A primer probe combination for specifically identifying non-classical species brucella anthropi and application thereof

Abstract

The application relates to the technical field of molecular biology detection, and provides application of a sequence as shown in SEQ ID NO. 1 in specific identification of non-classical species Brucella B. anthropi , and also provides a primer probe combination for specific identification of non-classical species Brucella B. anthropi and application thereof. The primer probe combination obtained by taking the sequence as shown in SEQ ID NO. 1 as a target sequence for design is used for fluorescence quantitative PCR detection, non-classical species Brucella nucleic acid is specifically detected, and sensitivity and repeatability are good. The method can exclude interference of classical species Brucella such as bovine species, ovine species, porcine species and canine species and nucleic acid of other common pathogenic bacteria such as Escherichia coli and Salmonella, and provides key technical support for accurate prevention and control of Brucella disease among livestock.

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection technology, and in particular to a method for specifically identifying non-classical Brucella species. B. anthropi Primer-probe combinations and their applications. Background Technology

[0002] Brucellosis (hereinafter referred to as "brucellosis") is caused by Brucella bacteria (Brucella spp.). Brucella Brucellosis is a global zoonotic infectious disease caused by bacteria (brucellosis spp.). The World Organization for Animal Health (WOAH) lists brucellosis in its notified disease list. my country's Ministry of Agriculture and Rural Affairs lists it as a Class II animal disease in its "List of Class I, II, and III Animal Diseases," and the National Health Commission of China lists it as a Class B notifiable infectious disease. This disease seriously endangers livestock production safety and public health safety. Infected livestock can experience abortion and infertility, while in humans, it mainly causes undulant fever, excessive sweating, and arthritis. If left untreated in the acute phase, it can become chronic, severely impacting quality of life.

[0003] The main brucellosis species prevalent in livestock in my country is Brucella melitensis (Brucella aureus). B. melitensis ), bovine brucellosis ( B.abortus ), swine brucellosis ( B. suis ) and canine brucellosis ( B.canis The above-mentioned strains are all classic Brucella species. In recent years, B. anthropi This strain has been classified as a Brucella species by internationally recognized taxonomic bodies, belonging to the genus Brucella and specifically a non-classical Brucella. Dozens of cases of human infection with this pathogen have been reported in the literature, potentially causing complications such as peritonitis, meningitis, and neonatal sepsis. The national standard "Diagnostic Techniques for Animal Brucellosis" recommends using the IS711 target gene for Brucella identification. The GB-IS711 primer probe can detect not only classic Brucella species such as those found in cattle, sheep, pigs, and dogs, but also non-classical species. B. anthropi Nucleic acid. However, B. anthropi Non-classical and non-classical Brucella species differ significantly from classic Brucella species such as bovine and ovine strains in their virulence and drug resistance, and can interfere with the diagnosis of classic Brucella species that pose a significant threat to livestock. Therefore, it is essential to design novel primers and probes to accurately distinguish between non-classical and classic Brucella species and to address the deficiencies in current national standard pathogen detection methods. Summary of the Invention

[0004] The purpose of this invention is to provide a method for specifically identifying non-classical Brucella species. B. anthropiThe primer-probe combination is used to specifically detect the nucleic acid of non-classical Brucella species, effectively eliminating interference from the main prevalent classic Brucella species in China, such as bovine, ovine, swine, and canine species.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a sequence as shown in SEQ ID NO.1 for the specific identification of non-classical Brucella species for non-disease diagnosis and / or treatment purposes. B. anthropi Applications in [the field].

[0006] This invention provides a method for the specific identification of non-classical Brucella species. B. anthropi The primer-probe combination is designed with the sequence shown in SEQ ID NO.1 as the target sequence; the primer-probe combination includes primer pairs and probes, the primer pairs include a forward primer as shown in SEQ ID NO.2 and a reverse primer as shown in SEQ ID NO.3; the sequence of the probe is shown in SEQ ID NO.4.

[0007] Preferably, the probe has a fluorescent reporter group attached to its 5' end and a quencher group attached to its 3' end; the fluorescent reporter group includes FAM and the quencher group includes BHQ1.

[0008] This invention provides the primer-probe combination for preparing and identifying non-classical Brucella species. B. anthropi Applications in products.

[0009] This invention provides a method for identifying non-classical Brucella species. B. anthropi The kit contains the aforementioned primer-probe combination.

[0010] This invention provides the primer-probe combination described above for the identification of non-classical Brucella species for non-disease diagnosis and / or treatment purposes. B. anthropi Applications in [the field].

[0011] This invention provides a method for identifying non-classical Brucella species for non-disease diagnosis and / or treatment purposes. B. anthropi The method includes the following steps: (1) Extract nucleic acid from the sample to be tested to obtain a nucleic acid sample; (2) The nucleic acid sample is amplified using the primer and probe set.

[0012] Preferably, the total volume of the amplification reaction in step (2) is 20 μL, including 10 μL of 2×qPCR probe Mastermix, 0.6 μL of forward primer, 0.6 μL of reverse primer, 0.3 μL of probe, 1 μL of nucleic acid sample, and 7.5 μL of double-distilled water.

[0013] Preferably, the amplification reaction procedure in step (2) is as follows: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 5 s; annealing at 62°C for 30 s, for 40 cycles.

[0014] By adopting the above technical solution, the present invention has the following beneficial effects: This invention establishes a real-time quantitative PCR detection method for distinguishing between non-classical and classic Brucella species through primer and probe design and reaction system optimization. This method can specifically detect the nucleic acids of non-classical Brucella species with good sensitivity and repeatability.

[0015] The non-classical Brucella species provided by this invention B. anthropi The quantitative real-time PCR detection method can be used for the etiological diagnosis of non-classical Brucella species. It has good sensitivity and repeatability, and can effectively exclude the interference of nucleic acids from the main prevalent classic Brucella species in China, such as cattle, sheep, pigs, and dogs, as well as other common pathogens such as Escherichia coli and Salmonella. It provides key technical support for the precise prevention and control of brucellosis in livestock.

[0016] The experimental results of this invention show that, using a CT value of 36 as the detection threshold, the sensitivity of this method is 5 × 10⁻⁶. -7 The concentration was ng / μL, and it showed no cross-reactivity with classic Brucella species such as bovine, ovine, swine, and canine, as well as other common pathogens such as Escherichia coli and Salmonella. The intra-batch and inter-batch coefficients of variation (CV) were both less than 3%. Attached Figure Description

[0017] Figure 1 Brucella atypical species B. anthropi Figure 1 shows the optimization results of annealing temperature for real-time PCR. Figure 1 In the diagram, A represents the result with an annealing temperature of 58℃, B represents the result with an annealing temperature of 60℃, C represents the result with an annealing temperature of 62℃, and D represents the result with an annealing temperature of 64℃. Figure 2 Brucella atypical species B. anthropi Figure showing the results of primer concentration optimization for real-time PCR; Figure 3 Brucella atypical species B. anthropi Figure showing the results of optimizing the concentration of real-time PCR probes; Figure 4 Brucella atypical species B. anthropi Graph of sensitivity results for real-time PCR; Figure 5 Brucella atypical species B. anthropi The specificity results of real-time PCR are shown in the figure. Detailed Implementation

[0018] This invention provides a sequence as shown in SEQ ID NO.1 for the specific identification of non-classical Brucella species for non-disease diagnosis and / or treatment purposes. B. anthropi Applications in [the field].

[0019] In this invention, the specific sequence of the sequence shown in SEQ ID NO.1 is 5'-TTCTTGCGCAGGAAGCCTTGCAGCAGCAGCGTGATCAGGCGGCGAGCGAATATGAGAAGCTCAGCAGCGAACTCACCGTCACCGGCGACAAGCTGAAACAGCTTGAAGACGAGGTGGCCG-3'.

[0020] This invention provides a method for the specific identification of non-classical Brucella species. B. anthropi The primer-probe combination was designed using the sequence shown in SEQ ID NO.1 as the target sequence.

[0021] In this invention, the primer-probe combination includes a primer pair and a probe. The primer pair includes a forward primer and a reverse primer. The sequence of the forward primer is shown in SEQ ID NO.2, specifically 5'-CGGCGAGCGAATATGAGAAG-3'; the sequence of the reverse primer is shown in SEQ ID NO.3, specifically 5'-ACCTCGTCTTCAAGCTGTTTC-3'. The sequence of the probe in this invention is shown in SEQ ID NO.4, specifically 5'-CTCAGCAGCGAACTCACCGTCA-3'.

[0022] In this invention, a fluorescent reporter group is attached to the 5' end of the probe, and a quencher group is attached to the 3' end. The fluorescent reporter group is preferably FAM, and the quencher group is preferably BHQ1.

[0023] This invention provides the primer-probe combination for preparing and identifying non-classical Brucella species. B. anthropi Applications in products.

[0024] This invention provides a method for identifying non-classical Brucella species. B. anthropi The kit contains the aforementioned primer-probe combination.

[0025] This invention provides the primer-probe combination described above for the identification of non-classical Brucella species for non-disease diagnosis and / or treatment purposes. B. anthropi Applications in [the field].

[0026] This invention provides a method for identifying non-classical Brucella species for non-disease diagnosis and / or treatment purposes. B. anthropi The method includes the following steps: (1) Extract nucleic acid from the sample to be tested to obtain a nucleic acid sample; (2) The nucleic acid sample is amplified using the primer and probe set.

[0027] In this invention, the total volume of the amplification reaction in step (2) is 20 μL, including 10 μL of 2×qPCR probe Mastermix, 0.6 μL of forward primer, 0.6 μL of reverse primer, 0.3 μL of probe, 1 μL of nucleic acid sample, and 7.5 μL of double-distilled water.

[0028] In this invention, the amplification reaction procedure in step (2) is as follows: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 5 s; annealing at 62°C for 30 s, for 40 cycles.

[0029] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0030] Example 1: Non-classical Brucella B. anthropi Establishment of a real-time PCR detection method

[0031] (a) Nucleic acid sample preparation

[0032] The nonclassical Brucella species shown in SEQ ID NO.1 B. anthropi The specific fragment sequence plasmid nucleic acid (pUC57-envC) was synthesized by Shanghai Sangon Biotech Co., Ltd. (China). The nucleic acids of Brucella mesenteriae, Brucella bovis, Brucella suis, Brucella canis, Mycobacterium tuberculosis, Haemophilus parasuis, Escherichia coli, Pasteurella multocida, Salmonella, and Staphylococcus aureus were all stored at the Zoonotic Disease Surveillance Center of the China Animal Health and Epidemiology Center.

[0033] (ii) Primers and probes

[0034] For non-classical Brucella species B. anthropi Primers and probes were designed based on the envC-specific fragment sequence of SX009 (gene sequence number NZ_CP194002.1) (as shown in SEQ ID NO.1). The primers and probes were synthesized by Shanghai Sangon Biotech Co., Ltd. (China). (The text also mentions *Brucella*, a non-classical species.) B. anthropiThe specific primer pairs were a forward primer and a reverse primer, named BruAn-F and BruAn-R, respectively; the probe was named BruAn-P, with the 5' end modified with a FAM group and the 3' end modified with a BHQ1 quencher group. The synthesized forward primer, reverse primer, and probe were dissolved in RNase-free and Dnase-free double-distilled water, respectively, and diluted to a working concentration of 10 μM.

[0035] (III) Optimization of Annealing Temperature

[0036] Extraction of non-classical Brucella species B. anthropi The SX009 envC specific fragment sequence plasmid nucleic acid (pUC57-envC) was amplified by real-time PCR.

[0037] Each 20 μL amplification reaction tube contains 10 μL of 2×qPCR probe Master mix; 0.4 μL of BruAn-F (10 μM); 0.4 μL of BruAn-R (10 μM); 0.2 μL of BruAn-P (10 μM); 8 μL of double-distilled water; and 1 μL of plasmid nucleic acid (pUC57-envC) at a template concentration of 0.005 ng / μL.

[0038] In the thermal cycling program, the initial stage was 95℃ for 15 min, followed by denaturation at 95℃ for 5 s; then different annealing temperatures (58℃, 60℃, 62℃, 64℃) were set, with an annealing time of 30 s for each, for a total of 40 cycles, to investigate the effect of annealing temperature on amplification efficiency.

[0039] The results showed that the fluorescence value was highest and the amplification efficiency was optimal at an annealing temperature of 62℃. Therefore, 62℃ was determined as the optimal annealing temperature. Figure 1 ).

[0040] (iv) Primer concentration optimization

[0041] Each 20 μL amplification reaction tube contained 10 μL of 2×qPCR probe Master mix (qPCR reaction solution); BruAn-F and BruAn-R (both 10 μM); 0.5 μL of BruAn-P (10 μM); and primers of different concentrations (BruAn-F, BruAn-R: 100 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM). Double-distilled water was added in increments of 8.1 μL, 7.7 μL, 7.3 μL, 6.9 μL, 6.5 μL, and 6.1 μL, respectively. 1 μL of plasmid nucleic acid (pUC57-envC) at a concentration of 0.005 ng / μL was used as template to determine the optimal primer concentration.

[0042] The thermal cycling program was as follows: pre-denaturation at 95℃ for 15 min; denaturation at 95℃ for 5 s; annealing at 62℃ for 30 s, for a total of 40 cycles.

[0043] The results showed that when the concentrations of BruAn-F and BruAn-R were both 300 nM, the amplification curve was complete, the Ct value (18.93) was the lowest, and the fluorescence peak was moderate. At this point, the primer concentration was the optimal reaction concentration. Figure 2 ).

[0044] (v) Optimization of probe concentration

[0045] Each 20 μL amplification reaction tube contained 10 μL of 2×qPCR probe Master mix (qPCR reaction solution); 0.6 μL each of BruAn-F and BruAn-R (300 nM); and different concentrations of probe BruAn-P: 50 nM, 100 nM, 150 nM, 200 nM, 250 nM, and 300 nM. 7.7 μL, 7.6 μL, 7.5 μL, 7.4 μL, 7.3 μL, and 7.2 μL of double-distilled water were added respectively. 1 μL of plasmid nucleic acid (pUC57-envC) at a concentration of 0.005 ng / μL was used as template to determine the optimal probe concentration.

[0046] The thermal cycling program started at 95℃ for 15 minutes; followed by denaturation at 95℃ for 5 seconds; and annealing at 62℃ for 30 seconds, for a total of 40 cycles.

[0047] The results showed that when the BruAn-P concentration was 150 nM, the amplification curve was complete, the Ct value (18.79) was the lowest, and the fluorescence peak was moderate. At this point, the probe concentration was the optimal reaction concentration. Figure 3 ).

[0048] Example 2: Non-classical Brucella B. anthropi Sensitivity evaluation of real-time PCR detection method

[0049] Based on the reaction system established in Example 1, plasmid nucleic acid (pUC57-envC) was detected to determine the sensitivity.

[0050] Each 20 μL reaction tube contains: 10 μL of 2 × qPCR probe Master mix; 0.6 μL each of BruAn-F and BruAn-R (300 nM); 0.3 μL of BruAn-P (150 nM); 7.5 μL of double-distilled water; and 5 × 10⁻⁶ qPCR reagents. -5 ng / μL, 5×10 -6 ng / μL, 5×10 -7 g / μL, 5×10 -8 Plasmid nucleic acid (pUC57-envC) template at different concentrations of ng / μL (1 μL).

[0051] The thermal cycling program started at 95℃ for 15 minutes; followed by denaturation at 95℃ for 5 seconds; and annealing at 62℃ for 30 seconds, for a total of 40 cycles.

[0052] The results showed that, with a CT value of 36 as the detection limit, the detection sensitivity was 5 × 10⁻⁶. -7 ng / μL. Figure 4 ).

[0053] Example 3: Non-classical Brucella B. anthropi Repeatability assessment of real-time PCR detection method

[0054] Based on the reaction system established in Example 1, plasmid nucleic acid (pUC57-envC) was detected to determine the method reproducibility. The specific steps are as follows: The reaction system configuration and amplification system were the same as in Example 1. The template concentration was 5 × 10⁻⁶. -1 -5×10 -3 The plasmid nucleic acid (pUC57-envC) was ng / μL, and three intragroup and three intergroup replicates were performed to calculate the coefficient of variation.

[0055] Table 1 Results of Repeatability Tests

[0056] The results showed that the plasmid nucleic acid (pUC57-envC) template concentration was 5 × 10⁻⁶ for repeated testing. -1 -5×10 -3 When the concentration was ng / μL, the coefficient of variation in the results was less than 3% (Table 1). This indicates that the detection method described in this invention has good repeatability.

[0057] Example 4: Non-classical Brucella B. anthropi Specificity evaluation of real-time PCR detection method

[0058] Based on the reaction system established in Example 1, specific detection of nucleic acids of 10 pathogens, including Brucella bovis, Brucella ovis, Brucella suis, Brucella canis, Mycobacterium tuberculosis, Haemophilus parasuis, Escherichia coli, Pasteurella multocida, Salmonella, and Staphylococcus aureus, was performed.

[0059] The results showed that the method described in this invention can specifically detect non-classical Brucella species. B. anthropi It does not cross-react with classic Brucella species such as cattle, sheep, pigs, and dogs, nor with other pathogens such as Escherichia coli and Salmonella, exhibiting good specificity. Figure 5 ).

[0060] In summary, the real-time quantitative PCR method established by the present invention can be used for non-classical Brucella species. B. anthropi This method provides specific detection and can differentiate Brucella species from classic species such as cattle, sheep, pigs, and dogs. It features high specificity, high sensitivity, good repeatability, and is simple and rapid, providing important technical support for the precise prevention and control of brucellosis in cattle and sheep.

[0061] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The use of the sequence shown in SEQ ID NO.1 in the specific identification of non-classical Brucella species B. anthropi for purposes other than disease diagnosis and / or treatment.

2. A primer-probe combination for specifically identifying the non-classical species Brucella anthropi, characterized in that, A primer-probe combination was designed using the sequence shown in SEQ ID NO.1 as the target sequence, as described in claim 1. The primer-probe combination includes primer pairs and probes, wherein the primer pairs include a forward primer as shown in SEQ ID NO.2 and a reverse primer as shown in SEQ ID NO.3; and the sequence of the probe is shown in SEQ ID NO.

4.

3. The primer-probe combination according to claim 2, characterized in that, The probe has a fluorescent reporter group attached to its 5' end and a quencher group attached to its 3' end. The fluorescent reporter group includes FAM, and the quencher group includes BHQ1.

4. The use of the primer-probe combination of claim 2 or 3 in the preparation of products for identifying non-classical Brucella anthropi.

5. A kit for identifying non-classical Brucella species B. anthropi, characterized in that, It includes the primer-probe combination as described in claim 2 or 3.

6. The use of the primer-probe combination of claim 2 or 3 in the identification of non-classical Brucella species B. anthropi for non-disease diagnosis and / or treatment purposes.

7. A method for identifying non-classical Brucella species *B. anthropi* for purposes other than disease diagnosis and / or treatment, characterized in that, Includes the following steps: (1) Extract nucleic acid from the sample to be tested to obtain a nucleic acid sample; (2) Amplify the nucleic acid sample using the primer and probe set described in claim 2 or 3.

8. The method according to claim 7, characterized in that, The total volume of the amplification reaction in step (2) is 20 μL, including 10 μL of 2×qPCR probe Master mix, 0.6 μL of forward primer, 0.6 μL of reverse primer, 0.3 μL of probe, 1 μL of nucleic acid sample, and 7.5 μL of double-distilled water.

9. The method according to claim 7, characterized in that, The amplification reaction procedure in step (2) is as follows: pre-denaturation at 95℃ for 15 min; denaturation at 95℃ for 5 s; annealing at 62℃ for 30 s, for 40 cycles.

Images