A multi-class pathogen one-tube detection method

Abstract

The application discloses a multi-pathogen one-tube detection method, and belongs to the technical field of pathogenic microorganism molecular diagnosis. The multi-pathogen one-tube detection method is used for simultaneously detecting Yersinia pestis, Babesia, Vibrio cholerae and Borrelia burgdorferi, and four groups of primer probe combinations are used for detection, wherein four probes are respectively marked with fluorescence groups and quenching groups which do not interfere with each other in spectrum. The application uses a four-fold qPCR system integrated with "modified primer + modified probe + UDG enzyme regulation" to detect four pathogens in one tube, can effectively resist complex sample matrix, can distinguish active pathogens in the sample, effectively reduces the sample processing requirement, shortens the pretreatment time, is suitable for various scenes such as epidemic source environment monitoring, clinical sample rapid screening of zoonosis, field epidemiology tracing and the like, and has important practical application value.

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostic technology for pathogenic microorganisms, and specifically to a method for detecting multiple types of pathogens in a single tube. Background Technology

[0002] Yersinia pestis, Babesia, Vibrio cholerae, and Borrelia burgdorferi are all pathogens of significant public health importance. Yersinia pestis causes plague, a highly contagious disease, and is classified as a Class A infectious disease. Vibrio cholerae is the causative agent of cholera and is an internationally quarantinable infectious disease. Babesia and Borrelia burgdorferi are zoonotic vector-borne pathogens, infecting hosts via tick bites and widely distributed in natural foci such as grasslands and forests. These four types of pathogens have overlapping epidemic areas, posing a risk of mixed exposure and co-infection in the wild environment, host animals, and clinical samples. Therefore, in disease control field operations, rapid, multi-target simultaneous screening of large numbers of samples is often necessary.

[0003] Real-time quantitative PCR (qPCR) has become the mainstream technology for pathogen nucleic acid detection due to its advantages such as high sensitivity, strong specificity, closed-tube detection, and outstanding quantitative capabilities. Multiplex quantitative PCR can achieve parallel detection of multiple targets in a single reaction system, significantly saving samples, reagents, and detection time, making it the preferred solution for high-throughput pathogen screening. Although multiplex quantitative PCR has many advantages, some problems still exist that cannot be overcome at present: First, the sample matrix causes significant interference. Soil, water, animal blood, and tissue lysis products from epidemic foci often contain various PCR inhibitors such as humic acid, tannins, polysaccharides, hemoglobin, and endogenous nucleases. Crude nucleic acid extraction samples are prone to problems such as decreased amplification efficiency, abnormal amplification curves, and false negatives with low target copies. Therefore, deep nucleic acid purification is required, which increases the number of operation steps and prolongs the detection time, making it unsuitable for rapid on-site detection.

[0004] Second, it cannot distinguish between live pathogen nucleic acid and cell-free nucleic acid from dead pathogens, leading to false positive results. Traditional qPCR only determines the presence of target nucleic acid in a sample; a positive result only indicates the presence of pathogen nucleic acid and cannot distinguish whether the nucleic acid originates from live pathogens or cell-free DNA released from the lysis of dead pathogens. In environmental monitoring and epidemic source risk assessment scenarios, a positive result for residual nucleic acid from dead pathogens can lead to epidemiological misjudgments, overestimating the risk of infection and interfering with prevention and control decisions.

[0005] Third, the compatibility of multiplex detection systems is poor. Natural oligonucleotides are prone to primer dimer formation and primer-probe non-specific hybridization, which increases baseline fluorescence and reduces the detection signal-to-noise ratio. Although various software programs are available to assist in screening target genes and designing primers and probes, for multiplex detection systems, relying solely on conventional software cannot effectively overcome the poor compatibility. Furthermore, traditional methods such as adjusting primer concentration and annealing temperature offer limited room for improvement.

[0006] Fourth, insufficient probe stability. Endogenous nucleases in the sample can degrade natural DNA probes, resulting in a decrease in the effective probe concentration, an increase in the detection limit for low-copy samples, and poorer experimental repeatability. Summary of the Invention

[0007] The purpose of this invention is to address the shortcomings of existing multiplex quantitative PCR detection technologies in detecting Yersinia pestis, Babesia, Vibrio cholerae, and Borrelia burgdorferi, by providing a new method for detecting multiple pathogens in a single tube. This method effectively resists interference from complex sample matrices and can also effectively distinguish between live and dead pathogens, thereby improving the accuracy of detection results.

[0008] The technical solution of this invention is as follows: A single-tube detection method for multiple pathogens, used to simultaneously detect Yersinia pestis, Babesia, Vibrio cholerae, and Borrelia burgdorferi, employs the following four primer-probe combinations: Yersinia pestis: Upstream primer: 5'-GGGTTGGGTTGGGTTGGG-taactgcaagcaccactgca-3', Downstream primer: 5'-cgtcatcccccacaaggttc-3', Probe: 5'-acagatgUcgcgggtgatcc-3'; Babesia: Upstream primer: 5'-GGGTTGGGTTGGGTTGGG-taataggaacggttgggggc-3', Downstream primer: 5'-acgacggtatctgatcgtct-3', Probe: 5'-agcatttgUcaaggacgtttcca-3'; Vibrio cholerae: Upstream primer: 5'-GGGTTGGGTTGGGTTGGG-tccatatgttggtgcgggtt-3', Downstream primer: 5'-gcacctgctttgtaggttgc-3', Probe: 5'-acgactcaUggggacttgctgc-3'; Borrelia burgdorferi: Upstream primer: 5'-GGGTTGGGTTGGGTTGGG-tggggaacttgattagcctgc-3', Downstream primer: 5'-tcaaagggcaaatttaggtgct-3', Probe: 5'-tgttgctgctacaacctcaUctgtca-3'; The four probes are labeled with fluorescent groups and quenching groups whose spectra do not interfere with each other.

[0009] Optionally or preferably, in the above method, qPCR technology is used for detection. The qPCR reaction system includes: a qPCR premix containing four primer probe combinations for detecting Yersinia pestis, Babesia, Vibrio cholerae and Borrelia burgdorferi, UDG enzyme, pretreatment sample, and enzyme-free pure water.

[0010] Optionally or preferably, in the above method, the qPCR reaction system further includes: Taq DNA polymerase, dNTP mixture, PCR buffer, and Mg. 2+ .

[0011] Optionally or preferably, in the above method, the qPCR reaction procedure includes: (1) UDG pre-incubation: 37 ℃, 5 min, to degrade the dead pathogen nucleic acid hybridization complex; (2) UDG inactivation + pre-denaturation: 95 ℃, 3 min, complete UDG inactivation and nucleic acid denaturation in one step; (3) 40 cycles: 95 ℃ for 10 s; 60 ℃ for 35 s. Four-channel fluorescence signals were collected at the 60 ℃ stage, and the results were interpreted.

[0012] Optionally or preferably, the above method includes the following steps: (1) Perform non-lytic pretreatment on the sample to be tested to obtain a pretreated sample; (2) Add the pretreated sample to the qPCR reaction system containing UDG enzyme and four sets of primer probes. First, pre-incubate at 37°C to degrade the hybridization products of the dead pathogen nucleic acid. Then, inactivate UDG enzyme at 95°C to complete the pre-denaturation. Then, perform real-time fluorescence quantitative PCR amplification. (3) Determine the type of pathogen based on the fluorescence channel signal.

[0013] Optionally or preferably, in the above method, the sample to be tested includes: soil sample, animal tissue sample, blood sample, and water sample.

[0014] Compared with the prior art, the present invention has the following beneficial effects: This invention combines primer and probe design with a detection system to achieve accurate and rapid detection with simple pretreatment of the sample to be tested.

[0015] This invention modifies the non-annealed region at the 5' end of the forward primer with G-quadruplexes. The secondary structure of the quadruplexes can locally enrich free Mg in the primer. 2+ To counteract the effects of inhibitors such as humic acid and polyphenols on Mg in the system 2+ The chelation consumption ensures the Mg required for annealing and amplification reactions. 2+ The concentration of G quadruple strands does not directly bind to inhibitors; instead, it improves sample amplification efficiency through stable primer-template annealing. The specific annealing sequences linked to the G quadruple strands in the four sets of forward primers are highly different, and the reverse primers are unmodified to ensure high specificity of target recognition. At the same time, further adjusting the final concentration of the four sets of modified primers to 0.2 μmol / L can balance the multiplex amplification efficiency, significantly reduce the probability of G quadruple strand homodimer formation, and reduce non-specific interactions between oligonucleotides in the multiplex system.

[0016] This invention embeds dU at a specific site in the probe sequence to work with the UDG enzyme system. The dU site is far from the Taq enzyme cleavage site at the 5' end of the probe, so it does not affect the probe's hydrolysis and luminescence during qPCR amplification. The non-lysis pretreatment uses only a low concentration of mild surfactant and a low dose of mild proteinase K to selectively lyse dead bacteria, preserving the complete cellular structure of live pathogens. The UDG enzyme can only degrade the hybridization complex of the free nucleic acid released from dead pathogens and the probe. During pre-incubation at 37°C, UDG recognizes the dU site in the double strand and cleaves the hybridization complex, preventing fluorescence. Only after subsequent high-temperature pre-denaturation at 95°C to thoroughly lyse live bacteria and release genomic DNA can normal amplification and luminescence occur, effectively avoiding false positive results caused by samples contaminated with dead pathogens.

[0017] Furthermore, the dU modification of the present invention does not disrupt the base complementary pairing between the probe and the target sequence, and the G quadruple modification and dU modification do not conflict with each other and can be adapted together to the quadruple amplification system.

[0018] This invention utilizes an integrated quadruple qPCR system of "modified primers + modified probes + UDG enzyme regulation" to detect four pathogens in a single tube. It can effectively tolerate complex sample matrices and distinguish active pathogens in samples, effectively reducing sample processing requirements and shortening pretreatment time. It is suitable for various scenarios such as environmental monitoring in epidemic areas, rapid screening of clinical samples of zoonotic diseases, and field epidemiological tracing, and has important practical application value. Attached Figure Description

[0019] Figure 1This is an amplification curve for the simultaneous detection of four pathogens. In the figure, the red line represents Yersinia pestis, the orange line represents Babesia, the green line represents Vibrio cholerae, and the blue line represents Borrelia burgdorferi.

[0020] Figure 2 To examine the specific amplification curves of Yersinia pestis, the four red lines represent four parallel replicates, and the negative results represent the control group (including the Yersinia enterocolitica group, Yersinia pseudotuberculosis group, Yersinia rumenii group, and negative control group).

[0021] Figure 3 To examine the precision of Yersinia pestis amplification curves, the eight red lines represent eight parallel replicates of the Yersinia pestis target sequence plasmid at weakly positive concentration levels.

[0022] Figure 4 To examine the amplification curve of the detection limit of Yersinia pestis, 1000 copies / mL of the Yersinia pestis target sequence plasmid was used, with 2 μL added in a single reaction. The eight red lines represent eight parallel replicates.

[0023] Figure 5 To examine the specific amplification curves of Borrelia burgdorferi, the four blue lines represent four parallel replicates, and the negative results represent the control group (including the Leptospira question mark group, the Leptospira hyperbolic group, the Treponema pallidum group, and the negative control group).

[0024] Figure 6 To examine the amplification curves for the precision of Borrelia burgdorferi, the eight blue lines represent eight parallel replicates of the Borrelia burgdorferi target sequence plasmid at weakly positive concentration levels.

[0025] Figure 7 To examine the amplification curve of the detection limit of Borrelia burgdorferi, 1000 copies / mL of the Borrelia burgdorferi target sequence plasmid was used, with 2 μL added in a single reaction, and the eight blue lines representing eight parallel replicates.

[0026] Figure 8 To examine the specific amplification curves of Vibrio cholerae, the four green lines represent four parallel replicates, and the negative results represent the control group (including the Vibrio parahaemolyticus group, Vibrio vulnificus group, and negative control group).

[0027] Figure 9 To examine the amplification curves for Vibrio cholerae precision, the eight green lines represent eight parallel replicates of the Vibrio cholerae target sequence plasmid at weakly positive concentration levels.

[0028] Figure 10 To examine the amplification curve of the detection limit of Vibrio cholerae, a Vibrio cholerae target sequence plasmid of 1000 copies / mL was used, with 2 μL added in a single reaction. The eight green lines represent eight parallel replicates.

[0029] Figure 11 To examine the specific amplification curves of Babesia, the four orange lines represent four parallel replicates, and negative results serve as the control group (Plasmodium falciparum group, Plasmodium vivax group, Toxoplasma gondii group, and negative results serve as the control).

[0030] Figure 12 To examine the precision of Babesia amplification curves, the eight orange lines represent eight parallel repeats of the Babesia target sequence plasmid at weakly positive concentration levels.

[0031] Figure 13 To examine the amplification curve of the detection limit of Babesia, a Babesia target sequence plasmid of 1000 copies / mL was used, with 2 μL added in a single reaction, and the eight orange lines representing eight parallel replicates. Detailed Implementation

[0032] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments and accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, and not all of them. Based on the embodiments of the present application, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial sources. All operations in the embodiments strictly comply with biosafety regulations.

[0033] Example 1: Detection of four types of pathogens in one tube The qPCR reaction system for detection includes: (1) Quadruple primer-probe mixture: containing four sets of G quadruple modified forward primers and unmodified reverse primers as shown in Table 1, each at 0.20 μmol / L, and four sets of probes at 0.10 μmol / L; (2) qPCR 2× amplification premix: hot-start Taq DNA polymerase final concentration 0.025 U / μL, four dNTPs 200 μmol / L each, CaCl2 final concentration 3.5 mmol / L; (3) UDG enzyme (uracil DNA glycosidase), final system concentration 0.02 U / μL; (4) Negative control: Pure water without nuclease.

[0034] Table 1 Primer and probe combinations for quadruple qPCR detection The target sequences corresponding to the primer-probe combinations used for detecting the four pathogens in Table 1 are as follows: Yersinia pestis detection target sequence: Atgaaaaaaatcagttccgttatcgccattgcattatttggaactattgcaactgctaatgcggcagatttaactgcaagcaccactgcaacggcaactcttgttgaaccagcccgcatcactcttacatataaggaaggcgctccaattacaattatggacaatggaaacatcgatacagaattacttgttggtacgcttactcttggcggctataaaacaggaaccactagcacatctgttaactttacagatgccgcgggtgatcccatgtacttaacatttacttctcaggatggaaataaccaccaattcactacaaaagtgattggcaaggattctagagattttgatatctctcctaaggtaaacggtgagaaccttgtgggggatgacgtcg (SEQ ID NO:13).

[0035] Babesia detection target sequence: ttttgttggtttttgaaccttagtaatggttaataggaacggttgggggcattcgtatttaactgtcagaggtgaaattcttagatttgttaaagacgaactactgcgaaagcatttgccaaggacgtttccattaatcaagaacgaaagttaggggatcgaagacgatcagataccgtcgtagtcctaaccataaacta (SEQ ID NO:14).

[0036] Vibrio cholerae detection target sequence: attcgactttccgtccatatgttggtgcgggtttgaattacaccactttctttgatgaaagctttaatagtacgggtactaataatgcattgagtgatttaaaactggacgactcatggggacttgctgctaacgttggctttgattatat gctcaatgatagctggttcctcaacgcttctgtgtggtatgccaatattgaaacaacggcaacctacaaagcaggtgcagatgccaaatccacggatgttgaaatcaatccttgggtatttatgatcgcgggtggttataagttctaa (seq ID NO:15).

[0037] Target sequence for detecting Borrelia burgdorferi: aattttatctaagcaatgacaaaaacatattggggaacttgattagcctgcgcaatcattgccattgcagattgtgttaaaatactattagttgttgctgctacaacctcatctgtcattgtagcatc ttttatttgagcataagatgcttttagattttcaattgcatactcagtactattctttatagattcaagtctattttggaaagcacctaaatttgccctttgatcacttatcattctaatagc (seq ID NO:16).

[0038] The sample system to be tested included Yersinia pestis, Babesia, Vibrio cholerae, and Borrelia burgdorferi, which were cultured in vitro separately. The bacterial concentrations were adjusted, and the mixture was used as a live pathogen sample. A mixture of humic acid, hemoglobin, and tannins at a final concentration of 100 ng / μL was added to the reaction system to simulate the inhibitory environment of the combined soil and blood samples from the epidemic source. Multiple sets of samples were serially diluted for parallel controls.

[0039] Testing procedure: (1) The sample to be tested was subjected to non-lytic pretreatment to obtain the pretreated sample. Pretreatment solution: Tween-20, 0.05%~0.1%; mild proteinase K, 50~100μg / mL; Tris-HCl, 10mM, pH 8.0; EDTA chelating agent, 1mM; nuclease-free water. The sample to be tested was mixed with the pretreatment solution at a volume ratio of 9:1 and treated for 12min.

[0040] (2) Add the pretreatment sample to the qPCR reaction system for detection, with an addition volume of 0.3 μL. The total reaction system is 20 μL, containing 10 μL of 2×qPCR premix, 2 μL of quadruple primer-probe mixture, 0.3 μL of UDG enzyme, 2 μL of pretreatment sample, and enzyme-free pure water to make up to 20 μL.

[0041] Amplification procedure: ① UDG pre-incubation: 37℃, 5 min; ② UDG inactivation and pre-denaturation: 95℃, 3 min; ③ 40 cycles: 95℃ for 10s; 60℃ for 35s, collecting four-channel fluorescence signals during the 60℃ stage.

[0042] Result interpretation: A positive result is defined as the appearance of a typical amplification curve in the corresponding fluorescence channel and Ct≤38.

[0043] A parallel control reaction without UDG enzyme was also set up.

[0044] Experimental results: qPCR was performed using a mixed sample system containing four pathogens, and the results are as follows: Figure 1 As shown, each pathogen could be effectively detected. Even in the presence of humic acid, hemoglobin, and tannins, a reaction level of 10 copies / μL maintained stable detection. The amplification efficiency of the four targets ranged from 90% to 103%, with a linear correlation coefficient R0. 2 >0.995, which meets the requirements for quantitative detection.

[0045] Example 2: A recombinant plasmid containing the pathogen target sequence was used as a positive plasmid to investigate its specificity, precision, and detection limit.

[0046] 1. Specificity: A 4-channel fluorescent PCR detection system was used. Positive plasmid templates for four pathogens were added separately, and detection was performed using a single template loading method, meaning only one pathogen template was added to each reaction system, with four parallel replicates for each template. Simultaneously, approximate pathogen control and negative control groups were set up. After amplification, the amplification curves and Ct values ​​of the four fluorescent channels were observed simultaneously to verify the cross-reactivity of the reagents.

[0047] 2. Precision (Reproducibility): Referring to CLSI EP5-A2 "Precision performance evaluation of quantitative measurement methods; Approval Guideline - Second Edition", positive plasmids of four pathogens at weak positive concentration levels were selected as samples for precision validation. Eight parallel tests were performed, and the results were statistically analyzed. The positive concordance rate of the sample test results should be 100%, and the intra-assay imprecision (CV) result of the Ct value should not exceed 5.00%.

[0048] 3. Limit of Detection (Sensitivity): Based on the theoretical lower limit of detection of molecular PCR technology, and after reviewing literature, existing similar products, and the intended use of the kit, the limit of detection is determined to be 1000 copies / mL, which is currently the standard limit of detection for similar products, while meeting the detection requirements. In this experiment, the template loading volume is 2 μL, and the theoretical template input amount for a single reaction is 2 copies. This low template amount is used to verify the minimum detection capability of the system. If the positive detection rate is higher than 95%, this concentration can be set as the limit of detection concentration.

[0049] Similar pathogens to Yersinia pestis: Yersinia enterocolitica, Yersinia pseudotuberculosis, and Yersinia rumeni; Babesia similar pathogens: Plasmodium falciparum, Plasmodium vivax, and Toxoplasma gondii; Similar pathogens to Vibrio cholerae: Vibrio parahaemolyticus, Vibrio vulnificus; Similar pathogens to Borrelia burgdorferi: Leptospira question mark, Leptospira hyperbolica, and Treponema pallidum.

[0050] Test results as follows Figures 2-13 As shown, this demonstrates that the primers and probes of the present invention have very high specificity and can effectively distinguish between the target pathogen and similar pathogens.

[0051] Example 3: Verification of the ability to identify dead pathogen contamination To prepare an inactivated pathogen sample system, four pathogens were thermally inactivated by incubating in a water bath at 95°C for 30 minutes. After inactivation, the inactivated products were cultured or passaged in vitro to confirm the absence of live pathogens. Other conditions were the same as those for the sample system to be tested in Example 1.

[0052] The detection procedure is the same as in Example 1, with a parallel control reaction without UDG enzyme added.

[0053] The results showed that no amplification signal was observed in the UDG enzyme group of inactivated pathogen samples, while positive amplification was observed in the group without UDG enzyme. The samples containing live pathogens tested using Example 1 showed positive amplification in both the UDG enzyme treatment group and the group without UDG enzyme treatment, indicating that this system can effectively distinguish between samples contaminated with live pathogens and those contaminated with dead pathogens.

[0054] Example 4: Control experiment using unmodified primers and probes 1. Primers are free of G quadruplex modification, probes do not contain dU, and the system does not contain UDG enzyme. The control primer and probe combinations for quadruple qPCR detection are shown in Table 2 below. No UDG enzyme was added to the qPCR system, and the other conditions were the same as in Example 1.

[0055] Table 2. Control primer and probe combinations for quadruple qPCR detection The results showed that in the presence of inhibitors humic acid, hemoglobin, and tannins, low-copy templates were prone to false negatives, multiplex amplification had high baselines, poor signal-to-noise ratios, and could not distinguish between contamination by dead pathogens.

[0056] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of ​​the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. A method for detecting multiple pathogens in a single tube, used for simultaneously detecting Yersinia pestis, Babesia, Vibrio cholerae, and Borrelia burgdorferi, characterized in that, The following four primer-probe combinations were used for detection: Yersinia pestis: Upstream primer: 5'-GGGTTGGGTTGGGTTGGG-taactgcaagcaccactgca-3', Downstream primer: 5'-cgtcatcccccacaaggttc-3', Probe: 5'-acagatgUcgcgggtgatcc-3'; Babesia: Upstream primer: 5'-GGGTTGGGTTGGGTTGGG-taataggaacggttgggggc-3', Downstream primer: 5'-acgacggtatctgatcgtct-3', Probe: 5'-agcatttgUcaaggacgtttcca-3'; Vibrio cholerae: Upstream primer: 5'-GGGTTGGGTTGGGTTGGG-tccatatgttggtgcgggtt-3', Downstream primer: 5'-gcacctgctttgtaggttgc-3', Probe: 5'-acgactcaUggggacttgctgc-3'; Borrelia burgdorferi: Upstream primer: 5'-GGGTTGGGTTGGGTTGGG-tggggaacttgattagcctgc-3', Downstream primer: 5'-tcaaagggcaaatttaggtgct-3', Probe: 5'-tgttgctgctacaacctcaUctgtca-3'; The four probes are labeled with fluorescent groups and quenching groups whose spectra do not interfere with each other.

2. The method according to claim 1, characterized in that, The detection was performed using qPCR. The qPCR reaction system included: a qPCR premix containing four primer-probe combinations for detecting Yersinia pestis, Babesia, Vibrio cholerae, and Borrelia burgdorferi; UDG enzyme; pretreatment sample; and enzyme-free pure water. The pretreatment sample was obtained by non-lytic pretreatment of the sample to be tested.

3. The method according to claim 2, characterized in that, The qPCR reaction system also includes: Taq DNA polymerase, dNTP mixture, PCR buffer, and Mg. 2+ .

4. The method according to claim 2 or 3, characterized in that, The qPCR reaction procedure includes: (1) UDG pre-incubation: 37 ℃, 5 min, to degrade the dead pathogen nucleic acid hybridization complex; (2) UDG inactivation and pre-denaturation: 95 ℃, 3 min; (3) 40 cycles: 95 ℃ for 10 s; 60 ℃ for 35 s. Fluorescence signals were collected at the 60 ℃ stage, and the results were interpreted.

5. The method according to claim 4, characterized in that, Includes the following steps: (1) Perform non-lytic pretreatment on the sample to be tested to obtain a pretreated sample; (2) Add the pretreated sample to the qPCR reaction system containing UDG enzyme and four sets of primer probes. First, pre-incubate at 37°C to degrade the hybridization products of the dead pathogen nucleic acid. Then, inactivate UDG enzyme at 95°C to complete the pre-denaturation. Then, perform real-time fluorescence quantitative PCR amplification. (3) Determine the type of pathogen based on the fluorescence channel signal.

6. The method according to claim 4, characterized in that, The samples to be tested include: soil samples, animal tissue samples, blood samples, and water samples.

Images