A loc106509506 gene molecular marker related to pig litter size trait, a detection kit and application thereof

Abstract

The application discloses a LOC106509506 gene molecular marker related to a pig litter size character, a detection kit and application thereof, and belongs to the technical field of molecular genetics. The application finds a single nucleotide polymorphism site significantly related to pig reproduction performance at a 103999688 site of a No. 2 chromosome of a pig reference genome Sscrofa11.1 through screening of pig whole genome genetic variation, namely a 2:103999688G>T site. The site is located in a LOC106509506 gene, and G / T allelic variation exists, wherein the T allele is significantly related to increase of pig total litter size and healthy piglet number, and can be used as an important molecular genetic marker for evaluation and improvement of pig reproduction performance.

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, specifically to a molecular marker, detection kit, and application of the LOC106509506 gene, which is associated with the pig litter size trait. Background Technology

[0002] Total litter size and number of healthy piglets are economic reproductive traits in pigs, directly impacting the economic benefits of pig farming. Pig litter size is a low-heritability quantitative trait (heritability approximately 0.1), regulated by a combination of minor genes and environmental factors. Traditional breeding relies on recording the litter size phenotype of female animals, resulting in a long selection cycle (typically 3-5 years). Furthermore, phenotypes are easily affected by environmental factors such as feeding management and disease, leading to slow genetic progress and making it difficult to meet the modern pig industry's demand for rapid development of high-fertility breeds.

[0003] Marker-assisted selection (MAS) overcomes the shortcomings of traditional phenotypic selection by directly selecting target traits at the DNA level, enabling precise early selection. Single nucleotide polymorphisms (SNPs) have become commonly used markers in molecular breeding due to their wide distribution in the genome and ease of genotyping. In recent years, genome-wide association studies (GWAS) have located multiple chromosomal regions associated with pig litter size, but they generally suffer from problems such as broad linkage disequilibrium regions, containing a large number of linkage sites, and difficulty in distinguishing true causal variations, leading to high false positive rates and unstable genetic effects of the developed markers. In addition, most reported litter size SNP markers only target a single trait such as total litter size or healthy piglet count, lacking loci with strong effects on both traits, thus limiting the efficiency of breeding applications.

[0004] The LOC106509506 gene is located in pigs ( Sus scrofa In the Sscrofa11.1 reference genome, LOC106509506 is a predicted gene obtained through genome annotation. Currently, the biological function, expression regulation mechanism, and role of the LOC106509506 gene in the formation of important economic traits in pigs remain unclear. Particularly in the field of pig reproductive trait research, there is a lack of reports on the association between genetic variations of the LOC106509506 gene and litter size in sows. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a molecular marker, detection kit, and application of the LOC106509506 gene related to the pig litter size trait.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a molecular marker for the LOC106509506 gene associated with the piglet litter size trait. The nucleotide sequence of the LOC106509506 gene molecular marker is shown in SEQ ID NO.1, and the 378th base from the 5' end of the sequence is an SNP site with a base polymorphism of G or T. Specifically, as follows: CTAAAGAGGGAAGGTTGTGTGGAGGGGTAAATTAGGAGCTTGGAATTAACATATATACACACTATATAAAATATATAATCAACAAGGCCCTGCTATATAGCACAGGGAGCTCAATATTCTGCAATAACCTATATGGGAAAAGATTTTAAATCGAATGGATATGTGTATATGTACAACTAAATTAC TGCATCCTTGAATGAAACAACATTGTAAATCAAGTATATTCCAATATTAAATTGGAAAAATAAAAAAGAATATCAAACAGTCACCACATTCTCTACTAAGCCAAAGCCTAATCCAGACCAAGGCCCTAACTCTTCAATTCTATGAAGGCCGAGAAAGGTGAAGCTGCAGAAGAAAATTTTAAGCTAGCA G / T AGATTGGTTTATGAGCCTTAGGGAAAGGAATCATTTTCATAAGAAAAGAACAAAGAGATGTAGGAAGTATTAACATGGAAGCTATACCAAGTTACCCAGAAGATCTAGCTAAAATAATTAATGAAGGTGCCTACACTAAACAGCAGATTTTCAATGTATACAAAAGAGCTTTATTTTTGAAGATGTCATCTAGGACTTTCAGAGCCTCAGAGGAATGAATTATCCTGCTTTCAGTGT (SEQ ID NO.1) Note: The nucleotides in bold italics in the sequence are SNP sites, which are represented in the sequence listing as the corresponding degenerate base "K".

[0007] The dominant allele associated with the SNP locus and the pig litter size trait is T. The total litter size and number of healthy piglets of the TT genotype are higher than those of the GG or TG genotypes.

[0008] This invention discovered a SNP locus (2:103999688G>T) at locus 103999688 on chromosome 2 of the pig reference genome Sscrofa11.1. This SNP locus is located within the LOC106509506 gene and exhibits G / T polymorphism, where T is a favorable allele variation for increasing the total number of piglets born and the number of healthy piglets.

[0009] In a second aspect, the present invention provides the application of the LOC106509506 gene molecular marker in the following (1) or (2): (1) To detect or assist in the detection of traits such as total number of piglets born and number of healthy piglets; (2) Pig genetics and breeding.

[0010] In the above applications, the pig genetic breeding refers to the selection of sows that simultaneously possess the traits of high total litter size and high number of healthy piglets.

[0011] A third aspect of the present invention provides a detection kit comprising: a primer pair for detecting the LOC106509506 gene molecular marker described above, wherein the primer pair consists of primer F shown in SEQ ID NO.2 and primer R shown in SEQ ID NO.3; specifically as follows: F: 5'-CTAAAGAGGGAAGGTTG-3' (SEQ ID NO.2) R: 5'-ACACTGAAAGCAGGATA-3' (SEQ ID NO.3) Furthermore, the detection kit also includes: PCR amplification reagents; the PCR amplification reagents include 2×Phanta Max buffer, dNTP mixture and Phanta Max Super-Fidelity DNA Polymerase.

[0012] Preferably, the detection kit is a PCR sequencing kit.

[0013] In a fourth aspect, the present invention provides the application of the above-described detection kit in (1) or (2) as follows: (1) To detect or assist in the detection of traits such as total number of piglets born and number of healthy piglets; (2) Pig genetics and breeding.

[0014] In the above applications, the methods for detecting or assisting in the detection of the traits of total litter size and number of healthy piglets are as follows: Using the genomic DNA of the pigs to be tested as a template, PCR amplification was performed using primer F shown in SEQ ID NO.2 and primer R shown in SEQ ID NO.3 to obtain amplification products; the amplification products were sequenced, and the total number of piglets born and the number of healthy piglets were identified based on the sequencing results.

[0015] Specifically, if the sequencing result of the amplified product corresponds to the TT genotype at position 378 of the sequence shown in SEQ ID NO.1, it is identified as having the traits of high total litter size and high number of healthy offspring.

[0016] Preferably, the PCR amplification system is as follows: 12.5 μL of 2×PhantaMax buffer, 0.5 μL of dNTP mixture (10 mMeach), 0.5 μL of PhantaMax high-fidelity DNA polymerase, 1 μL of DNA template, 1 μL each of primer F and primer R, 8.5 μL of ddH2O, for a total of 25 μL.

[0017] The PCR amplification conditions were: 94℃, 2 min; 94℃, 30 sec, 46℃, 30 sec, 72℃, 37 sec (extension program 60 s / kb) for 35 cycles; 72℃, 2 min.

[0018] The beneficial effects of this invention are: This invention, through screening for genetic variations across the entire pig genome, identified a single nucleotide polymorphism (SNP) at locus 103999688 on chromosome 2 of the pig reference genome Sscrofa11.1, specifically the 2:103999688G>T locus, which is significantly associated with pig reproductive performance. This locus is located within the LOC106509506 gene and exhibits G / T allele variation. The T allele is significantly correlated with increased total litter size and healthy piglet count, making it an important molecular genetic marker for evaluating and improving pig reproductive performance.

[0019] By detecting the genotypes at the aforementioned SNP loci in candidate breeding pigs, their potential reproductive capacity can be predicted before they reach reproductive age. Individuals carrying the T allele can be prioritized for breeding and propagation, thereby reducing the time cost of long-term phenotypic testing in traditional breeding and improving the efficiency of genetic improvement. This has significant application value for developing new high-reproductive-performance pig breeds and promoting efficient breeding in the pig industry. Attached Figure Description

[0020] Figure 1 : GWAS Manhattan plot and QQ plot of total piglets produced by Large White pigs; in the plot, A is the GWAS Manhattan plot and B is the QQ plot.

[0021] Figure 2: GWAS Manhattan diagram and QQ diagram of the large white pig Jianzai; in the diagram, A is the GWAS Manhattan diagram and B is the QQ diagram.

[0022] Figure 3 : Local Manhattan plot of chromosome 2 of total litter size in Large White pigs and distribution of PIP values ​​for fine SuSiE localization in the target interval; In the figure, A is the local Manhattan plot of chromosome 2 of total litter size in Large White pigs, and B is the distribution of PIP values ​​for fine SuSiE localization in the target interval.

[0023] Figure 4 : Local Manhattan plot of chromosome 2 of healthy piglets in Large White pigs and distribution of PIP values ​​for fine SuSiE localization in the target region; In the figure, A is the local Manhattan plot of chromosome 2 of healthy piglets in Large White pigs, and B is the distribution of PIP values ​​for fine SuSiE localization in the target region.

[0024] Figure 5 Bar chart comparing the differences in total litter size and number of healthy piglets among different Large White pig genotypes; in the figure, A represents total litter size and B represents number of healthy piglets; ** indicates P < 0.01, *** indicates P < 0.001.

[0025] Figure 6 Gel electrophoresis image of the amplified fragment corresponding to the LOC106509506 gene molecular marker; in the figure, M: Marker, lanes 1-2 represent duplicate samples.

[0026] Figure 7 Sanger sequencing results of the SNP site (2:103999688G>T). Detailed Implementation

[0027] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0028] As mentioned earlier, most of the reported SNP markers for litter size only target a single trait such as total litter size or healthy offspring size, lacking loci that have a strong effect on both traits, thus limiting their efficiency in breeding applications.

[0029] Therefore, this invention obtains all high-quality SNPs in the pig genome by performing whole-genome resequencing on pig genomic DNA and comparing the resequencing data with the pig reference genome Sscrofa11.1. SuSiE (Sum of Single Effects) Bayesian fine mapping is a statistical method that can accurately identify causal variation sets from complex linkage regions. By finely mapping core association regions and screening for sites with high posterior inclusion probability (PIP), the false positive problem of conventional GWAS can be effectively solved, and truly reliable functional causal sites can be obtained. By analyzing the correlation between each site and the traits of total litter size and number of healthy piglets, a gene molecular marker LOC106509506 associated with the traits of total litter size and number of healthy piglets was obtained. The SNP molecular marker is located at the base position 103999688 on chromosome 2 in the pig reference genome Sscrofa11.1. The SNP site of this molecular marker has G / T polymorphism, where T is the favorable allele variation of the traits of total litter size and number of healthy piglets.

[0030] Based on this SNP site, the present invention designed a gene molecular marker LOC106509506 associated with the pig litter size trait. The nucleotide sequence of the LOC106509506 gene molecular marker is shown in SEQ ID NO.1. The 378th base from the 5' end of the sequence is an SNP site with a base polymorphism of G or T.

[0031] This invention provides materials for detecting the molecular marker of the porcine LOC106509506 gene, including PCR primers for amplifying genomic DNA fragments including the SNP site of the molecular marker, or a kit containing the primers. The primers used to amplify the SNP molecular marker of this invention are as follows: Upstream primer F: 5'-CTAAAGAGGGAAGGTTG-3' (SEQ ID NO.2); Downstream primer R: 5'-ACACTGAAAGCAGGATA-3' (SEQ ID NO.3).

[0032] The kit also includes PCR amplification reagents.

[0033] In this invention, the PCR amplification reagent can be a high-fidelity DNA polymerase system, which has high-fidelity amplification capability.

[0034] In this invention, the PCR amplification reagent can also be 2×Taq Master Mix (Dye). 2×Taq Master Mix (Dye) is prepared by pre-mixing Taq DNA polymerase, dNTP mixture, MgCl2 and reaction buffer into a mixture of 2 times concentration and then optimizing the ratio. It has good amplification efficiency and high detection sensitivity.

[0035] The above-described primer set was used to amplify porcine genomic DNA by PCR. As one implementation method, the PCR amplification program was 94°C for 2 min; 94°C for 30 sec, 46°C for 30 sec, 72°C for 37 sec (extension program 60 s / kb) for 35 cycles; 72°C for 2 min. The obtained amplified products were sequenced to detect the genotype of the 2:103999688G>T locus.

[0036] The criteria for judging the quality of a pig's total litter size and number of healthy piglets are as follows: If the genotype at the 2:103999688G>T locus is TT, the pig will have a high total litter size and a high number of healthy piglets. If the genotype at the 2:103999688G>T locus is TG, the total number of piglets born and the number of healthy piglets are moderate. If the genotype of the 2:103999688G>T locus is GG, the pig will have a low total number of piglets and a low number of healthy piglets.

[0037] This invention does not specifically limit the sequencing method; any sequencing method known in the art can be used. In this embodiment, Sanger sequencing is used to determine the amplified DNA sequence. As one implementation, the DNA sequencing is performed by a commercial company, with both forward and reverse sequencing of the gene fragments. This invention determines the quality of the total litter size and healthy piglet count traits in pigs based on the base type at position 378 from the 5' end of the sequence, thereby enabling the detection and optimization of the total litter size and healthy piglet count traits through genetic breeding.

[0038] The LOC106509506 gene molecular marker of the present invention can be applied to association analysis of genotypes related to total litter size and number of healthy piglets or traits related to total litter size and number of healthy piglets, providing a new molecular marker resource for marker-assisted selection of pig reproductive performance.

[0039] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0040] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions.

[0041] Example 1: Screening of SNP loci associated with piglet number traits 1. Test method: (1) Selection of test subjects 3,367 healthy Large White sows raised by Heze Hongxing Original Breeding Pig Co., Ltd., Shandong Yisheng Livestock and Poultry Co., Ltd., and Heilongjiang Yisheng Poultry Co., Ltd. were selected as the experimental group. The total number of piglets born and the number of healthy piglets (i.e., the number of live piglets) of each sow in each parity were recorded in detail. Phenotypic quality control standards: The total number of piglets per litter is controlled between 4 and 30, the number of healthy piglets does not exceed the total number of piglets in the corresponding litter, individuals with extreme phenotypic abnormalities are removed, and the number of pigs retained is 3357.

[0042] (2) Genomic DNA extraction Ear tissue samples were collected from individual test subjects using ear-tweezers and placed in 1.5 mL centrifuge tubes containing 75% alcohol. The samples were then stored at -20°C. Genomic DNA was extracted from the tissue using a commercially available genomic DNA extraction kit. After extraction, quality control was performed using NanoDrop, Qubit, and 1% agarose gel electrophoresis. Qualified DNA samples were stored at -20°C for library construction and sequencing. DNA quality criteria included: A260 / A280 of 1.8-2.0, intact and undegraded electrophoretic bands, and a total amount sufficient for sequencing library construction.

[0043] (3) Quality control of whole genome resequencing and SNP detection A 1× low-depth resequencing strategy was adopted. Sequencing libraries were constructed using the GenoBaits® DNA Library Prep Kit. After the libraries passed quality control, they were sequenced using the MGI-2000 / MGI-T7 sequencing platform in PE15 mode. The raw sequencing data were output and saved in fastq format.

[0044] Raw sequencing reads were filtered using FastP / 0.23.4 software: sequencing adapter sequences were removed, and low-quality bases were eliminated. After filtering, the minimum quality of Q20 was 97.54% and the maximum was 99.34%, and the minimum quality of Q30 was 92.11% and the maximum was 97.37%, resulting in high-quality clean data.

[0045] The clean data were aligned with the pig Sscrofa11.1 reference genome using the mem module of BWA / 0.7.19 software; SAM files were generated and sorted using samtools / 1.21; sequencing coverage indicators of the b files were analyzed using qualimap software; PCR repeats were labeled using GATK4.2.6.1; and preliminary SNP typing of the population was completed using BaseVar / 2 software.

[0046] The missing genotypes were filled using Beagle / 5.5 software, and then multi-level SNP quality control was performed using Plink / 1.9: the deletion rate of the eliminated sites was >10%, the minimum allele frequency was <0.05, the Hardy-Weinberg equilibrium test P <1×10-6 variation was performed, and only biallelic SNPs were retained; subsequently, linkage disequilibrium pruning was performed based on a window of 100kb, a step size of 50 SNPs, and an r² threshold of 0.2 to obtain a high-quality SNP dataset for GWAS analysis.

[0047] (4) GWAS genome-wide association analysis A linear mixture model of MLM was constructed to correct for confounding factors such as batch size, parity, and kinship. Association tests were conducted on the total number of offspring and the number of healthy offspring, and the P_WALD test values ​​of each SNP locus were output. GWAS Manhattan plots and QQ plots of the two traits were plotted.

[0048] (5) Target interval extraction and SuSiE Bayesian fine localization Based on the significance results of GWAS, a unified candidate region division was performed by extending 1 Mb upstream and downstream from the representative loci that reached the significance threshold. The PIP posterior probabilities for each point of the total litter size and healthy offspring traits were output, and the PIP distribution map was plotted.

[0049] (6) Association analysis of different genotypes of significant SNPs with total litter size and number of healthy offspring Python software was used to statistically analyze the genotypes and genotype frequencies at significant SNP loci, and their association with total litter size and number of healthy offspring was performed. SPSS 26.0 one-way ANOVA was used to test differences between groups. Statistical indicators were expressed as mean ± standard deviation. * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001. R software was used to create bar charts comparing litter performance of different genotypes.

[0050] 2. Test Results: The GWAS Manhattan plot and QQ plot for the total litter size trait are shown in Figure 1; the GWAS Manhattan plot and QQ plot for the live litter size trait are shown in Figure 2. The results indicate that the 103 Mb region on chromosome 2 is a potentially shared and significantly associated region for both traits.

[0051] Based on the significance results of GWAS, a unified candidate region division was performed by extending 1 Mb upstream and downstream from the representative loci that reached the significance threshold. The posterior probability of PIP (Positive Incidence Percentage) for each point in the total litter size and healthy offspring traits was output, and a PIP distribution map was plotted. Figure 3 , Figure 4 Fine mapping results showed that the PIP value at site 2:103999688 was close to 1. Gene annotation results indicated that this site was located 176135 bp upstream of the transcription start site of the LOC106509506 gene.

[0052] The association analysis results between different genotypes at locus 2:103999688 and total litter size and healthy offspring traits are shown in Table 1 and... Figure 5 As shown.

[0053] Table 1: Association analysis results of different genotypes of significant SNPs with total litter size and number of healthy offspring. The results showed that there was a significant allele dosage effect at the 2:103999688G>T locus. The TT genotype had the best total litter size and healthy offspring performance, followed by the TG genotype, and the GG genotype had the lowest performance. The differences between the TT and TG genotypes and the GG genotype were extremely significant. T was a favorable allele variant for increasing total litter size and healthy offspring number.

[0054] Example 2: Design and application validation of molecular markers and detection kits for the LOC106509506 gene associated with piglet number traits. 1. Design of molecular markers and detection kits for the LOC106509506 gene, which is associated with the piglet litter size trait: Based on the 2:103999688G>T site screened in Example 1, this example designs a gene molecular marker LOC106509506 associated with the pig litter size trait. Its nucleotide sequence is shown in SEQ ID NO.1. The 378th base from the 5' end of the sequence is an SNP site with a base polymorphism of G or T.

[0055] A detection kit was designed based on the LOC106509506 gene molecular marker. The detection kit is a PCR sequencing kit, comprising: primer pairs and PCR amplification reagents for detecting the LOC106509506 gene molecular marker; wherein: The primer pair consists of primer F shown in SEQ ID NO.2 and primer R shown in SEQ ID NO.3; as detailed below: F: 5'-CTAAAGAGGGAAGGTTG-3' (SEQ ID NO.2) R: 5'-ACACTGAAAGCAGGATA-3' (SEQ ID NO.3) The PCR amplification reagents include 2×PhantaMax buffer, dNTP mixture, and PhantaMax high-fidelity DNA polymerase.

[0056] 2. Application Validation Another 30 different Large White sows were selected, and the total number of piglets born in each litter and the number of healthy piglets were recorded. DNA was extracted from ear tissues and PCR amplification and sequencing verification were carried out using the above-mentioned detection kit.

[0057] The PCR amplification system consisted of: 12.5 μL of 2×PhantaMax buffer, 0.5 μL of mixture (10 mM each), 0.5 μL of PhantaMax high-fidelity DNA polymerase, 1 μL of DNA template, 1 μL each of primer F and primer R, and 8.5 μL of ddH2O, for a total of 25 μL.

[0058] The PCR amplification conditions were: 94℃, 2 min; 94℃, 30 sec, 46℃, 30 sec, 72℃, 37 sec (extension program 60 s / kb) for 35 cycles; 72℃, 2 min.

[0059] The amplified products were screened by 1.2% agarose gel electrophoresis to select samples with single bright bands, and bidirectional sequencing was performed by a biotechnology company. The sequencing peak diagram was compared with the pig Sscrofa11.1 reference genome sequence to determine the genotype of the samples.

[0060] The total litter size and number of healthy offspring traits were identified based on the base mutation type of the target SNP site in the sequencing results. If the sequencing result of the amplified product corresponds to the TT genotype at the 378th base of the sequence shown in SEQ ID NO.1, it is identified as having the traits of a large total litter size and number of healthy offspring; its total litter size and number of healthy offspring are greater than those of the GG or TG genotypes.

[0061] The identification results based on molecular markers are compared with the actual total litter size and number of healthy piglets recorded. If the results are consistent, it indicates that the SNP molecular markers and detection kit of the present invention can be used for screening pig breeds with multiple traits such as total litter size and number of healthy piglets.

[0062] The results showed that the PCR products were bright, with single bands, and no non-specific amplification. Figure 6 The actual PCR product size was consistent with the expected PCR amplification product, allowing for direct sequencing of subsequent PCR products. The Sanger sequencing results for the 2:103999688G>T site are as follows: Figure 7 As shown.

[0063] The molecular marker identification results were completely consistent with the actual total litter size and healthy litter size records, indicating that the LOC106509506 gene molecular marker and detection kit of the present invention can be used for the identification of total litter size and healthy litter size traits, and the identification results are accurate and reliable.

[0064] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A molecular marker for the LOC106509506 gene associated with the piglet litter size trait, characterized in that, The nucleotide sequence of the LOC106509506 gene molecular marker is shown in SEQ ID NO.

1. The 378th base from the 5' end of the sequence is an SNP site, and its base polymorphism is G or T.

2. The LOC106509506 gene molecular marker according to claim 1, characterized in that, The dominant allele associated with the SNP locus and the pig litter size trait is T. The total litter size and number of healthy piglets of the TT genotype are higher than those of the GG or TG genotypes.

3. The application of the LOC106509506 gene molecular marker according to claim 1 in the following (1) or (2): (1) To detect or assist in the detection of traits such as total number of piglets born and number of healthy piglets; (2) Pig genetics and breeding.

4. The application according to claim 3, characterized in that, The pig genetic breeding refers to the selection of sows that simultaneously possess the traits of high total litter size and high number of healthy piglets.

5. A test kit, characterized in that, It comprises: a primer pair for detecting the LOC106509506 gene molecular marker as described in claim 1 or 2, said primer pair consisting of primer F shown in SEQ ID NO. 2 and primer R shown in SEQ ID NO.

3.

6. The detection kit according to claim 5, characterized in that, The detection kit also includes: PCR amplification reagents; the PCR amplification reagents include 2×PhantaMax buffer, dNTP mixture and PhantaMax high-fidelity DNA polymerase.

7. The detection kit according to claim 5, characterized in that, The detection kit is a PCR sequencing kit.

8. The use of the test kit according to any one of claims 5-7 in the following (1) or (2): (1) To detect or assist in the detection of traits such as total number of piglets born and number of healthy piglets; (2) Pig genetics and breeding.

9. The application according to claim 8, characterized in that, The methods for detecting or assisting in the detection of the traits of total litter size and number of healthy piglets are as follows: Using the genomic DNA of the pigs to be tested as a template, PCR amplification was performed using primer F shown in SEQ ID NO.2 and primer R shown in SEQ ID NO.3 to obtain amplification products; the amplification products were sequenced, and the total number of piglets born and the number of healthy piglets were identified based on the sequencing results. If the sequencing result of the amplified product corresponds to the TT genotype at the 378th base of the sequence shown in SEQ ID NO.1, then it is identified as having the traits of high total litter size and high number of healthy offspring.

Images