Method for detecting bordetella

Abstract

The present invention relates to methods for detecting Bordetella, and in particular provides methods for determining whether a patient exhibiting pertussis-like symptoms would benefit from treatment with a therapeutic agent that inhibits Bordetella holmesii. The methods are based on detecting Bordetella pertussis, Bordetella parapertussis, and Bordetella holmesii in a biological sample by assaying for the presence of IS481, IS1001, and hIS1001 target repeat elements, respectively. The invention also provides kits for performing the methods.

Description

[0001] This invention application is a divisional application of the invention patent application filed on March 23, 2017, with application number 201780031481.4 (international application number PCT / US2017 / 023735) entitled "Method for detecting Bordetella spp.".

[0002] Cross-references to related applications

[0003] This application claims the benefit and priority of U.S. Application No. 62 / 312,883, filed March 24, 2016, the contents of which are incorporated herein by reference in their entirety. Technical Field

[0004] This disclosure provides methods for determining whether patients exhibiting pertussis-like symptoms benefit from treatment with agents that inhibit Bordetella holmesii. These methods are based on detecting Bordetella pertussis, Bordetella parapertussis, and Bordetella holmesii in biological samples by determining the presence of IS481, IS1001, and hIS1001 targeting repeat sequences. Kits for carrying out said methods are also provided. Background Technology

[0005] The following description of the background of this disclosure is provided only to help the reader understand this disclosure, and does not acknowledge any prior art described or constituting this disclosure.

[0006] Bordetella pertussis and Bordetella parapertussis commonly cause pertussis, a highly contagious and acute respiratory illness, in humans. Hoppe JE., Pediatr Infect Dis J. 18:375-81 (1999); Mattoo et al., Clin. Microbiol. Rev., 18: 326-382 (2005). Symptoms of pertussis include attacks of severe coughing accompanied by inspiratory coughing and sometimes vomiting. In extreme cases, pertussis symptoms can lead to hypoxia, permanent brain damage, or even death. In some cases, Bordetella bronchiseptica and Bordetella hominis infections can cause pertussis-like symptoms.

[0007] Early diagnosis of pertussis can be difficult, especially because its symptoms resemble those observed in other common respiratory illnesses such as bronchitis, the common cold, or influenza. Traditionally, bacterial cultures have been used to definitively diagnose pertussis. Mucus is collected from the patient's nose and / or throat and sent to a medical laboratory for culture. While a positive result is considered definitive, cultures of *Bordeaux* species typically take 5 to 7 days to yield a diagnosis. Due to the harsh nature of this bacterium, *Bordeaux* bacterial cultures are also prone to false positives.

[0008] Antibody assays (including ELISA) are also used to diagnose Bordetella species by detecting characteristic bacterial antigens. Most commonly, the detection of pertussis toxin protein serves as an indicator of Bordetella infection. While these antibody-based assays have good sensitivity and specificity, they typically require a blood sample from the patient, rather than a non-invasively obtained mucus sample, and require the infection to be in the early and / or recovery phase. These assays may produce false negative results if a patient sample is not obtained within the appropriate time window during disease progression. Other methods for detecting Bordetella infection include direct fluorescent antibody (DFA) tests, which are limited by a lack of sensitivity.

[0009] Therefore, there is a great need for more robust and sensitive methods that can rapidly detect and differentiate multiple related Bordetella species (such as Bordetella pertussis, Bordetella parapertussis, and Bordetella hominis) in a single biological sample. Summary of the Invention

[0010] This disclosure provides compositions and methods for detecting and differentiating multiple related pathogenic Bordetella species (i.e., Bordetella pertussis, Bordetella parapertussis, and Bordetella hominis) in biological samples. In another aspect, the methods and compositions of this technology are useful in selecting the optimal treatment regimen for subjects exhibiting pertussis-like symptoms. The methods disclosed herein are intended to allow for rapid, sensitive, and simultaneous detection of one or more target nucleic acid sequences corresponding to multiple copy insertion sequences (IS) of IS481, IS1001, and hIS1001. The detection of IS481, IS1001, and hIS1001 repeat elements in biological samples is useful in determining the presence of Bordetella pertussis, Bordetella parapertussis, and Bordetella hominis, respectively. In some implementations, the treatment regimen includes one or more of the following: fluoroquinolones, carbapenems, trimethoprim-sulfamethoxazole, Bordetella hominis-specific antibodies, whole-cell (wP) Bordetella pertussis vaccine, acellular Bordetella pertussis vaccine, telithromycin, and macrolide antibiotics. The method of this technique can be performed on untreated biological samples, resulting in a direct, streamlined sample-to-result process.

[0011] Therefore, in one aspect, this disclosure provides a method for detecting the presence of at least one pathogenic Bordetella species in a biological sample, comprising: (a) contacting the biological sample with: (i) a first primer pair amplifying the IS481 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence; (ii) a second primer pair amplifying the IS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence; and (iii) a third primer pair amplifying the hIS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence; and (iii) a third primer pair amplifying the hIS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence; and (iv) a third primer pair amplifying the hIS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence; and (v) a third primer pair amplifying the hIS1001 target nucleic acid ... 3 or its complementary sequence being at least 85-95% identical nucleotides; generating a reaction-sample mixture in which amplification of the target nucleic acids IS481, IS1001, and hIS1001 (if present in the biological sample) occurs without extracting the target nucleic acids from the biological sample; (b) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to produce a fluorescent signal; (c) detecting the fluorescent signal generated by the amplified target nucleic acids produced in step (b); and (d) detecting the presence of at least one pathogenic Bordetella species in the biological sample by evaluating the fluorescent signal of each target nucleic acid, thereby (i) detecting Bordetella holmesii in the biological sample when a fluorescent signal against the hIS1001 target nucleic acid is detected; and (ii) detecting Bordetella parapertussis in the biological sample when a fluorescent signal against the IS1001 target nucleic acid is detected. (iii) When a fluorescent signal for the IS481 target nucleic acid is detected and no fluorescent signal for the hIS1001 target nucleic acid is detected, *B. pertussis* is detected in the biological sample, wherein the pathogenic *B. pertussis* species is one or more of *B. pertussis*, *B. parapertussis*, and *B. hominis*; and wherein the biological sample is not subjected to extraction or purification steps prior to amplification. Real-time PCR amplification can be performed in a direct amplification tray in conjunction with an integrated thermal cycler. The biological sample may include nasopharyngeal (NP) aspirates or washes, nasal swabs, or bacterial isolates.

[0012] Before contact with biological samples, all primer pairs may be included together in the amplification master mixture, which further includes DNA polymers, dNTPs, and PCR buffer. Additionally, the amplification master mixture may further include a fourth primer pair that specifically hybridizes to the control target nucleic acid under stringent conditions.

[0013] The biological sample can be contacted individually or simultaneously with one or more of these primer pairs. This contact occurs simultaneously (i.e., multiplexing), where one or more of the first, second, and third primer pairs contact the biological sample and interact with each other to amplify the target nucleic acid sequence.

[0014] In some embodiments of the method, the first primer pair consists of a first forward primer comprising 5' CCATAAGCATGCCCGATT 3' (SEQ ID NO: 11) and a first reverse primer comprising 5' CGCTTCAGGCACACAAACT 3' (SEQ ID NO: 10). Alternatively, in some embodiments, the second primer pair consists of a second forward primer comprising 5' CGGCTCGACGAATTGC 3' (SEQ ID NO: 7) and a second reverse primer comprising 5' AGTTCGTCACGCAGGACAT 3' (SEQ ID NO: 8). In any of the above embodiments, the third primer pair consists of a third forward primer comprising 5' GGCACGGATCGAGGTTTTT 3' (SEQ ID NO: 4) and a third reverse primer comprising 5' TACGGCCGTGAAGTGATAGA 3' (SEQ ID NO: 5).

[0015] Optionally, a control nucleic acid and a fourth primer pair complementary to a segment of the control nucleic acid may be included in the amplification mixture. In some embodiments, the control nucleic acid includes SEQ ID NO: 13. In some embodiments, the fourth primer pair consists of a fourth forward primer comprising 5' GCTTCAGTACCTTCGGCTTG 3' (SEQ ID NO: 17) and a fourth reverse primer comprising 5'TTGCAGGCATCTCTGACAAC 3' (SEQ ID NO: 18) to generate the control target nucleic acid of SEQ ID NO: 20.

[0016] In some embodiments, the method further includes contacting the biological sample with a first nucleic acid probe capable of specifically hybridizing to a segment of the IS481 target nucleic acid of SEQ ID NO: 1, wherein the first nucleic acid probe is detectably labeled and includes 5'TCAATTGCTGGACCATTTCGAGTCGAC 3' (SEQ ID NO: 12). Alternatively, in some embodiments, the method further includes contacting the biological sample with a second nucleic acid probe capable of specifically hybridizing to a segment of the complement of the IS1001 target nucleic acid of SEQ ID NO: 2, wherein the second nucleic acid probe is detectably labeled and includes 5'CAACCAGCCGCTGCTGACGGTC 3' (SEQ ID NO: 9). Alternatively, in some embodiments, the method further includes contacting the biological sample with a third nucleic acid probe capable of specifically hybridizing to a segment of the hIS1001 target nucleic acid of SEQ ID NO: 3, wherein the third nucleic acid probe is detectably labeled and includes 5'AGTCGCTGGCTACTGCTGCGCA 3' (SEQ ID NO: 6).

[0017] In some embodiments of this method, the first nucleic acid probe is labeled with a FAM fluorophore, the second nucleic acid probe is labeled with a CRF610 fluorophore, and the third nucleic acid probe is labeled with a JOE fluorophore.

[0018] In any of the above embodiments, the method further includes contacting the biological sample with a fourth nucleic acid probe, wherein the fourth nucleic acid probe is detectably labeled and comprises 5' TGGCTCTTGGCGGTCCAGATG 3' (SEQ ID NO:19). In some embodiments, the fourth nucleic acid probe is detectably labeled with a Q670 fluorophore.

[0019] On the other hand, this disclosure provides a method for selecting patients exhibiting pertussis-like symptoms to treat with a therapeutic agent inhibiting *Bordeza hominis*, comprising: (a) contacting a biological sample obtained from the patient with: (i) a first primer pair amplifying the IS481 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence; (ii) a second primer pair amplifying the IS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence; and (iii) a third primer pair amplifying the hIS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence; and (iii) a third primer pair amplifying the hIS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence; and (iv) a third primer pair amplifying the hIS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence; and (v) a third primer pair amplifying the hIS1001 target nucleic acid ... 3. Nucleotides that are at least 85-95% identical to the complementary sequence of the biological sample; (b) generating a reaction-sample mixture in which amplification of the target nucleic acids IS481, IS1001, and hIS1001 (if present in the biological sample) occurs without extracting the target nucleic acids from the biological sample; (c) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to produce a fluorescent signal; (d) detecting the fluorescent signal generated by the amplified target nucleic acids produced in step (b); and (e) if a fluorescent signal against the hIS1001 target nucleic acid is detected, selecting a patient to be treated with a therapeutic agent that inhibits Bordetella hominis, wherein the biological sample is not subjected to extraction or purification steps prior to amplification. In some embodiments, real-time PCR amplification is performed in a direct amplification disk in conjunction with an integrated thermal cycler. The biological sample may include nasopharyngeal (NP) aspirates or washes, nasal swabs, or bacterial isolates.

[0020] In some embodiments of the method, the first primer pair consists of a first forward primer comprising 5' CCATAAGCATGCCCGATT 3' (SEQ ID NO: 11) and a first reverse primer comprising 5' CGCTTCAGGCACACAAACT 3' (SEQ ID NO: 10). Additionally or alternatively, in some embodiments, the second primer pair consists of a second forward primer comprising 5' CGGCTCGACGAATTGC 3' (SEQ ID NO: 7) and a second reverse primer comprising 5' AGTTCGTCACGCAGGACAT 3' (SEQ ID NO: 8). In any of the above embodiments, the third primer pair consists of a third forward primer comprising 5' GGCACGGATCGAGGTTTTT 3' (SEQ ID NO: 4) and a third reverse primer comprising 5' TACGGCCGTGAAGTGATAGA 3' (SEQ ID NO: 5).

[0021] Optionally, a control nucleic acid and a fourth primer pair complementary to a segment of the control nucleic acid may be included in the amplification mixture. In some embodiments, the control nucleic acid includes SEQ ID NO: 13. In some embodiments, the fourth primer pair consists of a fourth forward primer comprising 5' GCTTCAGTACCTTCGGCTTG 3' (SEQ ID NO: 17) and a fourth reverse primer comprising 5'TTGCAGGCATCTCTGACAAC 3' (SEQ ID NO: 18) to generate the control target nucleic acid of SEQ ID NO: 20.

[0022] In some embodiments, the method further includes contacting the biological sample with a first nucleic acid probe capable of specifically hybridizing to a segment of the IS481 target nucleic acid of SEQ ID NO: 1, wherein the first nucleic acid probe is detectably labeled and includes 5'TCAATTGCTGGACCATTTCGAGTCGAC 3' (SEQ ID NO: 12). Alternatively, in some embodiments, the method further includes contacting the biological sample with a second nucleic acid probe capable of specifically hybridizing to a segment of the complement of the IS1001 target nucleic acid probe of SEQ ID NO: 2, wherein the second nucleic acid probe is detectably labeled and includes 5'CAACCAGCCGCTGCTGACGGTC 3' (SEQ ID NO: 9). Alternatively, in some embodiments, the method further includes contacting the biological sample with a third nucleic acid probe capable of specifically hybridizing to a segment of the hIS1001 target nucleic acid of SEQ ID NO: 3, wherein the third nucleic acid probe is detectably labeled and includes 5'AGTCGCTGGCTACTGCTGCGCA 3' (SEQ ID NO: 6).

[0023] In some embodiments of this method, the first nucleic acid probe is labeled with FAM fluorophore detection, the second nucleic acid probe is labeled with CFR610 fluorophore detection, and the third nucleic acid probe is labeled with JOE fluorophore detection.

[0024] In any of the above embodiments, the method further includes contacting the biological sample with a fourth nucleic acid probe, wherein the fourth nucleic acid probe is detectably labeled and comprises 5' TGGCTCTTGGCGGTCCAGATG 3' (SEQ ID NO:19). In some embodiments, the fourth nucleic acid probe is detectably labeled with a Q670 fluorophore.

[0025] In some embodiments, the therapeutic agent for inhibiting *Bordeza hominis* is one or more agents selected from the group consisting of fluoroquinolones, carbapenems, trimethoprim-sulfamethoxazole, and *Bordeza hominis*-specific antibodies. In some embodiments, the fluoroquinolone is selected from the group consisting of ciprofloxacin, gemifloxacin, levofloxacin, norfloxacin, ofloxacin, rovafloxacin, gatifloxacin, grepafloxacin, temafloxacin, lomefloxacin, sparfloxacin, enoxacin, and moxifloxacin. In some embodiments, the carbapenem is selected from the group consisting of: imipenem, meropenem, ertapenem, doripenem, panipenem, biapenem, razupenem (PZ-601), tebipenem, lenapenem, tomopenem, and thienpenem (Thienamycin).

[0026] In one aspect, this disclosure provides a method for selecting patients exhibiting pertussis-like symptoms to be treated with a *Bordeza hominis*-specific antibody and an additional therapeutic agent inhibiting *Bordeza parapertussis*, comprising: (a) contacting a biological sample obtained from the patient with: (i) a first primer pair amplifying the IS481 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence; (ii) a second primer pair amplifying the IS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence; and (iii) a third primer pair amplifying the hIS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence. 3. Nucleotides that are at least 85-95% identical to the complementary sequence of the biological sample; (b) generating a reaction-sample mixture in which the amplification of the target nucleic acids IS481, IS1001 and hIS1001 (if present in the biological sample) occurs without extracting the target nucleic acids from the biological sample; (c) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to produce a fluorescent signal; (d) detecting the fluorescent signal generated by the amplified target nucleic acids produced in step (b); and (e) if a fluorescent signal for the target nucleic acid hIS1001 and a fluorescent signal for the target nucleic acid IS1001 are detected, selecting the patient to be treated with Bordetella hominis specific antibodies and additional therapeutic agents, wherein the biological sample is not subjected to extraction or purification steps prior to amplification.

[0027] In some implementations, the additional therapeutic agent for inhibiting Bordetella parapertussis is one or more agents selected from the group consisting of: trimethoprim-sulfamethoxazole, ciprofloxacin, gemifloxacin, levofloxacin, norfloxacin, ofloxacin, trovafloxacin, gatifloxacin, grefloxacin, temfloxacin, lomifloxacin, sparfloxacin, enoxacin, and moxifloxacin.

[0028] In one aspect, this disclosure provides a method for selecting a patient exhibiting pertussis-like symptoms to be treated with a therapeutic agent inhibiting Bordetella pertussis and an additional therapeutic agent inhibiting Bordetella parapertussis, comprising: (a) contacting a biological sample obtained from the patient with: (i) a first primer pair for amplifying IS481, comprising nucleotides at least 85-95% identical to SEQ ID NO:1 or its complementary sequence; (ii) a second primer pair for amplifying IS1001, comprising nucleotides at least 85-95% identical to SEQ ID NO:2 or its complementary sequence; and (iii) a third primer pair for amplifying hIS1001, comprising nucleotides at least 85-95% identical to SEQ ID NO:2 or its complementary sequence; and (iii) amplifying a third primer pair for amplifying hIS1001, comprising nucleotides at least 85-95% identical to SEQ ID NO:2 or its complementary sequence; and (iii) amplifying a third primer pair for amplifying hIS1001, comprising nucleotides at least 85-95% identical to SEQ ID NO:2 or its complementary sequence; and (iv ... 3. Nucleotides that are at least 85-95% identical or complementary to the biological sample; (b) generating a reaction-sample mixture in which amplification of the target nucleic acids IS481, IS1001, and hIS1001 (if present in the biological sample) occurs without extracting the target nucleic acids from the biological sample; (c) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to produce a fluorescent signal; (d) detecting the fluorescent signal generated by the amplified target nucleic acids produced in step (b); and (e) if (i) a fluorescent signal for the target nucleic acid IS481 and a fluorescent signal for the target nucleic acid IS1001 are detected, and (ii) no fluorescent signal for the target nucleic acid hIS1001 is detected, then selecting the patient to be treated with a therapeutic agent for inhibiting Bordetella pertussis and an additional therapeutic agent for inhibiting Bordetella parapertussis, wherein the biological sample is not subjected to an extraction or purification step prior to amplification.

[0029] In some embodiments of the method, the additional therapeutic agent for inhibiting Bordetella parapertussis is one or more agents selected from the group consisting of: trimethoprim-sulfamethoxazole, ciprofloxacin, gemifloxacin, levofloxacin, norfloxacin, ofloxacin, trovafloxacin, gatifloxacin, grefloxacin, temafloxacin, lomifloxacin, sparfloxacin, enoxacin, and moxifloxacin.

[0030] In some embodiments of this method, the therapeutic agent inhibiting Bordetella pertussis is one or more agents selected from the group consisting of whole-cell (wP) Bordetella pertussis vaccine, acellular Bordetella pertussis vaccine, telithromycin, and macrolide antibiotics. In some embodiments, the macrolide antibiotic is selected from the group consisting of azithromycin (Zithromax), clarithromycin (Biaxin), erythromycin (E-Mycin, Eryc, Ery-Tab, PCE, Pediazole, Ilosone), and roxithromycin.

[0031] In another aspect, this disclosure provides a kit containing oligonucleotides, which may be primers or probes for performing amplification as described herein.

[0032] Specifically, the present invention includes, but is not limited to, the following:

[0033] 1. A method for detecting the presence of at least one pathogenic Bordetella species in a biological sample, comprising:

[0034] (a) Expose the biological sample to the following:

[0035] i. The first primer pair for amplifying the IS481 target nucleic acid, comprising at least 85-95% identical nucleotides to SEQ ID NO: 1 or its complementary sequence;

[0036] ii. A second primer pair for amplifying the IS1001 target nucleic acid, comprising at least 85-95% identical nucleotides to SEQ ID NO: 2 or its complementary sequence; and

[0037] iii. Amplify the third primer pair of the hIS1001 target nucleic acid, which includes at least 85-95% identical nucleotides to SEQ ID NO: 3 or its complementary sequence;

[0038] A reaction-sample mixture is generated in which the amplification of the target nucleic acids IS481, IS1001 and hIS1001 (if they are present in the biological sample) occurs without extracting the target nucleic acids from the biological sample.

[0039] (b) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to generate fluorescence signals;

[0040] (c) Detect the fluorescence signal generated by each amplified target nucleic acid produced in step (b); and

[0041] (d) The presence of at least one pathogenic Bordetella species in the biological sample was detected by evaluating the fluorescence signal of each target nucleic acid.

[0042] i. When a fluorescent signal targeting the hIS1001 target nucleic acid was detected, *B. holmesii* was detected in the biological sample;

[0043] ii. When a fluorescent signal targeting the IS1001 nucleic acid was detected, *B. parapertussis* was detected in the biological sample; and

[0044] iii. When a fluorescent signal targeting the IS481 target nucleic acid was detected but no fluorescent signal targeting hIS1001 was detected, Bordetella pertussis was detected in the biological sample.

[0045] The pathogenic Bordetella species is one or more of Bordetella pertussis, Bordetella parapertussis, and Bordetella hominis; and

[0046] The biological sample was not subjected to extraction or purification steps before amplification.

[0047] 2. The method of item 1, wherein the first primer pair consists of a first forward primer containing 5' CCATAAGCATGCCCGATT 3' (SEQ ID NO: 11) and a first reverse primer pair containing 5' CGCTTCAGGCACACAAACT 3' (SEQ ID NO: 10).

[0048] 3. The method of item 1 or item 2, wherein the second primer pair consists of a second forward primer containing 5' CGGCTCGACGAATTGC 3' (SEQ ID NO: 7) and a second reverse primer containing 5' AGTTCGTCACGCAGGACAT 3' (SEQ ID NO: 8).

[0049] 4. The method of any one of items 1-3, wherein the third primer pair consists of a third forward primer containing 5' GGCACGGATCGAGGTTTTT 3' (SEQ ID NO: 4) and a third reverse primer containing 5' TACGGCCGTGAAGTGATAGA 3' (SEQ ID NO: 5).

[0050] 5. The method of any one of claims 1-4, further comprising contacting the biological sample with a first nucleic acid probe capable of specifically hybridizing to a segment of the IS481 target nucleic acid of SEQ ID NO: 1, wherein the first nucleic acid probe is detectably labeled and comprises 5' TCAATTGCTGGACCATTTCGAGTCGAC 3' (SEQ ID NO: 12).

[0051] 6. The method of item 5, wherein the first nucleic acid probe is labeled with a FAM fluorescent group detectable label.

[0052] 7. The method of any one of claims 1-6, further comprising contacting the biological sample with a second nucleic acid probe capable of specifically hybridizing to a segment of the complement of the IS1001 target nucleic acid of SEQ ID NO: 2, wherein the second nucleic acid probe is detectably labeled and comprises 5' CAACCAGCCGCTGCTGACGGTC 3' (SEQ ID NO: 9).

[0053] 8. The method of item 7, wherein the second nucleic acid probe is labeled with a CFR610 fluorophore.

[0054] 9. The method of any one of claims 1-8, further comprising contacting the biological sample with a third nucleic acid probe capable of specifically hybridizing to a segment of the hIS1001 target nucleic acid of SEQ ID NO: 3, wherein the third nucleic acid probe is detectably labeled and contains 5' AGTCGCTGGCTACTGCTGCGCA 3' (SEQ ID NO: 6).

[0055] 10. The method of item 9, wherein the third nucleic acid probe is labeled with a JOE fluorophore detectable label.

[0056] 11. The method of any one of items 1-10, further comprising contacting the biological sample with a fourth primer pair for amplifying the control target nucleic acid of SEQ ID NO: 20.

[0057] 12. The method of item 11, wherein the fourth primer pair consists of a fourth forward primer containing 5' GCTTCAGTACCTTCGGCTTG 3' (SEQ ID NO: 17) and a fourth reverse primer containing 5' TTGCAGGCATCTCTGACAAC 3' (SEQ ID NO: 18).

[0058] 13. The method of item 11 or 12, further comprising contacting the biological sample with a fourth nucleic acid probe, the fourth nucleic acid probe being detectably labeled and containing 5'TGGCTCTTGGCGGTCCAGATG 3' (SEQ ID NO: 19).

[0059] 14. The method of item 13, wherein the fourth nucleic acid probe is labeled with a Q670 fluorophore.

[0060] 15. The method of any one of items 1-14, wherein real-time PCR amplification is performed in a direct amplification disk in conjunction with an integrated thermal cycler.

[0061] 16. The method of any one of items 1-15, wherein the biological sample is a nasopharyngeal (NP) aspirate or wash, a nasal swab or a bacterial isolate.

[0062] 17. A kit for detecting the presence of at least one pathogenic Bordetella species in a biological sample, comprising:

[0063] a. Amplify the first primer pair of the IS481 target nucleic acid or its complement of SEQ ID NO: 1;

[0064] b. Amplify the second primer pair of the IS1001 target nucleic acid or its complement of SEQ ID NO: 2; and

[0065] c. Amplify the third primer pair of the hIS1001 target nucleic acid or its complement of SEQ ID NO: 3;

[0066] 18. The kit of item 17, further comprising a fourth primer pair for amplifying the control target nucleic acid of SEQ ID NO: 20.

[0067] 19. The kit of item 17 or 18, wherein the first primer pair is capable of specifically hybridizing with the IS481 target nucleic acid, said IS481 target nucleic acid comprising at least 85-95% identical nucleotides to SEQ ID NO: 1 or its complement.

[0068] 20. The kit of any one of items 17-19, wherein the second primer pair is capable of specifically hybridizing with the IS1001 target nucleic acid, said IS1001 target nucleic acid comprising at least 85-95% identical nucleotides to SEQ ID NO: 2 or its complementary sequence.

[0069] 21. The kit of any one of items 17-20, wherein the third primer pair is capable of specifically hybridizing with the hIS1001 target nucleic acid, said hIS1001 target nucleic acid comprising at least 85-95% identical nucleotides to SEQ ID NO: 3 or its complementary sequence.

[0070] 22. The kit of any one of items 17-21, wherein the first primer pair consists of a first forward primer containing 5' CCATAAGCATGCCCGATT3' (SEQ ID NO: 11) and a first reverse primer containing 5' CGCTTCAGGCACACAAACT 3' (SEQ ID NO: 10).

[0071] 23. The kit of any one of items 17-22, wherein the second primer pair consists of a second forward primer containing 5' CGGCTCGACGAATTGC3' (SEQ ID NO: 7) and a second reverse primer containing 5' AGTTCGTCACGCAGGACAT 3' (SEQ ID NO: 8).

[0072] 24. The kit of any one of items 17-23, wherein the third primer pair consists of a third forward primer containing 5'GGCACGGATCGAGGTTTTT 3' (SEQ ID NO: 4) and a third reverse primer containing 5'TACGGCCGTGAAGTGATAGA 3' (SEQ ID NO: 5).

[0073] 25. The kit of any one of claims 17-24, wherein the kit further comprises a first nucleic acid probe capable of specifically hybridizing with a segment of the IS481 target nucleic acid of SEQ ID NO: 1 or its complement thereof, wherein the first nucleic acid probe is detectably labeled.

[0074] 26. The kit of item 25, wherein the first nucleic acid probe comprises 5'TCAATTGCTGGACCATTTCGAGTCGAC3' (SEQ ID NO: 12), or a complement thereof.

[0075] 27. The kit of item 26, wherein the first nucleic acid probe is labeled with a FAM fluorescent marker.

[0076] 28. The kit of any one of items 17-27, wherein the kit further comprises a second nucleic acid probe capable of specifically hybridizing with a segment of the IS1001 target nucleic acid of SEQ ID NO: 2 or its complement thereof, wherein the second nucleic acid probe is detectably labeled.

[0077] 29. The kit of item 28, wherein the second nucleic acid probe comprises 5' CAACCAGCCGCTGCTGACGGTC 3' (SEQ ID NO: 9), or a complement thereof.

[0078] 30. The kit of item 29, wherein the second nucleic acid probe is labeled with a CFR610 fluorophore.

[0079] 31. The kit of any one of items 17-30, wherein the kit further comprises a third nucleic acid probe capable of specifically hybridizing with a segment of the hIS1001 target nucleic acid of SEQ ID NO: 3 or its complement thereof, wherein the third nucleic acid probe is detectably labeled.

[0080] 32. The kit of item 31, wherein the third nucleic acid probe comprises 5' AGTCGCTGGCTACTGCTGCGCA 3' (SEQ ID NO: 6), or its complement.

[0081] 33. The kit of item 32, wherein the third nucleic acid probe is labeled with JOE fluorophore detectable label.

[0082] 34. A method for selecting patients exhibiting pertussis-like symptoms to treat with a therapeutic agent inhibiting *Bordeza hominis*, comprising:

[0083] (a) Expose biological samples obtained from the patient to the following:

[0084] (i) Amplify the first primer pair of the IS481 target nucleic acid, which includes at least 85-95% identical nucleotides to SEQ ID NO: 1 or its complementary sequence;

[0085] (ii) A second primer pair for amplifying the IS1001 target nucleic acid, comprising at least 85-95% identical nucleotides to SEQ ID NO: 2 or its complementary sequence; and

[0086] (iii) Amplify the third primer pair of the hIS1001 target nucleic acid, which includes at least 85-95% identical nucleotides to SEQ ID NO: 3 or its complementary sequence;

[0087] A reaction-sample mixture is generated in which the amplification of the target nucleic acids IS481, IS1001 and hIS1001 (if they are present in the biological sample) occurs without extracting the target nucleic acids from the biological sample.

[0088] (b) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to generate fluorescence signals;

[0089] (c) Detect the fluorescence signal generated by each amplified target nucleic acid produced in step (b); and

[0090] (d) If a fluorescent signal targeting the hIS1001 nucleic acid is detected, the patient is selected for treatment with a therapeutic agent that inhibits Bordetella hominis.

[0091] The biological sample was not subjected to extraction or purification steps before amplification.

[0092] 35. The method of item 34, wherein the first primer pair consists of a first forward primer containing 5' CCATAAGCATGCCCGATT 3' (SEQ ID NO: 11) and a first reverse primer containing 5' CGCTTCAGGCACACAAACT 3' (SEQ ID NO: 10).

[0093] 36. The method of item 34 or 35, wherein the second primer pair consists of a second forward primer containing 5' CGGCTCGACGAATTGC 3' (SEQ ID NO: 7) and a second reverse primer containing 5' AGTTCGTCACGCAGGACAT 3' (SEQ ID NO: 8).

[0094] 37. The method of any one of items 34-36, wherein the third primer pair consists of a third forward primer containing 5' GGCACGGATCGAGGTTTTT3' (SEQ ID NO: 4) and a third reverse primer containing 5' TACGGCCGTGAAGTGATAGA 3' (SEQ ID NO: 5).

[0095] 38. The method of any one of claims 34-37, further comprising contacting the biological sample with a first nucleic acid probe capable of specifically hybridizing to a segment of the IS481 target nucleic acid of SEQ ID NO: 1, wherein the first nucleic acid probe is detectably labeled and comprises 5' TCAATTGCTGGACCATTTCGAGTCGAC 3' (SEQ ID NO: 12).

[0096] 39. The method of item 38, wherein the first nucleic acid probe is labeled with a FAM fluorescent group detectable label.

[0097] 40. The method of any one of claims 34-39, further comprising contacting the biological sample with a second nucleic acid probe capable of specifically hybridizing to a segment of the complement of the IS1001 target nucleic acid of SEQ ID NO: 2, wherein the second nucleic acid probe is detectably labeled and comprises 5' CAACCAGCCGCTGCTGACGGTC 3' (SEQ ID NO: 9).

[0098] 41. The method of item 40, wherein the second nucleic acid probe is labeled with a CFR610 fluorophore.

[0099] 42. The method of any one of claims 34-41, further comprising contacting the biological sample with a third nucleic acid probe capable of specifically hybridizing to a segment of the hIS1001 target nucleic acid of SEQ ID NO: 3, wherein the third nucleic acid probe is detectably labeled and contains 5' AGTCGCTGGCTACTGCTGCGCA 3' (SEQ ID NO: 6).

[0100] 43. The method of item 42, wherein the third nucleic acid probe is labeled with a JOE fluorophore detectable label.

[0101] 44. The method of any one of claims 34-43, further comprising contacting the biological sample with a fourth primer pair for amplifying the control target nucleic acid of SEQ ID NO: 20.

[0102] 45. The method of item 44, wherein the fourth primer pair consists of a fourth forward primer containing 5' GCTTCAGTACCTTCGGCTTG 3' (SEQ ID NO: 17) and a fourth reverse primer containing 5' TTGCAGGCATCTCTGACAAC 3' (SEQ ID NO: 18).

[0103] 46. ​​The method of item 44 or 45, further comprising contacting the biological sample with a fourth nucleic acid probe, wherein the fourth nucleic acid probe is detectably labeled and contains 5' TGGCTCTTGGCGGTCCAGATG 3' (SEQ ID NO: 19).

[0104] 47. The method of item 46, wherein the fourth nucleic acid probe is labeled with a Q670 fluorophore.

[0105] 48. The method of any one of items 34-47, wherein real-time PCR amplification is performed in a direct amplification disk in conjunction with an integrated thermal cycler.

[0106] 49. The method of any one of items 34-48, wherein the biological sample is a nasopharyngeal (NP) aspirate or wash, a nasal swab or a bacterial isolate.

[0107] 50. The method of any one of items 34-49, wherein the therapeutic agent for inhibiting Bordetella hominis is one or more agents selected from the group consisting of fluoroquinolones, carbapenems, trimethoprim-sulfamethoxazole and Bordetella hominis-specific antibodies.

[0108] 51. The method of 50, wherein the fluoroquinolone is selected from the group consisting of ciprofloxacin, gemifloxacin, levofloxacin, norfloxacin, ofloxacin, rovafloxacin, gatifloxacin, grefloxacin, timafloxacin, lomifloxacin, sparfloxacin, enoxacin, and moxifloxacin.

[0109] 52. The method of 50, wherein the carbapenem is selected from the group consisting of: imipenem, meropenem, ertapenem, doribenem, panipenem, biapenem, razupenem (PZ-601), tebipenem, lenapenem, tomopenem, and thienpenem (thienamycin).

[0110] 53. A method for selecting patients exhibiting pertussis-like symptoms to treat with a *Bordeza hominis*-specific antibody and an additional therapeutic agent inhibiting *Bordeza parapertussis*, comprising:

[0111] (a) Expose biological samples obtained from the patient to the following:

[0112] (i) Amplifying the first primer pair of the IS481 target nucleic acid, which includes at least 85-95% identical nucleotides to SEQ ID NO: 1 or its complementary sequence;

[0113] (ii) A second primer pair for amplifying the IS1001 target nucleic acid, comprising at least 85-95% identical nucleotides to SEQ ID NO: 2 or its complementary sequence; and

[0114] (iii) Amplify the third primer pair of the hIS1001 target nucleic acid, which includes at least 85-95% identical nucleotides to SEQ ID NO: 3 or its complementary sequence;

[0115] A reaction-sample mixture is generated in which the amplification of the target nucleic acids IS481, IS1001 and hIS1001 (if they are present in the biological sample) occurs without extracting the target nucleic acids from the biological sample.

[0116] (b) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to generate fluorescent signals;

[0117] (c) Detect the fluorescence signal generated by each amplified target nucleic acid produced in step (b); and

[0118] (d) If fluorescent signals against hIS1001 target nucleic acid and IS1001 target nucleic acid are detected, select patients to be treated with Bordetella hominis specific antibodies and additional therapeutic agents.

[0119] The biological sample was not subjected to extraction or purification steps before amplification.

[0120] 54. The method of 53, wherein the additional therapeutic agent for inhibiting Bordetella parapertussis is one or more agents selected from the group consisting of: trimethoprim-sulfamethoxazole, ciprofloxacin, gemifloxacin, levofloxacin, norfloxacin, ofloxacin, rovafloxacin, gatifloxacin, grefloxacin, temfloxacin, lomifloxacin, sparfloxacin, enoxacin, and moxifloxacin.

[0121] 55. A method for selecting a patient exhibiting pertussis-like symptoms to be treated with a therapeutic agent inhibiting Bordetella pertussis and an additional therapeutic agent inhibiting Bordetella parapertussis, comprising:

[0122] (a) Expose biological samples obtained from the patient to the following:

[0123] (i) Amplify the first primer pair of IS481, which includes at least 85-95% identical nucleotides to SEQ ID NO: 1 or its complementary sequence;

[0124] (ii) Amplify the second primer pair of IS1001, which includes at least 85-95% identical nucleotides to SEQ ID NO: 2 or its complementary sequence; and

[0125] (iii) Amplify the third primer pair of hIS1001, which includes at least 85-95% identical nucleotides to SEQ ID NO: 3 or its or complementary sequence;

[0126] A reaction-sample mixture is generated in which the amplification of the target nucleic acids IS481, IS1001 and hIS1001 (if they are present in the biological sample) occurs without extracting the target nucleic acids from the biological sample.

[0127] (b) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to generate fluorescent signals;

[0128] (c) Detect the fluorescence signal generated by each amplified target nucleic acid produced in step (b); and

[0129] (d) If (i) a fluorescent signal targeting IS481 and a fluorescent signal targeting IS1001 are detected, and (ii) no fluorescent signal targeting hIS1001 is detected, then the patient is selected to be treated with a therapeutic agent that inhibits Bordetella pertussis and an additional therapeutic agent that inhibits Bordetella parapertussis.

[0130] The biological sample was not subjected to extraction or purification steps before amplification.

[0131] 56. The method of 55, wherein the additional therapeutic agent for inhibiting Bordetella parapertussis is one or more agents selected from the group consisting of: trimethoprim-sulfamethoxazole, ciprofloxacin, gemifloxacin, levofloxacin, norfloxacin, ofloxacin, rovafloxacin, gatifloxacin, grefloxacin, temfloxacin, lomifloxacin, sparfloxacin, enoxacin, and moxifloxacin.

[0132] 57. The method of item 55 or 56, wherein the therapeutic agent for inhibiting Bordetella pertussis is one or more agents selected from the group consisting of whole-cell (wP) Bordetella pertussis vaccine, acellular Bordetella pertussis vaccine, telithromycin, and macrolide antibiotics.

[0133] 58. The method of item 57, wherein the macrolide antibiotic is selected from the group consisting of azithromycin (Zithromax), clarithromycin (Biaxin), erythromycin (E-Mycin, Eryc, Ery-Tab, PCE, Pediazole, Ilosone), and roxithromycin. Detailed Implementation

[0134] This disclosure provides methods for determining whether patients exhibiting pertussis-like symptoms benefit from treatment with agents that inhibit Bordetella holmesii. These methods are based on detecting Bordetella pertussis, Bordetella parapertussis, and Bordetella holmesii in biological samples by determining the presence of IS481, IS1001, and hIS1001 target repeat sequences, respectively, using real-time PCR. The disclosed method comprises: (a) contacting the biological sample with: (i) a first primer pair specifically binding to a target nucleic acid sequence of an IS481 repeat element (if present); (ii) a second primer pair specifically binding to a target nucleic acid sequence of an IS1001 repeat element (if present); and (iii) a third primer pair specifically binding to a target nucleic acid sequence of an hIS1001 repeat element (if present), to induce amplification of the IS481, IS1001, and hIS1001 target nucleic acids (if present in the biological sample). The method involves: (a) generating a reaction-sample mixture without extracting the target nucleic acid from the biological sample; (b) subjecting the reaction-sample mixture to real-time polymerase chain reaction (PCR) conditions under which each of the target nucleic acids present in the biological sample is amplified to produce a fluorescent signal; (c) detecting the amount of fluorescent signal produced by each fluorophore using an integrated thermal cycling system; and (d) determining the presence of one or more of *Bordeia pertussis*, *Bordeia parapertussis*, and *Bordeia hominis* in the biological sample by comparing the amount of fluorescence produced by each target nucleic acid and applying the algorithm disclosed herein. A kit for carrying out this method is also provided.

[0135] definition

[0136] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which they pertain.

[0137] As used herein, unless otherwise stated, the singular forms “a” and “the” include plural references. Thus, for example, a reference to “oligonucleotide” includes multiple oligonucleotide molecules, and a reference to “nucleic acid” refers to one or more nucleic acids.

[0138] As used herein, the term “about” with respect to numbers is generally considered to include numbers in the range of 1% to 10% in either direction (greater than or less than), unless otherwise stated or otherwise apparent from the context.

[0139] As used herein, the term “amplify / amplication” in relation to nucleic acid sequences refers to a method of increasing the representativeness of a population of nucleic acid sequences in a sample. A copy of a specific target nucleic acid sequence produced in vitro during an amplification reaction is called an “amplifier” or “amplification product.” Amplification can be exponential or linear. The target nucleic acid can be DNA (e.g., genomic DNA and cDNA) or RNA. While the illustrative methods described below involve amplification using polymerase chain reaction (PCR), many other methods (e.g., isothermal methods, rolling circle methods, etc.) are known to those skilled in the art. Those skilled in the art will understand that these other methods can be used in place of or in conjunction with PCR methods. See, for example, Saiki, “Amplification of Genomic DNA” in PCR Protocols, Innis et al., eds., Academic Press, San Diego, CA 1990, pp. 13-20; Wharam et al., Nucleic Acids Res. 29(11):E54-E54 (2001).

[0140] The term "amplification mixture" as used herein refers to a mixture of reagents used in nucleic acid amplification reactions, but does not contain primers or samples. An amplification mixture includes buffer, dNTPs, and DNA polymerase. An amplification mixture may further include MgCl2, KCl, and nonionic and ionic detergents (including cationic detergents).

[0141] The “amplification master mixture” includes the amplification mixture and primers for amplifying one or more target nucleic acids, but does not contain the sample to be amplified.

[0142] As used herein, the terms “complement,” “complementary,” or “complementarity” relating to polynucleotides (i.e., nucleotide sequences, such as oligonucleotides or target nucleic acids) refer to the Watson / Crick base pairing rule. As used herein, a complement to a nucleic acid sequence is an oligonucleotide that is “antiparallel associated” when aligned with another nucleic acid sequence such that the 5’ end of one sequence pairs with the 3’ end of another. For example, the sequence “5’-AGT-3” is complementary to the sequence “3’-TCA-5.” Nucleic acids described herein may include certain bases not commonly found in naturally occurring nucleic acids. These bases include, for example, inosine, 7-denitroguanine, locked nucleic acids (LNAs), and peptide nucleic acids. Complementarity does not need to be perfect; stable duplexes may contain mismatched base pairs, degenerated, or unmatched bases. Technicians in the field of nucleic acid technology can determine the stability of duplexes by considering many variables, such as the length, base composition, and sequence of oligonucleotides, ionic strength, and the incidence of mismatched base pairs. The complementary sequence can also be an RNA sequence complementary to a DNA sequence or its complementary sequence, and can also be cDNA.

[0143] As used herein, the term "fundamentally complementary" means that two sequences hybridize under strict hybridization conditions. Those skilled in the art will understand that a fundamentally complementary sequence does not need to hybridize along its entire length. Specifically, a fundamentally complementary sequence may contain a sequence of consecutive bases that does not hybridize with the target sequence, located at the 3' or 5' of the sequence of consecutive bases that hybridize with the target sequence under strict hybridization conditions.

[0144] As used herein, the “cycle threshold” (Ct) of an analyte is the PCR cycle in which the fluorescence signal crosses a specific fluorescence threshold. This Ct depends on the efficiency of the amplification reaction, which includes the starting template copy number, organism lysis, PCR amplification, hybridization or cleavage of the fluorescent probe, and detection sensitivity. Ct provides a relative measure of the target nucleic acid concentration in the PCR reaction. Many factors besides the target nucleic acid concentration can affect the absolute value of Ct. However, errors from the reaction mixture or instrument that alter fluorescence measurements associated with Ct calculations can lead to template-independent changes in the Ct value.

[0145] As used herein, the term "detection" refers to determining the presence of a target nucleic acid in a sample. Detection does not require the method to provide 100% sensitivity and / or 100% specificity.

[0146] As used herein, the term “direct amplification” refers to a nucleic acid amplification reaction in which the target nucleic acid is amplified from a sample without prior purification, extraction, or concentration.

[0147] As used herein, the term "extraction" refers to any activity undertaken to remove nucleic acids from other (non-nucleic acid) material present in a sample. Extraction includes mechanical or chemical lysis, the addition of detergents or proteases, or precipitation and removal of non-nucleic acids such as proteins.

[0148] As used herein, the term "fluorophore" refers to a molecule that absorbs light at a specific wavelength (excitation frequency) and subsequently emits light at a longer wavelength (emission frequency). The term "donor fluorophore," as used herein, refers to a fluorophore that donates or transfers emission energy to the quencher when it is in close proximity to the quencher module. Due to this energy donation, the donor fluorophore itself emits less light at a specific emission frequency that would be present in the absence of a closely located quencher module.

[0149] As used herein, the term "hybridization" refers to the process by which two substantially complementary nucleic acid strands (complemented by at least about 65%, 75%, or 90% on a length of at least 14 to 25 nucleotides) anneal to each other under suitable stringent conditions to form a duplex or heteroduplex by hydrogen bonding between complementary base pairs. Hybridization is typically and preferably performed with nucleic acid molecules of probe length, preferably 15-100 nucleotides, more preferably 18-50 nucleotides. Nucleic acid hybridization techniques are known in the art. See, for example, Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainview, NY. Hybridization and hybridization strength (i.e., the strength of the association between nucleic acids) are influenced by factors such as the degree of complementarity between the nucleic acids, the stringency of the conditions involved, and the thermal melting point (T0) of the resulting hybrid. mThe effects of hybridization conditions are understood by those skilled in the art. They will know how to estimate and adjust the stringency of hybridization conditions so that sequences with at least the required level of complementarity will hybridize stably, while those with lower complementarity will not. For examples of hybridization conditions and parameters, see, for example, Sambrook et al., 1989, *Molecular Cloning: A Laboratory Manual*, Second Edition, Cold Spring Harbor Press, Plainview, NY; Ausubel, F. M et al., 1994, *Current Protocols in Molecular Biology*, John Wiley & Sons, Secaucus, NJ. In some embodiments, specific hybridization occurs under stringent hybridization conditions. Oligonucleotides or polynucleotides specifically targeting the target nucleic acid (e.g., probes or primers) will "hybridize" with the target nucleic acid under suitable conditions.

[0150] As used herein, the terms “individual,” “patient,” or “subject” can refer to an individual organism, a vertebrate, a mammal, or a human. In a preferred embodiment, the individual, patient, or subject is a human.

[0151] As used herein, the term "multiplex PCR" refers to the simultaneous generation of two or more PCR products or amplicones within the same reaction vessel. Each PCR product is initiated using unique primer pairs. Multiplex reactions may further include specific probes for each product labeled with different detectable modules.

[0152] As used herein, an "oligonucleotide" refers to a molecule having a nucleic acid base sequence on a backbone primarily composed of identical monomeric units spaced at defined intervals. The bases are arranged on the backbone in such a way that they can bind to nucleic acids having a base sequence complementary to the oligonucleotide's bases. The most common oligonucleotides have a backbone of sugar phosphate units. Oligodeoxyribonucleotides without a hydroxyl group at the 2' position and oligoribonucleotides with a hydroxyl group at the 2' position can be distinguished. Oligonucleotides may also include derivatives in which the hydrogen atom of the hydroxyl group is replaced by an organic group (e.g., allyl). Oligonucleotides that function as primers or probes are generally at least about 10-15 nucleotides in length or up to about 70, 100, 110, 150, or 200 nucleotides in length, more preferably at least about 15 to 25 nucleotides in length. Oligonucleotides used as primers or probes for specific amplification or specific detection of a specific target nucleic acid are generally capable of specifically hybridizing with that target nucleic acid.

[0153] As used herein, “pathogenic Bordetella species” refers to any Bordetella species capable of causing pertussis or related conditions in a subject (e.g., a human). Specific pathogenic bacteria include, for example, Bordetella pertussis, Bordetella parapertussis, and Bordetella hominis.

[0154] As used herein, a “positive control nucleic acid” or “internal positive amplification control” is a nucleic acid known to be present in a sample in a certain amount or level. In some embodiments, the positive control nucleic acid is not naturally present in the sample and is added to the sample before subjecting the reaction sample mixture to a real-time polymerase chain reaction in a disclosed method for detecting the presence of pathogenic Bordetella species in the sample.

[0155] As used herein, the term "primer" refers to an oligonucleotide that, when placed under conditions that initiate the synthesis of a primer extension product complementary to the target nucleic acid strand—namely, in an appropriate buffer ("buffer" includes pH, ionic strength, cofactors, etc.) and at a suitable temperature in the presence of different nucleotide triphosphates and polymerases—can serve as the starting point for nucleic acid sequence synthesis. One or more nucleotides of a primer may be modified, for example, by adding a methyl group, biotin or digitoxin moiety, a fluorescent tag, or by using a radioactive nucleotide. The primer sequence does not need to reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5′ end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. The term "primer" as used herein includes all synthetically available forms of primers, including peptide nucleic acid primers, locked nucleic acid primers, phosphate-thioester modified primers, labeled primers, etc. As used herein, the term "forward primer" refers to a primer annealed to the antisense strand of double-stranded DNA (dsDNA). A "reverse primer" annealed to the sense strand of dsDNA.

[0156] Primers are typically at least 10, 15, 18, or 30 nucleotides in length, or at most about 100, 110, 125, or 200 nucleotides in length. In some embodiments, primers are preferably about 15 to about 60 nucleotides in length, and most preferably about 25 to about 40 nucleotides in length. In some embodiments, primers are 15 to 35 nucleotides in length. There is no standard length for optimal hybridization or polymerase chain reaction amplification. The optimal length for a particular primer application can be readily determined in the manner described in H. Erlich, PCR Technology, Principles and Application for DNA Amplification, (1989).

[0157] A "primer extension reaction" refers to a synthetic reaction in which an oligonucleotide primer hybridizes with a target nucleic acid and produces a complementary copy of the target nucleic acid via polymerase-dependent 3'-addition of a single complementary nucleotide. In some embodiments, this primer extension reaction is PCR.

[0158] As used in this article, the term "primer pair" refers to a forward and reverse primer pair (i.e., a left and right primer pair) that can be used together to amplify a given region of the nucleic acid of interest.

[0159] As used herein, "probe" refers to a nucleic acid that interacts with a target nucleic acid via hybridization. A probe may be fully or partially complementary to the target nucleic acid sequence. The degree of complementarity depends (generally) on many factors based on the probe's function. Probes may be labeled or unlabeled, or modified using any of the many methods known in the art. Probes may specifically hybridize with the target nucleic acid. Probes may be DNA, RNA, or an RNA / DNA hybrid. Probes may be oligonucleotides, artificial chromosomes, fragmented artificial chromosomes, genomic nucleic acids, fragmented genomic nucleic acids, RNA, recombinant nucleic acids, fragmented recombinant nucleic acids, peptide nucleic acids (PNAs), locked nucleic acids, circular heterocyclic oligomers, or nucleic acid conjugates. Probes may include modified nucleobases, modified sugar modules, and modified nucleotide internucleotide bonds. Probes can be used to detect the presence or absence of methylated target nucleic acids. Probes are typically at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100, or more nucleotides in length.

[0160] As used in this article, a “probe element” refers to a nucleotide that (a) is associated with a primer because it is linked to or located near the primer’s nucleic acid sequence, and (b) specifically hybridizes to the target nucleic acid to be detected under stringent conditions.

[0161] As used herein, the term "primer-probe detection system" refers to a method for real-time PCR. This method utilizes bifunctional molecules (referred to herein as primer-probes) containing PCR primer elements covalently linked to probe elements via polymerase-blocking groups. Furthermore, each primer-probe molecule contains a fluorophore that interacts with a quencher to reduce background fluorescence. Primers-probes, as used herein, may comprise a 3' primer with a 5' extended probe tail, including a hairpin structure with a fluorophore / quencher pair. During PCR, polymerase extension to the probe tail is prevented by the inclusion of hexadecimalt (HEG). During the first round of amplification, the 3' target-specific primer anneals and extends with the target nucleic acid, allowing the primer-probe to be immediately incorporated into the newly synthesized strand, which has a newly synthesized 5' probe target region. During the next round of denaturation and annealing, the probe region of the primer-probe hairpin loop hybridizes with the target, thereby separating the fluorophore and quencher and generating a measurable signal. These primer-probe combinations are described in Whitcombe et al., Nature Biotech 17: 804-807 (1999). SCORPION primers are illustrative examples of primer-probe combinations.

[0162] As used herein, the term "quencher module" refers to a molecule that absorbs emission energy generated by a donor and dissipates the energy as heat, or emits light at a wavelength longer than that emitted by the donor, located near the donor's fluorophore. In the latter case, the quencher is considered to be the acceptor fluorophore. Quenching modules can function via proximal (i.e., collisional) quenching or via Förster or fluorescence resonance energy transfer ("FRET"). Quenching via FRET is generally used for TaqMan® probes, while proximal quenching is used for molecular beacons and Scorpion™ probes.

[0163] As used in this article, “reaction sample mixture” refers to a mixture containing the amplification master mixture and the sample.

[0164] As used herein, the term "sample" refers to a clinical sample obtained from a patient or isolated from microorganisms. In a preferred embodiment, the sample is obtained from a biological source (i.e., a biological sample), such as tissue, body fluid, or microorganisms collected from the subject. Sample sources include, but are not limited to, mucus, sputum (processed or unprocessed), bronchoalveolar lavage (BAL), bronchial washings (BW), blood, body fluids, cerebrospinal fluid (CSF), urine, plasma, serum, or tissue (e.g., biopsy material). Preferred sample sources include nasopharyngeal and / or throat swabs or nasal washings.

[0165] As used herein in relation to the methods of this technique, the term "sensitivity" is a measure of the method's ability to detect a preselected sequence variant within a population of heterologous sequences. If we assume that the preselected sequence variant is present in at least F% of the sequences in the sample, for F% of variants, the method has a sensitivity of S%, meaning it can detect the preselected sequence with C% preselection confidence and S% of time / number of detections. For example, if we assume that the preselected variant sequence is present in at least 5% of the sequences in the sample, for 5% of variants, the method has a sensitivity of 90%, meaning it can detect the preselected sequence with 99% preselection confidence and 9 out of 10 detections (F = 5%; C = 99%; S = 90%). Illustrative sensitivities include at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, and 99%.

[0166] As used herein, the term "specificity" for oligonucleotide primers refers to the nucleotide sequence of the primer having sequence identity with at least 12 bases of a portion of the nucleic acid to be amplified when the nucleotides are aligned with the nucleic acid. Nucleic acid-specific oligonucleotide primers are those that hybridize with the target of interest under stringent hybridization or washing conditions and substantially do not hybridize with nucleic acids of no interest. Higher levels of sequence identity are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 85-95%, and more preferably at least 98% sequence identity. This can be determined using a commercially available computer program with default settings employing algorithms known in the art. As used herein, a sequence having "high sequence identity" has the same nucleotides at at least about 50% of the aligned nucleotide positions, preferably at least about 60% of the aligned nucleotide positions, and more preferably at least about 75% of the aligned nucleotide positions.

[0167] "Specificity," as used herein, is a measure of a method's ability to distinguish genuine preselected sequence variants from sequencing artifacts or other closely related sequences. It is the ability to avoid false positives. False positives can occur due to errors in sample preparation, sequencing mistakes, or unintentional sequencing of closely related sequences (such as pseudogenes or gene family members) that introduce the sequence of interest. A method has X% specificity if, when applied to N... 总 A sample set of sequences, where X 真 The sequences are true variants and X 非真 When 500 sequences are not true variants, the method selects at least X% of the non-true variants as non-variants. For example, if the method has 90% specificity, and when applied to a sample set of 1000 sequences, where 500 sequences are true variants and 500 are not true variants, then the method selects at least 90% of these 500 non-true variants as non-variants. Exemplary specificities include at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, and 99%.

[0168] As used herein, “strict hybridization conditions” refers to hybridization conditions as stringent as the following: overnight hybridization at 42°C in salmon sperm DNA sonicated with 50% formamide, 5x SSC, 50 mM NaH2PO4, pH 6.8, 0.5% SDS, 0.1 mg / mL, and 5x Denhart solution; washing with 2x SSC and 0.1% SDS at 45°C; and washing again with 0.2x SSC and 0.1% SDS at 45°C. In another instance, strict hybridization conditions should not allow hybridization of two nucleic acids differing by more than two bases in a 20-nucleotide sequence.

[0169] As used in this article, "TaqMan" A "PCR detection system" refers to a method for real-time PCR. In this method, the main amplification mixture includes TaqMan, which hybridizes with the amplified nucleic acid segments. Probe. TaqMan The probe contains a donor and a quencher fluorophore at either end, and they are positioned close enough that the fluorescence of the donor is absorbed by the quencher. However, when the probe hybridizes with the amplified segment, the 5'-exonuclease activity of Taq polymerase cleaves the probe, allowing the donor fluorophore to emit detectable fluorescence.

[0170] As used herein, the term "target nucleic acid" or "target sequence" refers to a nucleic acid sequence of interest in a sample to be detected and / or quantified. A target nucleic acid can consist of a segment of a chromosome, a complete gene with or without an intergenic sequence, a segment or portion of a gene with or without an intergenic sequence, or a nucleic acid sequence for which probes or primers are designed. Target nucleic acids may include wild-type sequences, mutations, deletions, insertions or duplications, tandem repeat elements, the gene of interest, the region of the gene of interest, or any upstream or downstream region thereof. A target nucleic acid may represent an alternative sequence or allele of a specific gene. Target nucleic acids may be derived from genomic DNA, cDNA, or RNA.

[0171] The impact of Bordetella species profiling on treatment selection

[0172] Pertussis continues to be a major cause of morbidity and infant mortality worldwide. (World Health Organization, Wkly. Epidemiol. Rec. 80:31-38 (2005)). Despite the availability of Bordetella pertussis vaccines, the reported incidence of pertussis in industrialized countries has been rising over the past 20 years. This increase in pertussis incidence is attributed to several factors, including immunodeficiency, increased public health awareness and reporting, and the use of more sensitive diagnostic methods such as PCR-based assays.

[0173] Several studies have shown an increased incidence of respiratory illnesses induced by *Bordetella parapertussis*. Watanabe, M. et al., *Expert Rev. Anti Infect. Ther. 2:447-454* (2004). Furthermore, pertussis-like illnesses caused by *Bordetella hominis* occur in the United States. Weber, DJ et al., *Infect. Control Hosp. Epidemiol.* 31:875-877* (2010). Moreover, *Bordetella bronchitidis* is incidentally isolated from the upper respiratory tract of immunocompromised individuals. Wernli, D. et al., *Clin. Microbiol. Infect.* 17:201-203* (2010). Therefore, species identification and confirmation of *Bordetella* species are essential to allow for the accurate diagnosis and management of pertussis and pertussis-like illnesses in humans.

[0174] The multicopy insert sequence IS481 is frequently used as a target nucleic acid sequence in real-time PCR assays for detecting Bordetella pertussis infection because the Bordetella pertussis genome typically includes approximately 50–200 copies of IS481, making this assay highly sensitive. However, single-analyte PCR assays targeting only IS481 can produce false-positive results for pertussis, as IS481 is also found in animal isolates of Bordetella hominis (8–10 copies per genome) and Bordetella bronchitis. (Register, K. et al., J. Clin. Microbiol. 44:4577–4583 (2006); Reischl, U. et al., J. Clin. Microbiol. 39:1963–1966 (2001). The false-outbreak caused by assays using IS481 as a single PCR target has demonstrated the need for cutoff values ​​defined based on analytical sensitivity and clinical relevance. Lievano, FA, et al., J. Clin. Microbiol. 40:2801-2805 (2002); Muyldermans, G., et al., J. Clin. Microbiol. 43:30-35 (2005).

[0175] Accurate identification of *Bordeia hominis* is important for several reasons. Unlike *Bordeia pertussis*, *Bordeia hominis* can cause invasive disease in both immunocompromised and immunocompetent subjects. (Tartof SY et al., *Clin Infect Dis* 58: e39-43 (2014); Jonckheere et al., *J Med Microbiol* 61: 874-877 (2012); Russell FM et al., *Clin Infect Dis* 33: 129-130 (2001).) Studies have shown that neither whole-cell (wP) nor acellular (aP) *Bordeia pertussis* vaccines confer therapeutic protection against *Bordeia hominis* infection in mice. (Zhang et al., *Emerging Infectious Diseases* 18(11):1771-1779 (2012). In humans, during a pertussis outbreak in Ohio (USA), the estimated effectiveness of booster immunization against *Bordetella hopterii* in adolescents against acellular pertussis was 36%, compared to 67% against *Bordetella pertussis*. (Rodgers L et al., ClinInfect Dis 56: 322-331 (2013)). Therefore, immunized patients may not be immune to *Bordetella hopterii* infection. Furthermore, subsequent misdiagnosis of *Bordetella hopterii* as *Bordetella pertussis* could be misinterpreted as vaccine failure, leading to inappropriate public health measures. Additionally, it remains unclear whether prophylactic antibiotic treatment for all contacts of index cases (such as in *Bordetella pertussis* infection) is necessary for *Bordetella hopterii* infection. (Weber DJ et al., Infect Control and Hosp Epidemiol 31: 306-307 (2010)). Therefore, high specificity is required in *Bordetella* spp. screening assays to avoid unnecessary or inappropriate therapeutic interventions.

[0176] This disclosure provides a sensitive and specific real-time multiplex PCR assay that simultaneously targets the repeat elements of IS481, Bordetella parapertussis IS1001, and Bordetella hominis hIS1001, thereby allowing rapid identification of one or more pathogenic Bordetella species in biological samples.

[0177] Biological sample collection and preparation

[0178] The methods and compositions of this technology can be used to detect pathogenic Bordetella species by determining target nucleic acid sequences corresponding to multiple copy insertion sequences of IS481, IS1001, and hIS1001 in a biological sample obtained from a subject. Samples used for the detection of pathogenic Bordetella species may also include cultures of bacterial isolates grown on appropriate culture media to form colonies, wherein such cultures are prepared from a biological sample obtained from a subject.

[0179] The methods disclosed herein can be used to detect and quantify pathogenic Bordetella species in biological samples derived from sterile and / or non-sterile sites. "Sterile sites" include bodily fluids such as whole blood, plasma, cell-free plasma, urine, cerebrospinal fluid, synovial fluid, pleural fluid, pericardial fluid, intraocular fluid, tissue biopsy, or tracheal aspirates. As used herein, "cell-free plasma" refers to plasma containing less than 1% cells by volume. "Non-sterile sites" include sputum, feces, skin swabs, groin swabs, nasal swabs, and pharyngeal swabs. In some embodiments, the biological sample includes nasopharyngeal (NP) aspirates or swabs or nasal washes. In other embodiments, the biological sample includes a culture of isolated bacteria grown on a suitable culture medium to form colonies. The sample may also include bacterial isolates.

[0180] Biological samples may be suspected of containing nucleic acids from pathogenic Bordetella species and / or one or more pathogenic Bordetella species. Additionally, biological samples can be obtained from subjects suspected of being infected with one or more pathogenic Bordetella species. Biological samples may be contacted with the amplification master mixture for use on a microfluidic / microelectronic centrifuge platform.

[0181] While the methods disclosed herein preferably employ untreated biological samples to form a direct, streamlined sample-to-result process, the detection methods disclosed herein are effective when used to purify isolated nucleic acids (DNA or RNA) from biological samples according to any method known to those skilled in the art. Samples can be collected or concentrated by centrifugation, if desired. Cells in the sample can be lysed, such as by treatment with enzymes, thermal surfactants, sonication, or a combination thereof. Alternatively, commercially available nucleic acid extraction kits can be used to treat the biological samples.

[0182] In some embodiments, one or more primer pairs are present in the amplification master mixture, which also includes DNA polymerase, dNTPs, and PCR buffer before contacting the biological sample. Amplification of IS481, IS1001, and hIS1001 target repeat elements preferably occurs in multiplex form. Alternatively, individual PCR reactions for each multiple-copy insert sequence can be used. The biological sample can be contacted with the primer pairs and / or the amplification master mixture to form a reaction-sample mixture in a direct amplification disc. For example, the biological sample can be contacted with the amplification master mixture in a direct amplification disc, such as a direct amplification disc sold by Focus Diagnostics Inc. (Cypress, Calif., USA), which is used as part of the SIMPLE XA direct real-time PCR assay with 3M TM The integrated circulation system works in conjunction with the direct amplification disk. The direct amplification disk is a thin disk containing multiple designated areas, each containing wells for receiving the amplification master mixture and associated wells for receiving untreated patient samples. A sample-reaction mixture is generated in the direct amplification disk when or after the addition of the amplification master mixture and the sample.

[0183] Real-time PCR

[0184] The amplification of the target nucleic acid can be detected by any of a number of methods known in the art, such as gel electrophoresis, column chromatography, hybridization with probe, sequencing, melting curve analysis, or "real-time" detection.

[0185] For real-time detection, primers and / or probes can be detectably labeled to allow fluorescence differences upon primer introduction or when probe hybridization occurs, for example, and amplified in an instrument capable of monitoring fluorescence changes during the reaction. Real-time detection methods for nucleic acid amplification are known and include, for example, the TaqMan® system, the Scorpion™ primer system, and the use of intercalation dyes for double-stranded nucleic acids.

[0186] In real-time quantitative PCR, the accumulation of amplified products is continuously measured in standard dilutions of target DNA and samples containing unknown amounts of target DNA. This is achieved by comparing the initial template concentration in the standard samples with the PCR concentration required to produce a specific threshold concentration of product. TM A standard curve was constructed by correlating the number of cycles (Ct). In the test samples, target PCR was measured after the same Ct. TM Product accumulation allows for interpolation of the target DNA concentration from the standard curve.

[0187] In some embodiments, amplified nucleic acids are detected by hybridization with a specific probe. Probe oligonucleotides (complementary to a portion of the amplified target sequence) can be used to detect the amplified fragment. In some embodiments, hybridization can be detected in real time. In another embodiment, hybridization is not detected in real time. Amplified nucleic acids of individual target sequences can be detected simultaneously (i.e., in the same reaction vessel, such as in multiplex PCR) or individually (i.e., in separate reaction vessels). In some embodiments, multiple target nucleic acids are detected simultaneously using two or more distinguishably labeled (e.g., by different labelable modules such as color) gene-specific oligonucleotide probes, one hybridizing with a first target sequence and another with a second target sequence.

[0188] In some implementations, different primer pairs are labeled with different distinguishable and detectable modules. Thus, for example, HEX and FAM fluorescent dyes can be present on different primer pairs in multiplex PCR and are associated with the resulting amplicon. In other implementations, the forward primer is labeled with one detectable module, while the reverse primer is labeled with a different detectable module, such as FAM dye for the forward primer and HEX dye for the reverse primer. Using different detectable modules is useful for distinguishing between amplification products of the same or very similar length.

[0189] For sequence-modified nucleic acids, the target can be independently selected from the top or bottom chain. Therefore, all detectable targets can include the top chain, the bottom chain, or a combination of top and bottom chain targets.

[0190] A common method for real-time PCR uses fluorescent probes such as TaqMan® probes, molecular beacons, and Scorpion primer probes. Compared to other forms of quantitative PCR (which detect the amount of the final amplified product), real-time PCR quantifies the initial amount of template with higher specificity, sensitivity, and reproducibility. Real-time PCR does not detect the size of the amplicon. The probes used in Scorpion™ and TaqMan® technologies are based on the principle of fluorescence quenching and involve a donor fluorophore and a quenching module.

[0191] Real-time PCR is performed using any suitable instrument capable of detecting the accumulation of PCR amplification products. Most commonly, the instrument is capable of detecting fluorescence from one or more fluorescent tags. For example, real-time detection on an instrument (such as the ABI Real-Time PCR System 7500® Sequence Detector) monitors fluorescence and calculates a measurement, or Rn value, of the reporter signal during each PCR cycle. The threshold cycle, or Ct value, is the cycle in which fluorescence intersects with a threshold. The threshold can be determined by the sequence detection system software or manually.

[0192] In some implementations, the probes used are detectably tagged, and detection is accomplished by detecting the probe tag on each amplification product. A quencher can be further associated with this detectable tag, preventing the detection of the tag before it reaches the target of the amplification probe. TaqMan® probes are examples of these probes.

[0193] TaqMan® probes (Heid et al., Genome Res. 6: 986-994, 1996) use the fluorescent 5' exonuclease activity of Taq polymerase to measure the amount of a target sequence in a DNA sample. TaqMan® probes are oligonucleotides that typically contain a donor fluorophore at or near the 5' base and a quencher module typically at or near the 3' base. The quencher module can be a dye such as TAMRA or a non-fluorescent molecule such as 4-(4-dimethylaminophenylazo)benzoic acid (DABCYL). See Tyagi et al., 16 Nature Biotechnology 49-53 (1998). Upon irradiation, the excited fluorescent donor transfers energy to the nearby quencher module via FRET rather than fluorescence. Therefore, the close proximity of the donor and quencher prevents the emission of donor fluorescence while the probe remains intact.

[0194] TaqMan® probes are designed to anneal to the internal regions of PCR products. When the polymerase replicates the template bound to the TaqMan probe, its 5' exonuclease activity cleaves the probe. This terminates the activity of the quencher (without FRET), and the donor fluorophore begins to emit fluorescence, which increases proportionally to the probe cleavage rate in each cycle. Accumulation of PCR products is detected by monitoring the increase in fluorescence of the reporter dye. If the quencher is a acceptor fluorophore, accumulation of PCR products can be detected by monitoring the decrease in fluorescence of the acceptor fluorophore.

[0195] In some implementations, real-time PCR is performed using a bifunctional primer-probe detection system (e.g., Scorpion™ primers). With Scorpion primers, sequence-specific priming and PCR product detection are achieved using a single molecule. Scorpion primers maintain a stem-loop configuration in the unhybridized state. The fluorophore is attached to the 5' end and quenched by a module coupled to the 3' end, although this arrangement can be reversed in some implementations. The 3' portion of the stem and / or loop also contains a sequence complementary to the primer extension product and linked to the 5' end of the specific primer via a non-amplifiable monomer. After primer module extension, the specific probe sequence is able to bind to its complementary sequence within the extended amplicon, thereby opening the hairpin loop. This prevents fluorescence quenching, and the signal can be observed. The specific target is amplified using a reverse primer and the primer portion of the Scorpion™ primer, yielding the extension product. The binding of the probe element of the Scorpion™ primer to the extension product causes the fluorophore to separate from the quencher, generating a fluorescent signal.

[0196] In some embodiments, the probes used in the disclosed methods comprise, or constitute, short fluorescently labeled DNA sequences designed to detect segments of DNA sequences with genetic variation, such as those disclosed in French et al., Mol Cell Probes, 5(6):363-74 (2001), which is incorporated herein by reference in its entirety. HyBeacons® is an example of this type of probe.

[0197] In some embodiments of this method, at least one probe in the amplification reaction, or at least one primer in each primer pair, includes a detectable module. Alternatively, the detectable module may be on a probe attached to a primer, such as a primer-probe pair. In some embodiments, the detectable module or tag is a fluorophore.Suitable fluorescent modules include, but are not limited to, the following fluorophores: 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid, acridine and its derivatives (acrididine, acridine isothiocyanate), Alexa Fluors (AlexaFluor® 350, AlexaFluor® 488, AlexaFluor® 546, AlexaFluor® 555, AlexaFluor® 568, AlexaFluor® 594, AlexaFluor® 647 (Molecular Probes)), 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS), 4-amino-N-[3-vinylsulfonyl]phenyl]naphthalimide-3,5-disulfonate. (Lucifer Yellow VS), N-(4-anilino-1-naphthyl)maleimide, anthranilamide, BODIPY® R-6G, BODIPY® 530 / 550, BODIPY® FL, Brilliant Yellow, Cal Fluor Red 610® (CFR610), coumarins and derivatives (coumarins, 7-amino-4-methylcoumarin (AMC, coumarin 120), 7-amino-4-trifluoromethylcoumarin (coumarin 151)), Cy2®, Cy3®, Cy3.5®, Cy5®, Cy5.5®, cyanosine, 4',6-diamino-2-phenylindole (DAPI), 5',5''-dibromopyrogallol-sulfonephthalein (Bromopyrogallol Red), 7-diethylamino-3-(4'-isothiocyanate-phenyl)-4-methylcoumarin, diethylenetriaminepentaacetic acid, 4,4'-diisothiocyanate-dihydro-stilbene-2,2'-disulfonic acid, 4,4'-diisothiocyanate-stilbene-2,2'-disulfonic acid, 5-[dimethylamino]naphthalene-1-sulfonyl chloride (DNS, dansyl chloride), 4-(4'-dimethylaminophenylazo)benzoic acid (DABCYL), 4-dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC), Eclipse. TM(Epoch Biosciences Inc.), Eosin and its derivatives (Eosin, Eosin isothiocyanate), Erythrosin and its derivatives (Erythrosin B, Erythrosin isothiocyanate), Ethidium, Fluorescein and its derivatives (5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazine-2-yl)aminofluorescein (DTAF), 2',7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), Fluorescein, Fluorescein isothiocyanate (FITC), Hexachloro-6-carboxyfluorescein (HEX), QFITC ​​(XRITC), Tetrachlorofluorescein (TET), Fluorescein, IR144, IR1446, Lanthamide phosphors, Malachite green isothiocyanate, 4-methylumbelliferone, o-cresolphthalein, nitrotyrosine, pararosaniline, phenol red, B-phycoerythrin, R-phycoerythrin, allophycocyanin, o-phthalaldehyde, Oregon Green (Oregon Green)®, propidium iodide, pyrene and its derivatives (pyrene, pyrene butyrate, succinimide-1-pyrene butyrate), QSY® 7, QSY® 9, QSY® 21, QSY® 35 (molecular probe), Reactive Red 4 (Cibacron® Brilliant Red 3B-A), Rhodamine and its derivatives (6-carboxy-X-rhodamine (ROX), 6-carboxy-rhodamine (R6G), Rhodamine B sulfonyl chloride, Rhodamine (Rhodamine), Rhodamine B, Rhodamine 123, Rhodamine Green, Rhodamine X isothiocyanate, sulfonyl rhodamine B, sulfonyl rhodamine 101, sulfonyl chloride derivatives of sulfonyl rhodamine 101 (Texas Red) (Texas Red), N,N,N',N'-Tetramethyl-6-carboxyrhodamine (TAMRA), Tetramethylrhodamine, Tetramethylrhodamine isothiocyanate (TRITC), Riboflavin, Rose acid, Terbium chelate derivatives, Quasar 670® and VIC®.

[0198] Select a suitable quencher based on the fluorescence spectrum of the specific fluorophore. Useful quenchers include, for example, BlackHole™ quenchers BHQ-1, BHQ-2, and BHQ-3 (Biosearch Technologies, Inc.) and the ATTO series of quenchers (ATTO 540Q, ATTO 580Q, and ATTO 612Q; Atto-Tec GmbH).

[0199] In some embodiments of this method, the reaction sample mixture is subjected to real-time polymerase chain reaction (PCR) conditions under which target nucleic acids present in the biological sample are amplified, and the amplification products are detected and measured. In some embodiments, the biological sample is loaded directly into a direct amplification disk without separate front-end sample preparation, and then real-time PCR detection and differentiation of the target analytes are performed in the same disk. In some embodiments, amplification is performed in a direct amplification disk (an 8-well disk from FocusDiagnostics, Inc.). In some embodiments, real-time PCR amplification is performed in the direct amplification disk using SIMPLEXA direct assay, and detection is performed using an integrated thermal cycler (such as the 3M™ Integrated Cyclist sold by 3M™ (St. Paul, Minn., USA)). The 3M™ Integrated Cyclist can accommodate direct amplification disks and is capable of multiple assays per disk. This device can heat >5°C per second and cool >4°C per second. Cycling parameters can be varied depending on the length of the amplification product to be extended. In some embodiments, using oligonucleotide primers, probes, and / or primer-probe combinations, an internal positive amplification control (IPC) may be included in the sample.

[0200] Alternative methods for detecting target nucleic acids

[0201] Alternatively, the target nucleic acid can be detected by measuring the endpoint of the reaction. In endpoint detection, amplicons can be detected by first separating them by size and then detecting the separated amplicons. Separation of amplicons of different sizes can be accomplished by gel electrophoresis, column chromatography, capillary electrophoresis, or other separation methods known in the art.

[0202] Detectable tags can be incorporated into nucleic acids, binding to or conjugating to them. Tags can be attached via spacer arms of various lengths to reduce potential steric hindrance or impact on other useful or desired properties. See, for example, Mansfield, 9 Mol. Cell. Probes 145-156 (1995). Detectable tags can be incorporated into nucleic acids by covalent or non-covalent means, such as transcription (e.g., using random primers with Klenow polymerase), nick translation, amplification, or equivalents known in the art. For example, nucleotide bases can be conjugated to a detectable module such as a fluorescent dye and then incorporated into the nucleic acid during synthesis or amplification.

[0203] Examples of other useful tags that can help detect target nucleic acids include radioisotopes (e.g., 32 P, 35 S, 3 H, 14 C, 125 I, 131I) Electro-dense reagents (e.g., gold), enzymes (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), colorimetric tags (e.g., colloidal gold), magnetic labels (e.g., Dynabeads™), biotin, dioxigenin, or haptens and proteins from which antiserum or monoclonal antibodies are obtained. Other tags include ligands or oligonucleotides capable of forming complexes with corresponding receptors or oligonucleotide complements. The tag may be directly incorporated into the nucleic acid to be detected, or it may be attached to a probe (e.g., an oligonucleotide) or antibody that hybridizes or binds to the nucleic acid to be detected.

[0204] In other embodiments, fluorescent nucleotide analogs can be used to label nucleic acids, see, for example, Jameson, Methods. Enzymol. 278: 363-390 (1997); Zhu, Nucl. Acids Res. 22: 3418-3422 (1994). U.S. Patent Nos. 5,652,099 and 6,268,132 also describe nucleoside analogs that are incorporated into nucleic acids (e.g., DNA and / or RNA) or oligonucleotides by enzymatic or chemical synthesis to produce fluorescent nucleotides. U.S. Patent No. 5,135,717 describes phthalocyanine and tetrabenztriazaporphyrin reagents used as fluorescent labels.

[0205] In some embodiments, detectable labeled probes can be used in hybridization assays to detect target nucleic acid sequences within biological samples. These assays include, but are not limited to, Northern blotting, Southern blotting, microarrays, dot or slit blotting, and in situ hybridization assays such as fluorescence in situ hybridization (FISH). Some embodiments may employ hybridization methods to measure the expression of polynucleotide gene products (such as mRNA). Methods for performing polynucleotide hybridization assays have been well developed in the art. Hybridization procedures and conditions vary depending on the application and are selected based on known general binding methods, including those mentioned below: Maniatis et al., Molecular Cloning: A Laboratory Manual (2nd ed. ColdSpring Harbor, NY, 1989); Berger and Kimmel, Methods in Enzymology, Vol. 152, Guide to Molecular Cloning Techniques (Academic Press, Inc., San Diego, Calif, 1987); Young and Davis, PNAS. 80: 1194 (1983).

[0206] This technology for screening and determining Bordetella spp.

[0207] The genome of *Bordedia hopterii* typically contains approximately 3–5 copies of the hIS1001 sequence and 8–10 copies of the IS481 sequence. The genome of *Bordedia parapertussis* typically contains approximately 20 copies of the IS1001 sequence. *Bordedia pertussis* typically contains approximately 50–200 copies of the IS481 sequence.

[0208] In various embodiments of this disclosure, primers and probes are used in the methods described herein to amplify and detect target nucleic acid sequences of pathogenic Bordetella species. In some embodiments, the target nucleic acid may include an IS481 insert sequence (and fragment thereof) from Bordetella pertussis and Bordetella hominis, an IS1001 insert sequence (and fragment thereof) from Bordetella parapertussis, and an hIS1001 insert sequence (and fragment thereof) from Bordetella hominis. Additionally, primers may be used to amplify one or more control nucleic acid sequences.

[0209] In some implementations, the control nucleic acid sequence includes 5'TAACCCCGCGATAAAGACAGAAGATTATGCATACGAGATCAAAGGAGCCGGCCTTTTCTCTAGAGATCTCTTATTTTCCTTGAAGTCACCTGTTTATGTTAAAGCAGGTGAGCAGGTATACATTCAGTACGATCTGAACAAAAGCAATGCAGAACTTGCTCTCGACTATGGTTTTGTGGAATCAAACCCTAAACGGAACTCATATACTTTAACAATAGAGATACCAGAATCAGACCCATTCTTTGGGGATAAGTTGGATATTGCTGAGAGTAACAAGATGGGTGAGACCGGATACTTTGACATAGTAGACGGCCAGACTCTTCCCGCTGGTAT GC TTCAGTACCTTCGGCTTGTGGCTCTTGGCGGTCCAGATGCTTCTTATTAGAATCTATCTTCAATAACACCATATG GGGTCATCTTGAATTGCCTGTAAGTCGTACAAACGAGGAACTCATATGCCGTGTTGTCAGAGATGCCTGCAAThe sequence ATCTGCTCTGTCTGGTTTTGATACGACCATTGAAGAGGATGAGAAGCTTCTGGACAAAGGAAAGCTTGAGCCTAGGTTGGAAATGGCTCTCAAG 3' (SEQ ID NO: 13), including a forward primer of 5'GCTTCAGTACCTTCGGCTTG 3' (SEQ ID NO: 17), a reverse primer of 5'TTGCAGGCATCTCTGACAAC 3' (SEQ ID NO: 18), and a detectable labeled nucleic acid probe of 5'TGGCTCTTGGCGGTCCAGATG 3' (SEQ ID NO: 19) are used to amplify the control nucleic acid sequence. In some embodiments, the control target nucleic acid includes 5'GCTTCAGTACCTTCGGCTTGTGGCTCTTGGCGGTCCAGATGCTTTCTTATTAGAATCTATCTTCAATAACACCATATGGGGTCATCTTGAATTGCCTGTAAGTCGTACAAACGAGGAACTCATATGCCGTGTTGTCAGAGATGCCTGCAA 3' (SEQ ID NO: 20).

[0210] The primers and probes of this technology are used in the methods described herein to amplify and detect target nucleic acids including SEQ ID NO: 1 corresponding to the IS481 repeat element, target nucleic acids including SEQ ID NO: 2 corresponding to the IS1001 repeat element, and target nucleic acids including SEQ ID NO: 3 corresponding to the hIS1001 repeat element. In one embodiment, the method involves using primer pairs specifically targeting the IS481, IS1001, and hIS1001 repeat elements. Using separate tags for each target, the target nucleic acids described herein can be detected individually or in multiplexes.

[0211] Specific primers, probes, and primers / probes used to amplify and detect all or fragments of marker genes specific to *Bordetella hominis*. These include sequences specific to *Bordetella hominis* but not to other *Bordetella* species. Detection of *Bordetella hominis*-specific genes helps distinguish samples containing *Bordetella hominis* from those containing another pathogenic species, such as *Bordetella pertussis*. A suitable marker gene is the hIS1001 multiple copy insert sequence (see, e.g., GenBank accession number AY786982.1), as shown below.

[0212]

[0213] (SEQ ID NO: 14)

[0214] The nucleic acid sequences of the hIS1001 amplicon generated using the methods disclosed herein are underlined.

[0215] In some implementations, the hIS1001 target nucleic acid includes 5' GGCACGGATCGAGGTTTTTGCGATTGCGCAGCAGTAGCCAGCGACTGGACTTGATCACCCGGCGGGCCGGCTTGTCGTGCCGCAACTGGTTCGCTTGGTCTACACGCACCCGGTCTATCACTTCACGGCCGTA 3' ( SEQ ID NO: 3) or a fragment thereof. Indicative primer and labeled probe sequences for amplifying and detecting hIS1001 repeat elements include:

[0216]

[0217] The nucleotide sequence of *Bordedia pertussis* IS1001 is provided in GenBank accession number JX013521.1 and is shown below. The nucleic acid sequences of the IS1001 amplicons generated using the methods disclosed herein are underlined:

[0218]

[0219] (SEQ ID NO: 15)

[0220] In some embodiments, the IS1001 target nucleic acid includes 5' CGGCTCGACGAATTGCTGCAAGCCAACCAGCCGCTGCTGACGGTCTATGTCCTGCGTGACGAACT 3' (SEQ ID NO: 2) or a fragment thereof. Indicative primer and labeled probe sequences for amplifying and detecting the IS1001 multiple copy insert sequence (see, for example, GenBank accession number JX013521.1) include:

[0221]

[0222] The nucleotide sequence of *Bordedia pertussis* IS481 is provided in GenBank accession number AB473880.1 and is shown below. The nucleic acid sequences of the IS481 amplicons generated using the methods disclosed herein are underlined:

[0223]

[0224] (SEQ ID NO: 16)

[0225] In some embodiments, the IS481 target nucleic acid includes 5' CCATAAGCATGCCCGATTGACCTTCCTACGTCGACTCGAAATGGTCCAGCAATTGATCGCCCATCAAGTTTGTGTGCCTGAAGCG 3' (SEQ ID NO: 1) or a fragment thereof. Indicative primer and labeled probe sequences for amplifying and detecting the IS481 multiple copy insertion sequence (see, for example, GenBank accession number AB473880.1) include:

[0226]

[0227] Therefore, the qualitative detection and differentiation of *Bordedia hopterii* and *Bordedia pertussis* using the method of this disclosure can be performed on a direct amplification disk with an integrated circulator system using primer pairs, labeled probes, and real-time PCR for amplifying and detecting IS481, IS1001, and hIS1001 repeat elements. Using this method, target genomic DNA is specifically amplified and simultaneously detected in the same reaction by fluorescently labeled probes. Probes specifically hybridizing with hIS1001 repeat elements may include a JOE tag, and probes specifically hybridizing with IS481 and IS1001 repeat elements may include a FAM tag and a CFR610 tag, respectively. Probes specifically hybridizing with control target nucleic acids may include a Q670 fluorophore.

[0228] Therefore, in one aspect, this disclosure provides a method for detecting the presence of at least one pathogenic Bordetella species in a biological sample, comprising: (a) contacting the biological sample with: (i) a first primer pair amplifying the IS481 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence; (ii) a second primer pair amplifying the IS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence; and (iii) a third primer pair amplifying the hIS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence. 3 or its complementary sequence being at least 85-95% identical nucleotides; generating a reaction-sample mixture in which amplification of the target nucleic acids IS481, IS1001, and hIS1001 (if present in the biological sample) occurs without extracting the target nucleic acids from the biological sample; (b) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to produce a fluorescent signal; (c) detecting the fluorescent signal generated by the amplified target nucleic acids produced in step (b); and (d) detecting the presence of at least one pathogenic Bordetella species in the biological sample by evaluating the fluorescent signal of each target nucleic acid, thereby (i) detecting Bordetella holmesii in the biological sample when a fluorescent signal against the hIS1001 target nucleic acid is detected; and (ii) detecting Bordetella parapertussis in the biological sample when a fluorescent signal against the IS1001 target nucleic acid is detected. (iii) When a fluorescent signal against the IS481 target nucleic acid is detected and no fluorescent signal against hIS1001 is detected, *B. pertussis* is detected in the biological sample, wherein the pathogenic *B. pertussis* species is one or more of *B. pertussis*, *B. parapertussis*, and *B. hominis*; and wherein the biological sample is not subjected to extraction or purification steps prior to amplification. Real-time PCR amplification can be performed in a direct amplification tray in conjunction with an integrated thermal cycler. The biological sample may include nasopharyngeal (NP) aspirates or washes, nasal swabs, or bacterial isolates.

[0229] Treatment of Bordetella infections

[0230] This article discloses a method for determining whether a patient exhibiting pertussis-like symptoms would benefit from treatment with a therapeutic agent that inhibits Bordetella hominis, either alone or in combination with a therapeutic agent that targets other pathogenic Bordetella species.

[0231] Examples of therapeutic agents that inhibit *Bordeza hominis* include fluoroquinolones, carbapenems, trimethoprim-sulfamethoxazole (e.g., Bactrim, Septra), and *Bordeza hominis*-specific antibodies. In some embodiments, the fluoroquinolones are selected from the group consisting of ciprofloxacin, gemifloxacin, levofloxacin, norfloxacin, ofloxacin, trovafloxacin, gatifloxacin, grefloxacin, timafloxacin, lomifloxacin, sparfloxacin, enoxacin, and moxifloxacin. In some embodiments, the carbapenems are selected from the group consisting of imipenem, meropenem, ertapenem, doribenem, panipenem, biapenem, azupenem (PZ-601), telbipenem, lenapenem, tomopenem, and thiampenem (thiamycin).

[0232] Examples of therapeutic agents that inhibit Bordetella pertussis include whole-cell (wP) Bordetella pertussis vaccines, acellular Bordetella pertussis vaccines, trimethoprim-sulfamethoxazole (e.g., Bactrim, Septra), telithromycin, and macrolide antibiotics. In some embodiments, the macrolide antibiotic is selected from the group consisting of azithromycin (Zithromax), clarithromycin (Biaxin), erythromycin (E-Mycin, Eryc, Ery-Tab, PCE, Pediazole, tasteless erythromycin), and roxithromycin.

[0233] Examples of therapeutic agents that inhibit Bordetella parapertussis include trimethoprim-sulfamethoxazole (e.g., Bactrim, Septra), ciprofloxacin, gemifloxacin, levofloxacin, norfloxacin, ofloxacin, trovafloxacin, gatifloxacin, grefloxacin, temfloxacin, lomifloxacin, sparfloxacin, enoxacin, and moxifloxacin.

[0234] In one aspect, this disclosure provides a method for selecting a patient exhibiting pertussis-like symptoms to treat with a therapeutic agent inhibiting *Bordeza hominis*, comprising: (a) contacting a biological sample obtained from the patient with: (i) a first primer pair amplifying the target nucleic acid IS481, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence; (ii) a second primer pair amplifying the target nucleic acid IS1001, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence; and (iii) a third primer pair amplifying the target nucleic acid hIS1001, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence. 3. Nucleotides that are at least 85-95% identical to the complementary sequence of the biological sample; (b) generating a reaction-sample mixture in which the amplification of the target nucleic acids IS481, IS1001 and hIS1001 (if present in the biological sample) occurs without extracting the target nucleic acids from the biological sample; (c) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to produce a fluorescent signal; (d) detecting the fluorescent signal generated by the amplified target nucleic acids produced in step (b); and (e) if a fluorescent signal against the hIS1001 target nucleic acid is detected, selecting a patient to be treated with a therapeutic agent that inhibits Bordetella hominis, wherein the biological sample is not subjected to an extraction or purification step prior to amplification.

[0235] In some embodiments, the therapeutic agent for inhibiting *Bordeza hominis* is one or more agents selected from the group consisting of fluoroquinolones, carbapenems, trimethoprim-sulfamethoxazole, and *Bordeza hominis*-specific antibodies. In some embodiments, the fluoroquinolone is selected from the group consisting of ciprofloxacin, gemifloxacin, levofloxacin, norfloxacin, ofloxacin, trovafloxacin, gatifloxacin, grefloxacin, timafloxacin, lomifloxacin, sparfloxacin, enoxacin, and moxifloxacin. In some embodiments, the carbapenem is selected from the group consisting of imipenem, meropenem, ertapenem, doribenem, panipenem, biapenem, azupenem (PZ-601), telbipenem, lenapenem, tomopenem, and thiampenem (thiamycin).

[0236] In one aspect, this disclosure provides a method for selecting patients exhibiting pertussis-like symptoms to be treated with a *Bordeza hominis*-specific antibody and an additional therapeutic agent inhibiting *Bordeza parapertussis*, comprising: (a) contacting a biological sample obtained from the patient with: (i) a first primer pair amplifying the IS481 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence; (ii) a second primer pair amplifying the IS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence; and (iii) a third primer pair amplifying the hIS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence. 3. Nucleotides that are at least 85-95% identical to the complementary sequence of the biological sample; (b) generating a reaction-sample mixture in which the amplification of the target nucleic acids IS481, IS1001 and hIS1001 (if present in the biological sample) occurs without extracting the target nucleic acids from the biological sample; (c) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to produce a fluorescent signal; (d) detecting the fluorescent signal generated by the amplified target nucleic acids produced in step (b); and (e) if a fluorescent signal for hIS1001 and a fluorescent signal for the target nucleic acid IS1001 are detected, selecting the patient to be treated with Bordetella hominis specific antibodies and additional therapeutic agents, wherein the biological sample is not subjected to extraction or purification steps prior to amplification.

[0237] In some implementations, the additional therapeutic agent for inhibiting Bordetella parapertussis is one or more agents selected from the group consisting of: trimethoprim-sulfamethoxazole, ciprofloxacin, gemifloxacin, levofloxacin, norfloxacin, ofloxacin, trovafloxacin, gatifloxacin, grefloxacin, temfloxacin, lomifloxacin, sparfloxacin, enoxacin, and moxifloxacin.

[0238] In another aspect, this disclosure provides a method for selecting a patient exhibiting pertussis-like symptoms to be treated with a therapeutic agent inhibiting Bordetella pertussis and an additional therapeutic agent inhibiting Bordetella parapertussis, comprising: (a) contacting a biological sample obtained from the patient with: (i) amplifying a first primer pair of IS481, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence; (ii) amplifying a second primer pair of IS1001, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence; and (iii) amplifying a third primer pair of hIS1001, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence. 3. Nucleotides that are at least 85-95% identical or complementary to the biological sample; (b) generating a reaction-sample mixture in which amplification of the target nucleic acids IS481, IS1001, and hIS1001 (if present in the biological sample) occurs without extracting the target nucleic acids from the biological sample; (c) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to produce a fluorescent signal; (d) detecting the fluorescent signal generated by the amplified target nucleic acids produced in step (b); and (e) if (i) a fluorescent signal for the target nucleic acid IS481 and a fluorescent signal for the target nucleic acid IS1001 are detected, and (ii) no fluorescent signal for the target nucleic acid hIS1001 is detected, then selecting the patient to be treated with a therapeutic agent for inhibiting Bordetella pertussis and an additional therapeutic agent for inhibiting Bordetella parapertussis, wherein the biological sample is not subjected to an extraction or purification step prior to amplification.

[0239] In some embodiments of this method, the additional therapeutic agent for inhibiting Bordetella parapertussis is one or more agents selected from the group consisting of: trimethoprim-sulfamethoxazole, ciprofloxacin, gemifloxacin, levofloxacin, norfloxacin, ofloxacin, trovafloxacin, gatifloxacin, grefloxacin, temafloxacin, lomifloxacin, sparfloxacin, enoxacin, and moxifloxacin.

[0240] In some embodiments of this method, the therapeutic agent inhibiting Bordetella pertussis is one or more agents selected from the group consisting of whole-cell (wP) Bordetella pertussis vaccine, acellular Bordetella pertussis vaccine, telithromycin, and macrolide antibiotics. In some embodiments, the macrolide antibiotic is selected from the group consisting of azithromycin (Zithromax), clarithromycin (Biaxin), erythromycin (E-Mycin, Eryc, Ery-Tab, PCE, Pediazole, odorless erythromycin (Ilosone)), and roxithromycin.

[0241] algorithm

[0242] In performing real-time PCR on the sample-reaction mixture and detecting and measuring fluorescence signals associated with amplified IS481, IS1001, and hIS1001 target repeat elements, the method of this technique also provides an algorithm for determining the presence of one or more associated pathogenic Bordetella species (i.e., Bordetella pertussis, Bordetella parapertussis, and Bordetella hominis) by matching a cycle threshold (Ct) from the amplified target nucleic acid sequence to provide the final result.

[0243] In some implementations, the hIS1001 target nucleic acid sequence is amplified using a probe labeled with JOE, the IS1001 target nucleic acid sequence is amplified using a probe labeled with an oxanthracene dye (such as CFR610) that fluoresces in the red region of the visible spectrum, and the IS481 target nucleic acid sequence is amplified using a probe labeled with a fluorescein imide fluorophore (such as FAM). Therefore, the hIS1001 signal is detected via the JOE fluorophore, the IS1001 signal is detected via the CFR610 fluorophore, and the IS481 signal is detected via the FAM fluorophore.

[0244] The algorithm for calculating the number of Bordetella species is as follows:

[0245]

[0246] N / A = The detected signal is not suitable for analysis.

[0247] Therefore, the presence or absence of pathogenic Bordetella species in a sample can be determined based on the following:

[0248] (1) Samples with a detectable signal (FAM) for the IS481 target nucleic acid sequence but no detectable CFR610 signal for IS1001 and no detectable JOE signal for hIS1001 were interpreted as containing only Bordetella pertussis.

[0249] (2) Samples with a detectable signal for the target nucleic acid sequence of IS1001 (CRF610) but no detectable FAM signal for IS481 and no detectable JOE signal for hIS1001 were interpreted as containing only Bordetella parapertussis.

[0250] (3) Samples with a detectable signal (JOE) for the hIS1001 target nucleic acid sequence but without a detectable CRF610 signal for IS1001 were interpreted as containing only Bordetella hominis.

[0251] (4) When fluorescence signals for the target nucleic acid sequence IS481 (FAM) and IS1001 (CRF610) are detected, but fluorescence signals for hIS1001 (JOE) are not detected, the sample is identified as containing both Bordetella pertussis and Bordetella parapertussis.

[0252] (5) When a fluorescent signal for the IS1001 target nucleic acid sequence (CRF610) and a fluorescent signal for the hIS1001 target nucleic acid sequence (JOE) are detected, the sample is identified as containing both Bordetella hominis and Bordetella parapertussis.

[0253] (6) Samples lacking detectable signals for IS481 (FAM), IS100 (CFR610) and hIS1001 (JOE) were interpreted as negative for Bordetella pertussis, Bordetella parapertussis and Bordetella hominis.

[0254] Reagent test kit

[0255] This disclosure also provides a kit for detecting target nucleic acid sequences corresponding to pathogenic Bordetella species.

[0256] The kit of this technology includes at least two oligonucleotides that can be used as primers or primer-probes to amplify one or more multicopy insertion sequences to determine the presence of pathogenic Bordetella species in biological samples. The multicopy insertion sequences are selected from the group consisting of IS481, IS1001, and hIS1001.

[0257] In some embodiments, the kit of this technology includes a single primer pair that specifically hybridizes to a target nucleic acid selected from the group consisting of IS481, IS1001, and hIS1001. In other embodiments, the kit of this technology includes multiple primer pairs, including a first primer pair that specifically hybridizes to the target nucleic acid of IS481, and a second primer pair that specifically hybridizes to the target nucleic acid of IS1001 or hIS1001. In some embodiments, the kit of this technology includes a pair of primer pairs, including a first primer pair that specifically hybridizes to the target nucleic acid of IS1001, and a second primer pair that specifically hybridizes to the target nucleic acid of hIS1001. In some embodiments, the kit of this technology includes multiple primer pairs, including a first primer pair that specifically hybridizes to the target nucleic acid of IS481, a second primer pair that specifically hybridizes to the target nucleic acid of IS1001, and a third primer pair that specifically hybridizes to the target nucleic acid of hIS1001. In any of the above embodiments, the target nucleic acid of IS481 corresponds to SEQ ID NO: 1; the target nucleic acid of IS1001 corresponds to SEQ ID NO: 2; and the target nucleic acid of hIS1001 corresponds to SEQ ID NO: 3.

[0258] In some embodiments, the kit includes a first primer pair capable of specifically hybridizing with the IS481 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 1 or its complementary sequence. Alternatively, the kit includes a second primer pair capable of specifically hybridizing with the IS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 2 or its complementary sequence. Alternatively, the kit includes a third primer pair capable of specifically hybridizing with the hIS1001 target nucleic acid, comprising nucleotides at least 85-95% identical to SEQ ID NO: 3 or its complementary sequence.

[0259] In some embodiments, the kit includes one or more primer pairs selected from the following: 5'CCATAAGCATGCCCGATT 3' (SEQ ID NO: 11) and 5'CGCTTCAGGCACACAAACT 3' (SEQ ID NO: 10) (IS481 primer pair); 5'CGGCTCGACGAATTGC 3' (SEQ ID NO: 7) and 5'AGTTCGTCACGCAGGACAT 3' (SEQ ID NO: 8) (IS1001 primer pair); and 5'GGCACGGATCGAGGTTTTT 3' (SEQ ID NO: 4) and 5'TACGGCCGTGAAGTGATAGA 3' (SEQ ID NO: 5) (hIS1001). Alternatively, the kit may include an internal control primer pair consisting of a forward primer and a reverse primer, wherein the forward primer comprises 5' GCTTCAGTACCTTCGGCTTG 3' (SEQ ID NO: 17) and the reverse primer comprises 5'TTGCAGGCATCTCTGACAAC 3' (SEQ ID NO: 18).

[0260] Alternatively, in some embodiments, the kit provides a single nucleic acid probe that specifically hybridizes to a target nucleic acid selected from the group consisting of a single multicopy insert sequence: IS481, IS1001, and hIS1001. In other embodiments, the kit of this technology includes multiple nucleic acid probes, including a first nucleic acid probe that specifically hybridizes to a target nucleic acid of IS481, and a second nucleic acid probe that specifically hybridizes to a target nucleic acid of IS1001 or hIS1001. In some embodiments, the kit of this technology includes multiple nucleic acid probes, including a first nucleic acid probe that specifically hybridizes to a target nucleic acid of IS1001, and a second nucleic acid probe that specifically hybridizes to a target nucleic acid of hIS1001. In some embodiments, the kit of this technology includes multiple nucleic acid probes, including a first nucleic acid probe that specifically hybridizes to a target nucleic acid of IS481, a second nucleic acid probe that specifically hybridizes to a target nucleic acid of IS1001, and a third nucleic acid probe that specifically hybridizes to a target nucleic acid of hIS1001.

[0261] In some embodiments, the first nucleic acid probe is capable of hybridizing with the IS481 target nucleic acid segment of SEQ ID NO: 1 or its complementary sequence, and is fluorophoretically labeled. Alternatively, in some embodiments, the second nucleic acid probe is capable of hybridizing with the IS1001 target nucleic acid segment of SEQ ID NO: 2 or its complementary sequence, and is fluorophoretically labeled. In some embodiments, the third nucleic acid probe is capable of specifically hybridizing with the hIS1001 target nucleic acid segment of SEQ ID NO: 3 or its complementary sequence, and is fluorophoretically labeled.

[0262] In some embodiments, the kit includes one or more nucleic acid probes selected from the following: 5'TCAATTGCTGGACCATTTCGAGTCGAC 3' (SEQ ID NO: 12) or its complementary sequence (IS481 probe); 5'CAACCAGCCGCTGCTGACGGTC 3' (SEQ ID NO: 9) or its complementary sequence (IS1001 probe); and 5'AGTCGCTGGCTACTGCTGCGCA 3' (SEQ ID NO: 6) or its complementary sequence (hIS1001 probe). Alternatively, the kit may include an internal control nucleic acid probe comprising 5'TGGCTCTTGGCGGTCCAGATG 3' (SEQ ID NO: 19) or its complementary sequence.

[0263] In some embodiments, the kit includes a liquid medium containing at least one target-specific nucleic acid probe at a concentration of 250 nM or less. Using this kit, probes are provided in the required amount for reliable multiplex detection reactions according to this technology. In some embodiments, the target-specific nucleic acid probe is detectably labeled.

[0264] In some embodiments, the kit further includes a buffer, an enzyme with polymerase activity, and an enzyme with polymerase activity but lacking a 5' ohm. 3' exonuclease activity or 5' 3' and 3' 5' exonuclease activity refers to the enzyme, enzyme cofactors such as magnesium or manganese, salts, chain-extending nucleotides such as deoxyribonucleoside triphosphates (dNTPs), modified dNTPs, nuclease-resistant dNTPs, or labeled dNTPs, which are necessary for performing assays or reactions (such as amplification and / or detection of target nucleic acid sequences corresponding to pathogenic Bordetella species).

[0265] In one embodiment, the kit of this technology further includes a positive control nucleic acid sequence and a negative control nucleic acid sequence to ensure the integrity of the assay during the experiment. The kit may further include means for comparing the copy numbers of one or more of IS481, IS1001, and hIS1001 in biological samples and control nucleic acid samples (e.g., for samples with known copy numbers of one or more of IS481, IS1001, and hIS1001). The kit also includes instructions for use, automated analysis software, containers, packaging such as packaging for commercial sale, etc.

[0266] The kit may further include one or more of the following: wash buffer and / or reagents, hybridization buffer and / or reagents, labeling buffer and / or reagents, and detection methods. These buffers and / or reagents are typically optimized for the specific amplification / detection technique used in the kit. Protocols for performing different steps of the method using these buffers and reagents may also be included in the kit.

[0267] The kit may also include an assay definition scan card and / or instructions, such as a printed or electronic instruction manual for using oligonucleotides in the assay. In some embodiments, the kit includes an amplification reaction mixture or amplification master mixture. The reagents included in the kit may be contained in one or more containers, such as vials.

[0268] Primers, probes, and / or primer-probe pairs specific for amplifying and detecting the internal control DNA can be included in the amplification master mix as target primer pairs to monitor for potential PCR inhibition. Reagents necessary for amplifying and detecting the target and internal control can be formulated into an integrated amplification master mix, which is provided in the kit as a single-reaction aliquot.

[0269] Example

[0270] Example 1: Detection of pathogenic Bordetella species by direct real-time PCR using SIMPLEXA

[0271] Nasopharyngeal swab samples were collected from the patient. 50 μL of unprocessed and undiluted nasal swab samples were directly loaded into the sample well of wedge 1 of the SIMPLEXA direct amplification disk (Focus Diagnostics, Inc., Cypress, CA, USA) without a separate front-end sample preparation step.

[0272] 50 μL of the amplification master mixture was aspirated into the reaction well of wedge 1 of the disk. This amplification master mixture included PCR buffer, DNA polymerase, dNTPs, magnesium chloride, potassium chloride, primers consisting of SEQ ID NOs: 4-5, 7-8, and 10-11, probes consisting of SEQ ID NOs: 6, 9, and 12, an internal control DNA fragment (SEQ ID NO: 13), and primer pairs and probes specific to the control fragment (SEQ ID NOs: 17-19). TaqMan probes consisting of SEQ ID NOs: 6, 12, 9, and 19 were labeled with JOE, FAM, CFR610, and Q670, respectively. Positive and negative controls containing cultured *Bordedia pertussis*, *Bordedia parapertussis*, and *Bordedia hopnea* were included in the assay.

[0273] Use foil to calibrate the wedge, then insert the direct amplification disk into the 3M. TM Real-time PCR was initiated in an integrated cyclic analyzer (3M, St. Paul, MN, USA). The PCR cycling conditions included the following steps: i) preheating the sample at 75°C for 300 seconds, one cycle; ii) polymerase activation at 97°C for 120 seconds, one cycle; and iii) denaturation at 97°C for 10 seconds and annealing at 56°C for 30 seconds, for 40 cycles. Specific fluorescence threshold concentrations corresponding to the amplicon of IS481, IS1001, and hIS1001 were set at 2000, 5000, and 2000, respectively.

[0274] The presence of pathogenic Bordetella species was determined by using fluorescently labeled probes to specifically amplify and simultaneously detect target genomic DNA in the same reaction. The algorithm evaluates the cycling threshold (Ct) in the FAM, JOE, and CFR610 channels to provide the final result.

[0275] (1) Samples with detectable FAM signals but no detectable CFR610 and JOE signals were interpreted as positive for Bordetella pertussis.

[0276] (2) Samples with detectable CFR610 signals but no detectable FAM and JOE signals were interpreted as positive for Bordetella parapertussis.

[0277] (3) Samples with detectable JOE signals but no detectable CFR610 were interpreted as positive for Bordetella hominis.

[0278] (4) Samples with signals in the FAM and CFR610 channels but without detectable JOE signals were interpreted as being positive for both Bordetella pertussis and Bordetella parapertussis.

[0279] (5) Samples with signals in the JOE and CFR610 channels were interpreted as being positive for both Bordetella hominis and Bordetella parapertussis.

[0280] Example 2: Detection limit of multiplex assay for Bordetella spp.

[0281] Using quantitative bacterial strains of *Bordezoella pertussis*, *Bordezoella parapertussis*, and *Bordezoella hootii*, a limit of detection (LoD) study was conducted to determine the simplex virus. TM The analytical sensitivity for direct determination of Bordetella spp. in nasopharyngeal swab matrix was assessed. Each bacterial strain was screened to determine the putative LoD and subsequently confirmed. The LoD for each strain was determined as the lowest concentration with ≥85-95% detection (≥19 out of 20 replicates) for 20 replicates.

[0282] Example 3: Cross-reactivity of multiplex assays for Bordetella spp.

[0283] For cross-reactivity assays, the control nasal swab sample will be mixed with one of the test organisms listed below (n=5 per organism).

[0284]

[0285] For each sample, multiple determinations of Bordetella spp. were performed. In each case, a Ct value ≤40 was interpreted as a positive result for cross-reactivity with Bordetella pertussis, a Ct value ≤40 was interpreted as a positive result for cross-reactivity with Bordetella parapertussis, and a Ct value ≤40 was interpreted as a positive result for cross-reactivity with Bordetella hominis.

[0286] Cross-reactivity is not expected to be observed for any of the aforementioned microbial species.

[0287] Example 4: Comparison of direct real-time PCR results of Bordetella spp. SIMPLE XA with bidirectional sequencing

[0288] Simplexa was evaluated using a set of 284 nasopharyngeal swab samples. TM Clinical manifestations of *Bordedia* spp. were directly measured. This group included 102 positive *Bordedia pertussis*, 37 positive *Bordedia parapertussis*, 37 positive *Bordedia hopterii*, and 108 negative for all targets. 35 *Bordedia hopterii* positive samples were artificially created. (Simplified Chinese text is incomplete and requires further context.) TM The assay results were compared with bidirectional sequencing results to determine the concordance between positive and negative results. The optimized thresholds for FAM, JOE, CFR610, and Q670 were 2000, 2000, 5000, and 5000, respectively.

[0289] Table 1: Homogenes of Bordetella pertussis

[0290]

[0291] a Sequencing revealed that eight samples were negative for Bordetella pertussis, but Simplexa reported them as positive for Bordetella pertussis, with Ct values ​​of 39.2, 37.1, 36.1, 36.0, 37.3, 36.9, 38.0, and 37.1, respectively.

[0292] b Sequencing of three samples reported positive results for Bordetella pertussis, but Simplexa reported negative results for Bordetella pertussis.

[0293] Table 2: Homogenization of Bordetella parapertussis

[0294]

[0295] c Sequencing of three samples reported negative results for Bordetella parapertussis, but Simplexa reported positive results for Bordetella parapertussis, with Ct values ​​of 38.2, 36.5, and 39.8, respectively.

[0296] Table 3: Homogenes of Bordetella hominis

[0297]

[0298] d One sample was reported as negative for Bordetella hominis by sequencing, but was reported as positive for Bordetella hominis by Simplexa, with a Ct value of 33.4.

[0299] Using 284 de-identified clinical samples, the positive and negative concordance rates of bidirectional sequencing results for *Bordedia pertussis* in clinical nasopharyngeal specimens were 97.1% (99 / 102) and 95.6% (174 / 182), respectively (Table 1). For clinical nasopharyngeal specimens, the positive and negative concordance rates of bidirectional sequencing results for *Bordedia parapertussis* were 100% (37 / 37) and 98.8% (244 / 247), respectively (Table 2). For clinical nasopharyngeal specimens, the positive and negative concordance rates of bidirectional sequencing results for *Bordedia hopnea* were 100% (37 / 37) and 99.6% (246 / 247), respectively (Table 3).

[0300] These results demonstrate that Simplexa TMDirect assays of Bordetella species can directly detect Bordetella pertussis, Bordetella parapertussis, and Bordetella hominis in nasopharyngeal samples without a separate nucleic acid extraction step, and have performance comparable to that observed with bidirectional sequencing.

[0301] equivalent

[0302] This technology is not limited to the specific embodiments described in this application, which are intended as a single illustration of various aspects of this technology. Many modifications and variations can be made to this technology without departing from the spirit and scope of the invention, as will be apparent to those skilled in the art. In addition to those listed herein, functionally equivalent methods and apparatus within the scope of this technology will be apparent to those skilled in the art from the foregoing description. These modifications and variations are intended to fall within the scope of this technology. It should be understood that this technology is not limited to specific methods, reagents, compound compositions, or biological systems, which can, of course, be varied. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be restrictive.

[0303] The terms “comprising,” “including,” “containing,” etc., should be understood broadly and without limitation. Furthermore, the terms and expressions used herein are used as descriptive rather than limiting terms, and are not intended to exclude any equivalents of the shown and described features or portions thereof, but it is understood that various modifications are possible within the scope of this disclosure.

[0304] Furthermore, in the context of describing features or aspects of this disclosure in accordance with the Markush Group, those skilled in the art will recognize that this disclosure is therefore also described in the form of any individual member of the Markush Group or a subgroup of its members.

[0305] As will be understood by those skilled in the art, for any and all purposes, particularly in providing written description, all scopes disclosed herein also encompass any and all possible subscopes and combinations thereof. Any listed scope can be readily considered adequately descriptive and such scopes can be decomposed into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting embodiment, each scope discussed herein can be readily decomposed into lower thirds, middle thirds, and upper thirds, etc. As will also be understood by those skilled in the art, all language such as “more than,” “at least,” “greater than,” “less than,” etc., includes the stated numbers and refers to a scope that can subsequently be decomposed into subscopes as described above. Finally, as will be understood by those skilled in the art, a scope includes each individual member. Thus, for example, a group having 1-3 cells refers to a group having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to a group having 1, 2, 3, 4, or 5 cells, and so on.

[0306] All patents, patent applications, provisional applications and publications mentioned or cited herein are incorporated herein by reference in their entirety (including all figures and tables) to such extent as may be inconsistent with the explicit teachings of this specification.

Claims

1. A method for detecting the presence of at least one pathogenic Bordetella species in a biological sample, comprising: (a) Expose the biological sample to the following: i. The first primer pair for amplifying the IS481 target nucleic acid, comprising at least 85-95% identical nucleotides to SEQ ID NO: 1 or its complementary sequence; ii. A second primer pair for amplifying the IS1001 target nucleic acid, comprising at least 85-95% identical nucleotides to SEQ ID NO: 2 or its complementary sequence; and iii. Amplify the third primer pair of the hIS1001 target nucleic acid, which includes at least 85-95% identical nucleotides to SEQ ID NO: 3 or its complementary sequence; A reaction-sample mixture is generated in which the amplification of the target nucleic acids IS481, IS1001 and hIS1001 (if they are present in the biological sample) occurs without extracting the target nucleic acids from the biological sample. (b) subjecting the reaction-sample mixture to real-time PCR conditions under which the target nucleic acids present in the biological sample are amplified to generate fluorescence signals; (c) Detect the fluorescence signal generated by each amplified target nucleic acid produced in step (b); and (d) The presence of at least one pathogenic Bordetella species in the biological sample was detected by evaluating the fluorescence signal of each target nucleic acid. i. When a fluorescent signal targeting the hIS1001 nucleic acid was detected, *B. holmesii* was detected in the biological sample; ii. When a fluorescent signal targeting the IS1001 nucleic acid was detected, *B. parapertussis* was detected in the biological sample; and iii. When a fluorescent signal targeting the IS481 target nucleic acid was detected but no fluorescent signal targeting hIS1001 was detected, Bordetella pertussis was detected in the biological sample. The pathogenic Bordetella species is one or more of Bordetella pertussis, Bordetella parapertussis, and Bordetella hominis; and The biological sample was not subjected to extraction or purification steps before amplification.

2. The method according to claim 1, wherein the first primer pair consists of a first forward primer containing 5' CCATAAGCATGCCCGATT 3' (SEQ ID NO: 11) and a first reverse primer pair containing 5' CGCTTCAGGCACACAAACT 3' (SEQ ID NO: 10).

3. The method according to claim 1 or claim 2, wherein the second primer pair consists of a second forward primer containing 5'CGGCTCGACGAATTGC 3' (SEQ ID NO: 7) and a second reverse primer containing 5'AGTTCGTCACGCAGGACAT3' (SEQ ID NO: 8).

4. The method according to any one of claims 1-3, wherein the third primer pair consists of a third forward primer containing 5'GGCACGGATCGAGGTTTTT 3' (SEQ ID NO: 4) and a third reverse primer containing 5'TACGGCCGTGAAGTGATAGA 3' (SEQ ID NO: 5).

5. The method according to any one of claims 1-4, further comprising contacting the biological sample with a first nucleic acid probe capable of specifically hybridizing to a segment of the IS481 target nucleic acid of SEQ ID NO: 1, wherein the first nucleic acid probe is detectably labeled and comprises 5' TCAATTGCTGGACCATTTCGAGTCGAC 3' (SEQ ID NO: 12).

6. The method of claim 5, wherein the first nucleic acid probe is labeled with a FAM fluorescent group detectable label.

7. The method according to any one of claims 1-6, further comprising contacting the biological sample with a second nucleic acid probe capable of specifically hybridizing to a segment of the complement of the IS1001 target nucleic acid of SEQ ID NO: 2, wherein the second nucleic acid probe is detectably labeled and comprises 5' CAACCAGCCGCTGCTGACGGTC 3' (SEQ ID NO: 9).

8. The method of claim 7, wherein the second nucleic acid probe is labeled with a CFR610 fluorophore.

9. The method according to any one of claims 1-8, further comprising contacting the biological sample with a third nucleic acid probe capable of specifically hybridizing to a segment of the hIS1001 target nucleic acid of SEQ ID NO: 3, wherein the third nucleic acid probe is detectably labeled and comprises 5' AGTCGCTGGCTACTGCTGCGCA 3' (SEQ ID NO: 6).

10. The method of claim 9, wherein the third nucleic acid probe is labeled with a JOE fluorophore detectable label.

Images