A molecular marker, KASP detection primer and application significantly related to soybean protein content

Abstract

The application discloses a molecular marker significantly related to soybean protein content, a KASP detection primer and application, and belongs to the technical field of molecular biology. The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, and an A / C mutation exists at the 22th base. The genotypes of the mutation site include AA and CC genotypes. The KASP primer group for detecting the molecular marker can be used to identify the high and low of soybean protein content, screen soybean varieties or strains with high soybean protein content, and carry out molecular marker assisted breeding on the soybean protein content. The KASP primer group for detecting the molecular marker developed in the application has the characteristics of low cost and high throughput in practical application, and is high in specificity, and the method is accurate and reliable. The KASP primer group for detecting the molecular marker effectively solves the problems of low breeding efficiency and poor accuracy in traditional breeding, and accelerates the breeding of high-protein soybean varieties.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a molecular marker, KASP detection primer, and their applications that are significantly correlated with soybean protein content. Background Technology

[0002] Soybeans Glycine max Soybean (L.) Merr. is a globally important oilseed and food crop, with its seeds containing approximately 40% protein, making it a major source of plant protein for humans, providing about 68% of the world's total protein consumption. Soybean protein contains all eight essential amino acids that the human body cannot synthesize, possessing extremely high nutritional value. With rising dietary standards, the demand for soybean protein continues to increase, leading to a growing imbalance between domestic soybean supply and demand. Therefore, the rapid and effective breeding of high-protein soybean varieties is of significant production importance for increasing soybean protein content. Research shows that soybean protein content is regulated by multiple genes and is easily influenced by the environment, classifying it as a complex quantitative trait. Traditional high-protein soybean breeding primarily relies on single-plant selection based on the protein content of offspring. This method is not only time-consuming and labor-intensive but also susceptible to environmental interference, resulting in low selection accuracy. Therefore, developing molecular markers closely linked to soybean protein content for early-stage (low-generation) selection can significantly reduce breeding workload and accelerate the breeding process.

[0003] Genome-wide association study (GWAS), as an effective gene mapping tool, can rapidly and accurately identify genes controlling soybean protein content. Although many researchers have conducted QTL mapping and SNP association analysis on soybean protein content, the number of genes controlling soybean protein content reported so far remains relatively small, and functional KASP markers that can be directly applied to marker-assisted selection are even less reported. Kompetitive allele-specific PCR (KASP) is a novel SNP genotyping method established based on the Amplification Refractory Mutation System (ARMS) and high-sensitivity fluorescence detection technology. Its principle is to design two forward primers and one universal reverse primer targeting allele SNP sites. Each forward primer carries a different fluorescent tag, and real-time fluorescence PCR amplification achieves accurate differentiation of allelic variations (He CL, et al . SNP genotyping: the KASP assay. Methods Mol Biol(2014, 1145, 75-86). However, while there are many reports on soybean protein-related QTLs and SNPs, reports on soybean protein KASP markers are rare.

[0004] Current technologies lack a molecular marker and its application method for accurately, efficiently, and early selecting high-protein soybean materials. The main problems are: firstly, most reported soybean protein content-related QTLs and SNPs are based on specific environments or populations, lacking universality and stability, and are difficult to directly convert into stable and reliable KASP markers; secondly, because soybean protein content is regulated by multiple genes and has strong environmental interactions, developing KASP markers that are closely linked, accurately genotyped, and suitable for large-scale breeding screening presents technical difficulties, including difficulty in controlling the linkage distance between the marker and the target gene, low fluorescence signal discrimination, and significant differences in marker effectiveness under different genetic backgrounds.

[0005] Therefore, developing KASP markers closely linked to soybean protein content for early (low generation) selection in breeding can significantly promote the reduction of breeding workload and accelerate the breeding process. At the same time, strengthening the mining and utilization of soybean protein content genes and developing molecular markers for auxiliary breeding are crucial for high-protein soybean breeding. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker, KASP detection primers, and applications that are significantly correlated with soybean protein content, thereby addressing the problems existing in the prior art. The KASP marker provided by this invention can accurately distinguish between SNP sites (A / C) related to soybean protein content, with the CC genotype showing significantly higher protein content than the AA genotype. This marker is unaffected by environmental factors and can be used for high-throughput, low-cost screening in the early stages of breeding, effectively solving the problems of low efficiency and poor accuracy in traditional breeding methods, and accelerating the selection of high-protein soybean varieties.

[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides a molecular marker that is significantly associated with soybean protein content. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is an A / C mutation at the 22nd base. The genotypes of this mutation site include AA and CC genotypes.

[0008] The present invention also provides a KASP primer set for detecting the molecular marker, comprising an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.3, and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.4.

[0009] The present invention also provides a detection kit for the molecular marker described above, comprising the KASP primer set described above.

[0010] This invention also provides the application of the KASP primer set or the detection kit described herein in identifying the level of soybean protein.

[0011] This invention also provides a method for identifying the level of soybean protein, comprising the following steps: Using the genomic DNA of the soybean sample to be tested as a template, the template is amplified by real-time quantitative PCR using the KASP primer set or the detection kit. After the PCR amplification is completed, the fluorescence signal is read, the fluorescence signal is analyzed and converted, the genotype is identified, and the soybean protein content is determined based on the genotype. If the identified genotype is AA, the soybean sample is judged to have a low protein content; if the identified genotype is CC, the soybean sample is judged to have a high protein content.

[0012] Optionally, the procedure for the quantitative PCR amplification is as follows: activation at 94℃ for 15 min; denaturation at 94℃ for 20 sec, annealing at 61~55℃ for 60 sec, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 94℃ for 20 sec, annealing at 55℃ for 60 sec, for 26 cycles.

[0013] Optionally, the fluorescence quantitative PCR amplification system is as follows: 2 μL of template DNA at 25 ng / μL, 5 μL of 2×KASPMaster mix, 0.14 μL of KASP mixed primers, and 2.9 μL of water; the volume ratio of upstream primer F1, upstream primer F2, and downstream primer R in the KASP mixed primers is 2:2:5.

[0014] The present invention also provides the application of the KASP primer set or the detection kit described herein in screening soybean varieties or lines with high protein content.

[0015] The present invention also provides the application of the KASP primer set or the detection kit described herein in marker-assisted breeding of soybean protein content traits.

[0016] The present invention discloses the following technical effects: The soybean protein content-related SNP locus S13_13349365 and its KASP molecular marker provided by this invention can effectively solve the technical problem of lacking stable, efficient, and suitable high-protein soybean molecular markers for early-generation selection in existing technologies. Compared with the traditional method of selecting individual plants based on protein content in high-protein soybean breeding, the KASP molecular marker of this invention is not affected by the environment and can accurately distinguish genotypes in the early stages of breeding (low generations), significantly reducing the breeding workload and accelerating the breeding process. Experimental results show that the average protein content of CC genotype materials was 44.92% and 47.55% in two years, respectively, significantly higher than that of AA genotype materials (39.45% and 41.96%), proving that the marker is closely linked to the high-protein trait and has high selection accuracy.

[0017] Furthermore, the KASP molecular marker detection method of this invention is simple to operate, low in cost, and high in throughput. Compared with existing SNP detection technologies such as sequencing, DNA microarrays, and mass spectrometry, it does not require expensive equipment or complex operating procedures, and can achieve endpoint fluorescence signal reading and genotyping on a conventional real-time quantitative PCR instrument. This marker has specific distinguishing ability for A / C allelic variations at SNP sites, and the genotyping results are clear and reliable. It is suitable for rapid screening and identification of high-protein materials in large-scale breeding populations, providing an efficient and practical tool for marker-assisted breeding of high-protein soybeans. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 The images show the Manhattan and QQ-plots of the soybean protein GWAS results; where A and B represent the Manhattan plots of the soybean protein GWAS results for 2022 and 2023, respectively, and the dashed lines in the figures represent the significant association threshold -log(p-value) ≥ 5.0. Figure 2 The results of KASP molecular marker genotyping detection for different soybean varieties are shown. The black dots near the origin represent blank controls without template DNA. The green dots near the Y-axis and the red dots near the X-axis represent soybean varieties carrying the C allelic variant and soybean varieties carrying the A allelic variant, respectively. Detailed Implementation

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0025] Example 1: Obtaining SNP sites significantly associated with soybean protein content 1. Test materials and genomic DNA extraction From 1084 soybean germplasm resources, 264 representative soybean germplasm resources were selected as research subjects, including 52 local varieties and 212 cultivated varieties, constituting the soybean microcore germplasm resources (detailed material information is shown in Table 1). The above materials have been published in the literature (Zhang, W., Xu, W., Zhang, H. et al. Comparativeselective signature analysis and high-resolution GWAS reveal a new candidate gene controlling seed weight in soybean. Theor Appl Genet (2021). https: / / doi.org / 10.1007 / s00122-021-03774-6).

[0026] Table 1. Names and IDs of soybean natural populations used for resequencing and genome-wide association analysis. Genomic DNA was extracted from the young leaves of the above 264 soybean materials using the CTAB method. The DNA quality was assessed by agarose gel electrophoresis and NanoDrop spectrophotometer, and met the A standard. 260 / A 280 The ratio was between 1.8 and 2.0. The concentration was diluted to 50 ng / μL and stored at -20℃ for later use. Whole-genome resequencing with 10× coverage was performed on the above 264 materials. The raw sequencing data were quality filtered (removing adapter sequences, low-quality reads, and reads containing more than 10% N) and then compared with the soybean reference genome (Glycine max v2.0) to obtain a high-density SNP marker map covering the entire genome.

[0027] 2. Determination of soybean protein content The aforementioned 264 soybean materials were grown in two independent environments in 2022 and 2023. Mature seeds were harvested and dried to constant weight in a 65℃ oven. The dried seeds were thoroughly mixed, pulverized, and passed through a 0.25 mm sieve, then placed in sample vials for later use. 0.2 g of the sample, accurate to 0.0001 g, was weighed and placed in a 300 mL digestion tube. The seed protein content was determined according to the Kjeldahl method (on a dry basis, protein conversion factor 5.71) in GB 5009.5-2016, "National Food Safety Standard - Determination of Protein in Food". Each sample was measured three times, and the average value was taken.

[0028] 3. Genome-wide association study (GWAS) Genome-wide association analysis was performed using the GAPIT algorithm package in R software, employing a mixed linear model (MLM). SNP loci obtained from sequencing were used as genotypic data, and protein content phenotypic values ​​under two different environments were used as phenotypic data. Population structure (Q matrix) and phylogenetic relationships (K matrix) were considered as covariates.

[0029] GWAS analysis showed that 61 SNP loci significantly associated with soybean protein content were detected in 2022 (-log10(P) ≥ 3.0), and 63 were detected in 2023. Among them, the SNP locus S13_13349365, located at position 13,349,365 bp on chromosome 13, was stably detected in both environments. Figure 1 The phenotypic variation explained by this locus was 7.1% (the highest among all detected loci). The physical location of this locus in the soybean reference genome v2.0 is Chr13:13,349,365, with alleles A / C.

[0030] Example 2: Development of KASP marker primers based on SNP site S13_13349365 1. Target sequence acquisition Based on the soybean reference genome v2.0, 100 bp of genomic sequences were extracted upstream and downstream of SNP site S13_13349365, and their nucleotide sequences are shown in SEQ ID NO.1. The polymorphism of this site is A / C, where A represents an allelic variant that decreases protein content and C represents an allelic variant that increases protein content.

[0031] SEQ ID NO.1: agttcctgacatgatgagatamagaaacagctcctgacattttctctattagatactgattgatttctcaatatatatatatatatatatatatatatttcttaaaactttttgtagatactcttaaccctcagcaatatattgggataggattacatcaaggtttggcct.

[0032] 2. KASP primer design Competitive allele-specific PCR primers were designed using NCBI's Primer-BLAST tool (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) with SEQ ID NO.1 as a template. The design principles included: the 3' ends of the two forward primers corresponded to the two allelic variants (A and C) of the SNP site, respectively; different fluorescent adapter sequences were added to the 5' ends of the two forward primers; and universal primers were used for the reverse primers. The specific primer sequences are as follows: Upstream primer F1 (corresponding to the C allele, carrying the FAM fluorescent adapter): 5'- gaaggtgaccaagttcatgct agttcctgacatgatgagataa-3' (SEQ ID NO. 2); Upstream primer F2 (corresponding to the A allele, carrying a HEX fluorescent adapter): 5'- gaaggtcggagtcaacggatt agttcctgacatgatgagatac-3' (SEQ ID NO. 3); Downstream universal primer R: 5'-aggccaaaccttgatgtaatcct-3' (SEQ ID NO. 4).

[0033] The underlined portions represent fluorescent linker sequences: F1 linker sequence is FAM (6-carboxyfluorescein), and F2 linker sequence is HEX (hexachloro-6-methylfluorescein). These primers were synthesized by a commercial company and purified by PAGE.

[0034] Example 3: Application of KASP markers in soybean genotyping and high-protein variety breeding 1. Genomic DNA extraction from the sample to be tested Young leaves of the soybean variety to be tested were taken, and genomic DNA was extracted using the CTAB method. After quality control, the DNA was diluted to a working concentration of 25 ng / μL.

[0035] 2. KASP reaction system and amplification procedure The KASP reaction system consisted of 10 μL of the following components: soybean sample DNA template, 25 ng / μL, 2 μL; 2×KASP Master mix, 5 μL; KASP Assay Mix, F1:F2:R = 2:2:5, 0.14 μL; and water, 2.9 μL.

[0036] The amplification program was performed on an ABI 7500 real-time quantitative PCR instrument. The reaction conditions were as follows: activation at 94℃ for 15 min; denaturation at 94℃ for 20 sec, annealing at 61~55℃ for 60 sec, with a decrease of 0.6℃ per cycle, for 10 cycles; and denaturation at 94℃ for 20 sec, annealing at 55℃ for 60 sec, for 26 cycles.

[0037] 3. Fluorescence signal reading and genotype determination After the amplification reaction, the endpoint fluorescence signal was read using the software included with the ABI 7500 real-time quantitative PCR instrument. The excitation wavelengths were FAM: 485 nm and HEX: 535 nm, and the emission wavelengths were FAM: 520 nm and HEX: 556 nm. Based on the fluorescence signal intensity, genotype clustering analysis was performed on the scatter plot: samples closer to the X-axis (HEX channel positive) were AA genotypes, samples closer to the Y-axis (FAM channel positive) were CC genotypes, samples in the middle of the diagonal were AC heterozygous, and samples closer to the origin were negative controls (NTC).

[0038] 4. Application Results Genotyping of 45 soybean accessions was performed using the aforementioned KASP marker primers. The results are as follows: Figure 2 As shown in Table 2, this molecular marker can clearly distinguish between the two genotypes. Among them, 15 accessions carrying the C allele (CC genotype) had an average protein content of 44.92% in 2022 and 47.55% in 2023; 30 accessions carrying the A allele (AA genotype) had an average protein content of 39.01% in 2022 and 41.63% in 2023. The results indicate that the protein content of the CC genotype was significantly higher than that of the AA genotype (P<0.01), confirming that the C allele at SNP site S13_13349365 is a favorable allele for increasing protein content. This KASP marker can be used for early screening of high-protein soybean breeding materials.

[0039] Table 2. Protein content and genotyping results of 45 soybean samples. The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker significantly correlated with soybean protein content, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, with an A / C mutation at the 22nd base. The genotypes at this mutation site include AA and CC genotypes.

2. A KASP primer set for detecting the molecular marker of claim 1, characterized in that, It includes upstream primer F1 with nucleotide sequence as shown in SEQ ID NO.2, upstream primer F2 with nucleotide sequence as shown in SEQ ID NO.3, and downstream primer R with nucleotide sequence as shown in SEQ ID NO.

4.

3. A detection kit for molecular markers as described in claim 1, characterized in that, It includes the KASP primer set as described in claim 2.

4. The application of the KASP primer set of claim 2 or the detection kit of claim 3 in identifying the level of soybean protein content.

5. A method for identifying the protein content of soybeans, characterized in that, Includes the following steps: Using the genomic DNA of the soybean sample to be tested as a template, the template is amplified by real-time quantitative PCR using the KASP primer set described in claim 2 or the detection kit described in claim 3. After the PCR amplification is completed, the fluorescence signal is read, the fluorescence signal is analyzed and converted, the genotype is identified, and the soybean protein content is determined based on the genotype. If the identified genotype is AA, the soybean sample is judged to have a low protein content; if the identified genotype is CC, the soybean sample is judged to have a high protein content.

6. The method according to claim 5, characterized in that, The procedure for quantitative real-time PCR amplification is as follows: activation at 94℃ for 15 min; denaturation at 94℃ for 20 sec, annealing at 61~55℃ for 60 sec, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 94℃ for 20 sec, annealing at 55℃ for 60 sec, for 26 cycles.

7. The method according to claim 5, characterized in that, The quantitative real-time PCR amplification system consisted of: 2 μL of 25 ng / μL template DNA, 5 μL of 2×KASP Master mix, 0.14 μL of KASP mixed primers, and 2.9 μL of water; the volume ratio of upstream primer F1, upstream primer F2, and downstream primer R in the KASP mixed primers was 2:2:

5.

8. The application of the KASP primer set of claim 2 or the detection kit of claim 3 in screening soybean varieties or lines with high protein content.

9. The application of the KASP primer set of claim 2 or the detection kit of claim 3 in molecular marker-assisted breeding of soybean protein content traits.

Images