Laiwu pig anti-diarrhea related snp molecular marker, detection reagent and application thereof

Abstract

The application discloses a SNP molecular marker related to diarrhea resistance of Laiwu pigs, a detection reagent and application thereof, and belongs to the technical field of molecular genetics. ABCD1 The application obtains the SNP site significantly related to the diarrhea trait after PEDV infection through whole genome association analysis in the Laiwu pig The SNP molecular marker provided by the application can realize auxiliary prediction of the PEDV resistance potential before or in the early stage of disease occurrence by detecting the genotype information of pigs, and has the advantages of short detection period, stable result, good repeatability and being not easily affected by the feeding environment and the infection state.

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, specifically to SNP molecular markers, detection reagents, and their applications related to antidiarrheal properties in Laiwu pigs. Background Technology

[0002] Porcine epidemic diarrhea virus (PEDV) is an important pathogen that can cause serious intestinal diseases in pigs, especially suckling piglets. After infection with PEDV, piglets usually show clinical symptoms such as vomiting, watery diarrhea, dehydration, and growth retardation. In severe cases, it can lead to high mortality rates and cause huge economic losses to the pig industry.

[0003] Currently, the prevention and control of swine diarrheal diseases mainly rely on measures such as vaccination, adjuvant drug treatment, optimized feeding management, and environmental control. However, PEDV infection is easily affected by various factors such as viral strain variation, maternal antibody levels, feeding environment, and individual immune status. Relying solely on exogenous prevention and control measures is insufficient to fundamentally reduce the susceptibility of pig herds. Therefore, improving the diarrhea resistance of pig herds through genetic breeding has gradually become an important direction in swine disease resistance breeding.

[0004] With the development of molecular genetics and high-throughput sequencing technologies, utilizing genetic variations such as single nucleotide polymorphisms (SNPs) as molecular markers, combined with marker-assisted selection (MAS) technology, to improve disease resistance traits has become an important technique in modern animal breeding. Existing research has found that... FUT1 Gene-specific site polymorphisms are associated with the ability of pigs to adhere to enterotoxigenic Escherichia coli (ETEC) F18 strains, and can be used to reduce the susceptibility of piglets to diarrhea; MUC13 Multiple SNP sites in the gene have been reported to be associated with susceptibility to infection with *E. coli* type F4ac in piglets and can be used for selection in anti-diarrheal breeding; in addition, CTLA4 , STAT3 Specific loci in immune-related genes have also been found to be associated with diarrhea resistance or susceptibility in piglets. However, existing research mainly focuses on resistance studies in common introduced pig breeds or against specific bacterial diarrhea pathogens. For local Chinese pig breeds, especially the Laiwu pig, a genetic resource with local characteristics, there is still limited research on the genetic basis of its association with diarrhea phenotypes after PEDV infection. Currently, there is a lack of specific molecular markers that can effectively predict PEDV resistance or susceptibility in Laiwu pigs, limiting the development and utilization of superior disease-resistant germplasm resources from Laiwu pigs.

[0005] ABCD1The gene (ATP Binding Cassette Subfamily D Member 1) belongs to the ATP-binding cassette transporter family and encodes a very long-chain fatty acid transporter on the peroxisome membrane, involved in cellular lipid metabolism, oxidative stress regulation, and inflammation-related processes. Previous studies have shown that abnormal lipid metabolism, oxidative stress, and inflammatory responses can all affect the host's response to viral infection. However, current research on pigs... ABCD1 The relationship between genetic polymorphism and diarrheal phenotypes caused by PEDV infection lacks systematic research. Summary of the Invention

[0006] In view of the above-mentioned prior art, the purpose of this invention is to provide an SNP molecular marker, detection reagent and its application related to antidiarrheal treatment in Laiwu pigs.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides an SNP molecular marker related to antidiarrheal properties in Laiwu pigs, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the 156th base from the 5' end of the sequence is the SNP site, and its base polymorphism is A or G; specifically as follows: GACGGGTGGCGAAGTCGCAGTAGCCTCAGCCAGGCTGTGGAGCGGACGGACGCGTCTGGTGCCCCGGGGAGGGGCGCCACCGGGGGAGGAGGAGGAGGAGGTGGAGAGGAAGAGACGCCCTCTCTGCCTGAGACCTCTGGAGGCCTCTGACCCCAG A / G GGCTAGGGGACTGCCAAATTCCTCCACCTCGGCTGTCTGAAGAGGCCGCGACCCTGGAGGGCCCTGAACCCACTGCACCAGGGGCCCCAGCACCACCCGGGTGGCCTAAAGCGACAGTCTCAGGGACCACTGCAAGCTTTCCTGTTGCCTAGACCACGAGCCCGGGGTCAGAGCCACCACCCTTCCAGCTACCTGCTTCCTCTGCTGCCTCA.

[0008] Note: The nucleotides in bold italics in the sequence are SNP sites, which are represented in the sequence listing by the corresponding degenerate base "R".

[0009] The molecular markers were significantly associated with porcine PEDV resistance, with the G allele being the resistance-associated allele; boars carrying the G allele exhibited higher PEDV resistance.

[0010] pig ABCD1 The gene is located on the X chromosome (Chr.X:124485076-124501742) and is an X-linked gene. Because the X chromosome has a higher frequency of non-recombination during meiosis, the region containing this gene exhibits a long linkage disequilibrium block; furthermore, X-linked inheritance follows specific genetic rules, which are fundamentally different from those of autosomal genes. Differences exist between male and female individuals in gene dosage, genotype interpretation, and statistical modeling at this locus, which makes... ABCD1 The association analysis between gene SNPs and PEDV resistance is more complex. This invention screens out SNPs that are significantly associated with PEDV resistance and can be used for genotyping detection from the porcine ABCD1 gene region (Chr.X:124485076-124501742), which is of great significance for pig resistance breeding.

[0011] For boar individuals, their genotype at the SNP locus is hemizygous, carrying only one allele, A or G; among them, boar individuals carrying allele G exhibit resistance to PEDV infection.

[0012] A second aspect of the present invention provides the application of the above-mentioned SNP molecular markers in the following (1) or (2): (1) Preparation of reagents for identifying the resistance of Laiwu pigs to PEDV infection; (2) Assisted selection breeding of Laiwu pigs resistant to PEDV infection.

[0013] A third aspect of the present invention provides a detection reagent comprising: a primer pair for detecting the above-mentioned SNP molecular marker, said primer pair being composed of primer 346-F with a nucleotide sequence as shown in SEQ ID NO. 2 and primer 713-R with a nucleotide sequence as shown in SEQ ID NO. 3; specifically as follows: 346-F: 5'-GACGGGTGGCGAAGTCGCAGTA-3'; (SEQ ID NO. 2) 713-R: 5' - TGAGGCAGCAGAGGAAGCAGGTA -3'. (SEQ ID NO.3) Preferably, the detection reagent is a PCR sequencing kit or a KASP typing kit.

[0014] A fourth aspect of the present invention provides the use of the above-described detection reagent in the following (1) or (2): (1) Preparation of reagents for identifying the resistance of Laiwu pigs to PEDV infection; (2) Assisted selection breeding of Laiwu pigs resistant to PEDV infection.

[0015] In the above application, the sequencing result of the amplified product obtained by using the detection reagent corresponds to the Laiwu boar with G at the 156th base of the sequence shown in SEQ ID NO.1, and its resistance to PEDV is higher than that of the Laiwu boar with A at the 156th base of the sequence shown in SEQ ID NO.1.

[0016] Preferably, the amplification system is as follows: 12.5 μL of 2×Es Taq Master Mix, 1 μL each of primer 346-F and primer 713-R (10 μmol / L), 1 μL of template DNA (50 ng / μL), and 9.5 μL of ddH2O.

[0017] The beneficial effects of this invention are: This invention addresses the lack of effective molecular markers for evaluating diarrhea resistance in Laiwu boars after infection with porcine epidemic diarrhea virus (PEDV). Through genome-wide association analysis, it identifies effective molecular markers for evaluating PEDV resistance in Laiwu boars. ABCD1 Gene region screening identified SNP loci significantly associated with diarrheal traits caused by PEDV infection, and these SNP loci were used as molecular markers to identify PEDV resistance or susceptibility in Laiwu pigs. Compared with existing phenotypic evaluation methods that mainly rely on clinical symptom observation, virus detection, diarrhea scoring, and challenge tests, the SNP molecular markers provided by this invention can assist in predicting PEDV resistance potential before or in the early stages of disease by detecting pig genotype information. They have advantages such as short detection cycle, stable results, good repeatability, and less susceptibility to changes in rearing environment and infection status, providing a new molecular marker tool for the early screening of superior PEDV-resistant breeding pigs. Attached Figure Description

[0018] Figure 1 : Gel electrophoresis image of the amplified fragment corresponding to the SNP molecular marker; M: Marker; Lanes 1-4 represent duplicate samples.

[0019] Figure 2 Sanger sequencing peak diagram of the target SNP site. Detailed Implementation

[0020] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0021] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0022] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions. Wherein: The PEDV used in this invention is the classic strain CV777 of porcine epidemic diarrhea virus (PEDV), which has the GenBank accession number AF353511.1.

[0023] Example 1: Screening and identification of core SNP loci affecting diarrhea trait caused by PEDV infection in Laiwu pigs 1. Test method: Two hundred and eighteen 21-day-old weaned Laiwu piglets (all castrated boars) from a pig farm in Laiwu District, Shandong Province, were selected as experimental subjects after testing negative for PEDV nucleic acid. All piglets were acclimatized under the same feeding conditions and then orally administered 10 mL of a solution containing 10... 11 Piglets were challenged with a viral suspension of PEDV CV777 strain. Fecal samples were collected on day 2 post-challenge, and viral RNA was extracted using the OmegaBio-tek fecal RNA extraction kit. PEDV infection was detected by RT-qPCR, and the results showed that all experimental piglets were positive for PEDV. Piglets were observed for 14 consecutive days post-challenge, and the fecal condition was recorded daily. Diarrhea severity was classified into three grades based on fecal morphology, as shown in Table 1.

[0024] Table 1: Scoring Criteria for Diarrhea Severity Piglets with a fecal score of 3 at any point during the observation period were defined as belonging to the diarrhea group; piglets with a fecal score ≤2 throughout the entire observation period were defined as belonging to the non-diarrhea group. Based on the above criteria, 218 piglets were used to identify the diarrhea phenotype caused by PEDV infection.

[0025] After phenotypic recording, samples were collected from all piglets' intestines, intestinal contents, ear edges, liver, and spleen for storage. These samples were then used for subsequent genomic DNA extraction, genome resequencing, SNP genotyping, and association analysis.

[0026] The collected ear tissue samples were sent to Hangzhou Lianchuan Biomedical Technology Co., Ltd. for whole-genome resequencing on the BGI sequencing platform, with a sequencing depth ≥1×.

[0027] Bioinformatics software was used to process the low-depth sequencing data. First, the raw sequencing data was quality controlled to obtain high-quality clean reads. The clean reads were then aligned to the pig reference genome Sscrofa11.1 using Burrows-Wheeler Aligner (BWA, v0.7.17) to obtain the sequence alignment file. Subsequently, Samtools (v1.11) was used to sort the alignment results, and Picard was used to remove duplicate reads generated during PCR amplification to reduce the impact of sequencing bias on subsequent variant detection and genotype inference.

[0028] For the missing genotype information in the pig X chromosome region, preliminary genotype imputation was performed using Stitch software based on the obtained BAM file and target SNP locus information. The preliminary imputation results underwent quality screening, retaining SNP loci with INFO_SCORE > 0.4, minor allele frequency (MAF) ≥ 0.00001, and genotype deletion ratio ≤ 80%. Subsequently, the filtered variant data was input into Beagle software for further genotype inference to complete the remaining missing loci, ultimately obtaining complete X chromosome SNP genotype data.

[0029] The obtained SNP data underwent further quality control using PLINK v1.90 software. Individuals with a missing rate exceeding 5% were removed according to preset criteria, SNP markers with a missing rate exceeding 5% were filtered out, low-frequency variant sites with MAF < 0.05 were eliminated, and outlier samples were removed based on sample quality. After multiple rounds of quality filtering, a genotype dataset consisting of 218 samples and containing 339,343 high-quality SNP markers was finally obtained for subsequent genetic association analysis.

[0030] Targeting Laiwu pigs ABCD1 For the gene region, all SNPs within a 2 kb range upstream and downstream of the transcribed region were extracted. Linkage disequilibrium (LD) analysis was performed using PLINK v1.90, with r² ≥ 0.8 as the selection criterion to determine representative marker sites (TagSNPs). Furthermore, the chi-square test of allele frequencies was used to perform population genetic association analysis on the selected TagSNPs to evaluate the statistical association between different genetic variation sites in the ABCD1 gene region and the diarrhea phenotype in pigs infected with PEDV, and the significance level (P-value) of the association for each SNP site was calculated.

[0031] 2. Test Results: By analyzing the diarrheal symptoms of 218 Laiwu piglets infected with PEDV and... ABCD1 Association analysis of gene regions, in ABCD1 One gene was found to be significantly associated with diarrheal traits in piglets infected with PEDV within a 2kb region upstream and downstream of the gene. P＜0.05 The SNP sites of ) are shown in Table 2.

[0032] Table 2: SNP loci information associated with diarrheal traits in Laiwu pigs infected with PEDV Note: The physical location was determined based on Sscrofa11.1 (GCF_000003025.6) as the reference genome; A1 is the effect allele; F_A is the frequency of A1 in individuals with diarrhea; F_U is the frequency of A1 in individuals without diarrhea; A2 is the other alleles; CHISQ represents the chi-square statistic; OR represents the odds ratio of A1 alleles.

[0033] Analysis using the G allele as the effector allele showed that the frequency of the G allele in the diarrhea group was lower than that in the non-diarrhea group (26.67% vs 40.00%), with an odds ratio (OR) of 0.5455, suggesting that carrying the G allele can reduce the risk of diarrhea after PEDV infection.

[0034] Example 2: Design of SNP molecular markers and detection reagents related to diarrhea resistance in Laiwu pigs 1. Design of SNP molecular markers related to diarrhea resistance in Laiwu pigs: Based on the SNP sites screened in Example 1, this example designs an SNP molecular marker related to the antidiarrheal trait in pigs. Its nucleotide sequence is shown in SEQ ID NO.1. The 156th base from the 5' end of the sequence is an SNP site with a base polymorphism of A or G.

[0035] For boar individuals, the genotype at the SNP locus is hemizygous, carrying only one allele, A or G; among them, boar individuals carrying allele G exhibit resistance to PEDV infection.

[0036] 2. Design of detection reagents: A detection reagent was designed based on the above-mentioned SNP molecular markers. The detection reagent is a PCR sequencing kit, which includes primer pairs and PCR amplification reagents for detecting the above-mentioned SNP molecular markers.

[0037] Primer pairs were designed based on flanking sequences of the core SNP site, each extending approximately 500 bp upstream and downstream. Specific PCR primers were designed using Primer 5.0 software, adhering to strict principles: the amplified fragment length was controlled to be above 500 bp to ensure the target SNP site was located in the middle region of the amplified fragment; the primer Tm value was within the range of 63-65℃; and the primers were free of hairpin structures, primer dimers, and non-specific binding sites to ensure the specificity and effectiveness of PCR amplification. Their nucleotide sequences are shown in Table 3. Table 3: Primer pairs used for detecting molecular markers The PCR amplification reagents consist of: 12.5 μL of 2×Es Taq Master Mix, template DNA, and ddH2O.

[0038] Example 3: Application Verification 1. Test method: Twenty 28-day-old weaned piglets from Laiwu were selected as experimental subjects and challenged with the CV777 strain according to the method in Example 1. After challenge, the piglets were observed for 14 consecutive days, and their fecal condition was recorded daily according to the scoring criteria in Table 1. If a piglet scored 3 at any point during the observation period, it was defined as having a PEDV susceptibility trait; if the fecal score was ≤2 throughout the entire observation period, it was defined as having a PEDV resistance trait.

[0039] Genomic DNA was extracted from the experimental subjects (jejunal tissue extraction). The extracted genomic DNA was diluted to a concentration of 50 ng / μL, and a single sample or a mixed pool was used as template DNA. PCR amplification was performed using the detection primer pairs in Table 3 above. The amplification system was as follows: 12.5 μL of 2×Es Taq Master Mix, 1 μL each of primer 346-F (10 μmol / L) and primer 713-R (10 μmol / L), 1 μL of template DNA (50 ng / μL), and 9.5 μL of ddH2O.

[0040] The PCR amplification program was as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, annealing at 64℃ for 30 s; 72℃ extension for 22 s, 35 cycles; 72℃ final extension for 2 min.

[0041] The obtained PCR amplification products were subjected to agarose gel electrophoresis to observe whether the size of the electrophoretic bands was consistent with the expected size of the PCR amplification products. The PCR products that passed the gel imaging were sent to Sanger sequencing company for first-generation sequencing. The nucleotide sequences obtained from the sequencing were compared with the pig reference genome (Sscrofa11.1) to analyze the base polymorphism of the target SNP sites.

[0042] The diarrhea trait in weaned piglets was identified based on the base mutation type of the target SNP site in the sequencing results. If the sequencing result of the amplification product of the primer pair (346-F / 713-R) corresponds to the 156th base of the sequence shown in SEQ ID NO.1 as G, then the piglets were identified as having the PEDV resistance trait; if the sequencing result corresponds to the 156th base of the sequence shown in SEQ ID NO.1 as A, then the piglets were identified as having the PEDV susceptibility trait.

[0043] The results of the judgment on diarrhea traits based on actual fecal state were compared with the results based on molecular markers.

[0044] 2. Test Results: Gel electrophoresis image of the amplified fragment corresponding to the molecular marker is shown below. Figure 1 As shown; the bands are clear and without tails, meeting the experimental requirements. Sanger sequencing of the PCR amplification products at the target SNP site yielded clearly identifiable sequencing peaks. The results of pooled sequencing are shown below. Figure 2 As shown, this confirms that the SNP site does indeed exhibit A / G base polymorphism.

[0045] The fecal scoring results and molecular marker identification results of the experimental subjects are shown in Table 4.

[0046] Table 4: Results of Identification of Diarrhea Traits in Weaned Piglets The results showed that the identification results based on molecular markers were consistent with the actual diarrhea phenotype identification results, indicating that the molecular markers and detection reagents of the present invention can be used for screening Laiwu pigs with excellent resistance to PEDV infection and diarrhea traits. The prediction results are accurate and reliable.

[0047] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A SNP molecular marker associated with antidiarrheal properties in Laiwu pigs, characterized in that, The SNP molecular marker is located on the pig X chromosome. ABCD1 Genetically, its nucleotide sequence is shown in SEQ ID NO.

1. The 156th base from the 5' end of the sequence is an SNP site, and its base polymorphism is A or G.

2. The SNP molecular marker according to claim 1, characterized in that, Laiwu boars with a G base at the SNP site exhibit higher resistance to PEDV than Laiwu boars with an A base at the SNP site.

3. The application of the SNP molecular marker according to claim 1 in either (1) or (2): (1) Preparation of reagents for identifying the resistance of Laiwu pigs to PEDV infection; (2) Assisted selection breeding of Laiwu pigs resistant to PEDV infection.

4. A detection reagent, characterized in that, It comprises: a primer pair for detecting the SNP molecular marker of claim 1, the primer pair consisting of primer 346-F with a nucleotide sequence as shown in SEQ ID NO.2 and primer 713-R with a nucleotide sequence as shown in SEQ ID NO.

3.

5. The detection reagent according to claim 4, characterized in that, The detection reagent is a PCR sequencing kit.

6. The use of the detection reagent according to claim 4 in either (1) or (2): (1) Preparation of reagents for identifying the resistance of Laiwu pigs to PEDV infection; (2) Assisted selection breeding of Laiwu pigs resistant to PEDV infection.

7. The application according to claim 6, characterized in that, The sequencing results of the amplified product obtained using the detection reagent correspond to Laiwu boars with G at position 156 of the sequence shown in SEQ ID NO.1, and their resistance to PEDV is higher than that of Laiwu boars with A at position 156 of the sequence shown in SEQ ID NO.

1.

8. The application according to claim 7, characterized in that, The amplification system consisted of: 12.5 μL of 2×Es Taq Master Mix, 1 μL each of primer 346-F and primer 713-R, 1 μL of template DNA, and 9.5 μL of ddH2O.

Images