[0021] 1.3 Genome resequencing and SNP variant detection Library construction was conducted at Shanghai Paiseno Biotechnology Co., Ltd. Genomic DNA was first extracted and randomly fragmented using ultrasound, with inserts approximately 400 bp in length. End repair was then performed, adding an A-tail to the 3' end and a sequencing adapter to the 5' end. The assembled DNA was purified and amplified using polymerase chain reaction (PCR) to prepare a 400 bp library. Paired-end sequencing of the genomic DNA was performed using an Illumina NovaSeq 6000 with the PE150 strategy. After data quality control and filtering, the raw sequencing data were mapped to a reference genome using the BWA-MEM algorithm for sequence alignment, and SNPs were filtered using GATK software.

[0022] 1.4 Genome-wide association analysis of growth rate trait GWAS analysis was performed using the efficient mixed model association analysis software EMMAX. Manhattan plots of the GWAS results were generated using R software. The threshold P-values ​​for genome-wide significance were calculated using Bonferroni correction, and the final thresholds for significance (log10(0.05 / N)) were set at 7.9, and for suggestiveness (log10(1 / N)) at 6.6.

[0023] 1.5 Test Results Based on the Illumina NovaSeq 6000 sequencing platform, resequencing of 200 samples yielded 887.23 GB of raw reads. After removing adapters and low-quality reads from the sequencing data, 842.16 GB of clean reads were obtained. From 3,269,024 SNPs, a SNP locus significantly associated with the head shape trait of the yellow eel was found on chromosome Chr4 (e.g., Figure 1 As shown), named Chr4:56904310 C>T, this SNP site is located at the 84 bp position of the sequence shown in SEQ ID NO:1 (shown in bold and underlined). Figure 2 As shown, at the Chr4:56904310 C>T site, the head width of the TT genotype is significantly smaller than that of the CT and CC genotypes.

[0024] Based on the above results, this embodiment screened out one SNP marker related to the head shape of the swamp eel, located at the 56904310th base of chromosome 4, with a mutation type of C>T, named Chr4:56904310 C>T. The TT genotype is the preferred genotype, which has a narrower head.

[0025] SEQ ID NO:1 (5'-3'): TTTTTTGGAGCGACTGTAATCCCTCAGATGTCATTAACATCAGCATCAGAACACGCAAGAAGAAAACATTTCTTCACTGTTTCNCACTTCAACATTTAGGAGGCCTTCAATAATATTATAATCTCGTCTTAGTTTTTCAGAACACTCAGAGAAAGTTCACTGTGT The 84th N It can be C or T.

[0026] Example 2: Sequencing Validation and Application of SNP Markers Related to Head Shape in Eels 2.1 DNA collection from the loach samples to be validated Using the mixed eel family from Example 1 above, 150 fish were randomly selected again, and the genomic DNA of each individual was obtained according to the DNA extraction method described in Example 1.

[0027] 2.2 Amplifying nucleotide fragments containing the target SNP site To verify whether Chr4:56904310 C>T is related to the head shape trait of individual swamp eels, a pair of primers for amplifying this SNP was designed using Priemer 5.0 software. The sequences are shown in Table 1, SEQ ID NO:2-3. Genomic DNA was then amplified using these primers. The primer pair was synthesized by Shanghai Sangon Biotech Co., Ltd.

[0028] Prepare the following 10 μl reaction mixture using a dye-added premixed PCR kit (brand: TaKaRa, catalog number: RR903A): 5 μl Premix Taq, 0.5 μl 10 μM forward primer, 0.5 μl 10 μM reverse primer, 1 μl template DNA, and add ddH2O to a total volume of 10 μl.

[0029] The PCR amplification program was as follows: 98℃ pre-denaturation for 10 min, 98℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles, and a final extension at 72℃ for 5 min.

[0030] Table 1. Primer nucleotide sequences used for specific amplification of Chr4:56904310 C>T.

[0031] Prepare a 1% agarose gel, add the PCR amplification products described above, and perform electrophoresis using a 1 kb DNA ladder as a label. Use a gel imaging system to capture images of the bands to preliminarily verify the amplified fragment size of each sample. The electrophoresis results of samples with correct fragment sizes are shown below. Figure 3 As shown.

[0032] 2.3 Sanger sequencing to identify SNP loci genotypes Qualified PCR amplification products were sent to Shanghai Ouyi Biomedical Technology Co., Ltd. for Sanger sequencing using reverse primers to determine the genotype of each sample at Chr4:56904310 C>T. After successful genotyping, the head width data of each genotype sample were compared and analyzed. The results are as follows: Figure 4 As shown, the head width of the TT genotype is significantly smaller than that of the CT and CC genotypes.

[0033] The above results indicate that the Chr4:56904310 C>T SNP marker obtained in Example 1 is significantly correlated with the head shape trait of individual swamp eels, and this correlation is stable and reliable, as verified by Sanger sequencing of 150 swamp eel samples in Example 2. Among them, the TT genotype is the preferred genotype for swamp eel head shape, and the average head width of swamp eels carrying this genotype is significantly lower than that of individuals with the CT and CC genotypes.

[0034] Therefore, the Chr4:56904310 C>T SNP marker and primer pair provided by this invention can be effectively applied to molecular marker-assisted breeding of head shape traits in swamp eels. This can quickly screen out swamp eel individuals with excellent head shape traits, shorten the breeding cycle, improve breeding efficiency, and provide a reliable molecular tool for the accurate evaluation and improvement of swamp eel germplasm resources.

Claims

1. A SNP marker related to the head shape of the yellow eel, characterized in that, The SNP marker is located at the 56904310th base of chromosome 4 of the yellow eel, with a mutation type of C / T, named Chr4:56904310 C>T. This SNP site is located at position 84 of the sequence shown in SEQ ID NO:1, and its preferred genotype is TT.

2. A primer pair for amplifying or detecting the SNP marker of claim 1, characterized in that, The primer pairs are nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3.

3. A reagent kit for detecting the head shape of a yellow eel, characterized in that, The kit contains the primer pair as described in claim 2.

4. The application of the SNP marker as described in claim 1 in predicting head shape traits of swamp eels or in swamp eel breeding.

5. The application of the primer pair according to claim 2 in predicting head shape traits of swamp eels or in the breeding of swamp eels.

6. The application of the kit according to claim 3 in predicting head shape traits of swamp eels or in swamp eel breeding.

7. The application according to claim 4, wherein SNP markers related to the head shape of the yellow eel are used to detect the head shape trait of the yellow eel, comprising the following steps: (1) Take muscle tissue from the head of the eel to be tested and extract the genomic DNA of the eel; (2) Using the genomic DNA of the yellow eel as a template, PCR amplification was performed using the primer pair described in claim 2 to obtain the amplification product; (3) The amplified products were subjected to Sanger sequencing to determine the genotype of the individual eel with the SNP marker Chr4:56904310 C>T as described in claim 1; The preferred genotype is TT, and the head width of eels carrying this genotype is significantly smaller than that of individuals carrying the CT and CC genotypes.

8. The application according to claim 5, wherein the primer pair is used to detect the head shape trait of the yellow eel, comprising the following steps: (1) Take muscle tissue from the head of the eel to be tested and extract the genomic DNA of the eel; (2) Using the genomic DNA of the yellow eel as a template, PCR amplification was performed using the primer pair described in claim 2 to obtain the amplification product; (3) The amplified products were subjected to Sanger sequencing to determine the genotype of the individual eel with the SNP marker Chr4:56904310 C>T as described in claim 1; The preferred genotype is TT, and the head width of individuals carrying this genotype is significantly smaller than that of individuals carrying the CT and CC genotypes.

9. A method for detecting head shape characteristics in yellow eels, the method comprising the following steps: (1) Take muscle tissue from the head of the eel to be tested for the purpose of extracting genomic DNA from the eel; (2) Using the genomic DNA of the yellow eel as a template, PCR amplification was performed using the primer pair described in claim 2 to obtain the amplification product; (3) The amplification products were subjected to Sanger sequencing to determine the genotype of the individual eel with the SNP marker Chr4:56904310 C>T as described in claim 1; The preferred genotype is TT, and the head width of individuals carrying this genotype is significantly smaller than that of individuals carrying the CT and CC genotypes.

Images