Functional snp molecular marker for regulating corn stem thickness and application thereof

Abstract

The application discloses a SNP molecular marker closely linked with the thickness of corn stalk, a matched KASP primer combination and application thereof. The SNP is located at 139,007,656 bp of chromosome 7 of corn, is a C / G missense mutation of gene Zm00001eb316920 exon, and amino acid is changed from histidine to aspartic acid; based on GWAS analysis of phenotypes of stalk elliptic short axis D1 and long axis D2 of 561 corn inbred lines in six fields in two years, the site is significantly associated with stalk thickness in all environments; the stalk length short axis value of the CC genotype is small, the stalk is thin and easy to break, the stalk length short axis value of the GG genotype is larger, the stalk is thick and strong and resistant to lodging. Three KASP specific fluorescent primers are designed, high-throughput typing can be realized at the seedling stage, field identification at the mature stage is not needed, the breeding cycle of the lodging-resistant corn is greatly shortened, and the application is suitable for molecular marker assisted breeding of corn, and genetic improvement of germplasm resources.

Description

Technical Field

[0001] This invention belongs to the field of maize molecular breeding and functional molecular marker technology, specifically involving a major missense SNP molecular marker based on the two-dimensional phenotype of the short axis D1 and long axis D2 of the elliptical cross section of maize stalk, mined by multi-year multi-site GWAS, a matching KASP fluorescent typing primer combination, and the application of this marker in predicting stalk thickness in maize seedlings, screening lodging-resistant germplasm, and improving the genetic quality of backbone self-pollination. Background Technology

[0002] Maize (Zea mays L.) is my country's largest dual-purpose crop for both grain and forage. High-density planting and high yield are the current mainstream cultivation methods. Stalk breakage and lodging caused by strong winds and heavy rains are the most critical limiting factors restricting stable maize yields and mechanized harvesting. The cross-section of maize stalks is naturally elliptical, and a single diameter cannot objectively reflect the mechanical strength of the stalk. In breeding research, two indicators are usually used to comprehensively determine the stalk robustness: the short axis D1 and the long axis D2 of the elliptical cross-section of the above-ground nodes. The larger the values ​​of D1 and D2, the more vascular bundles and lignin are accumulated in the stalk, and the stronger the resistance to stalk breakage.

[0003] Existing genetic resources for regulating maize stem diameter have multiple shortcomings:

[0004] Most existing stem diameter QTLs / SNPs are only significant in a single environment, and have poor stability across years and production areas, making them unsuitable for nationwide breeding.

[0005] Traditional phenotypic identification requires manual measurement of D1 and D2 at the physiological maturity stage of maize, which consumes a large amount of experimental fields and manpower for large populations and prolongs the breeding cycle;

[0006] Traditional SSR and Indel markers rely on electrophoresis, which has low throughput and cannot be used for large-scale seedling screening; commercial chips are expensive and not suitable for small and medium-sized breeding units.

[0007] There is currently no KASP functional marker based on gene exon missense mutations that is stably associated with both the long and short axes of the elliptical cross section of the stem over many years and at multiple locations.

[0008] To address the aforementioned industry and technological challenges, this invention, based on a population of 561 inbred lines from six locations across four major maize-producing regions in China over two years, simultaneously measured the short and long axis phenotypes of the elliptical cross-section of the stem. By jointly screening three GWAS models, exon missense NPs were obtained, and a low-cost KASP detection system was developed to enable rapid prediction of stem thickness at maturity during the seedling stage. Summary of the Invention

[0009] In view of this, the present invention provides a molecular marker closely linked to the thickness of maize stalks and its application. This molecular marker can quickly and accurately screen maize materials with ideal plant type (such as thicker stalks) during the seedling stage, significantly improving breeding efficiency.

[0010] To achieve the above objectives, the present invention adopts the following technical solution:

[0011] In a first aspect, the present invention provides a molecular marker, wherein the SNP site is located at 139,007,656 bp on chromosome 7 of maize, and the nucleotide polymorphism is C / G;

[0012] It should be noted that this invention is based on field trial data from six locations over two years, conducting a stem phenotypic survey on an associated population composed of 561 maize inbred lines. Combined with genome-wide association analysis (GWAS), a single SNP locus was identified that showed a highly significant association with both the long and short axes of the elliptical cross-section of the stem under all experimental conditions: SNP_Chr7_139007656 (see Tables 1 and 2 for details). Using the maize B73 reference genome (RefGen_v5) as a baseline, this SNP is located at 139,007,656 bp (C / G) on chromosome 7.

[0013] Among the 561 inbred lines, 221 carried the B73 reference allele (C), with a frequency of 0.3940; and 340 carried the mutant allele (G), with a frequency of 0.6060. Sequence annotation showed that the SNP was a missense mutation in exon Zm00001eb316920. Wild-type C encodes histidine (H, neutral to weakly basic, with an imidazole ring on the side chain that can form hydrogen bonds to maintain the protein's spatial conformation); mutant G encodes aspartic acid (D, strongly acidic, permanently negatively charged). The drastic changes in amino acid charge and side chain polarity lead to alterations in the three-dimensional structure of the encoded protein, directly regulating the lignin and cellulose synthesis pathways in maize stem nodes, and ultimately affecting the growth and development of the long and short axes of the stem cross-section.

[0014] The KASP molecular marker of this invention is designed based on the aforementioned SNP loci. Individuals with the CC genotype exhibit thinner stems, while those with the GG genotype exhibit thicker stems. Therefore, the G haplotype is a dominant allele for improving stem thickness to enhance lodging resistance, and it has significant application value in plant type improvement and high-density planting breeding.

[0015] Secondly, the present invention provides a primer pair combination, the primer pair combination comprising:

[0016] SNP_Chr7_139007656_F1, nucleotide sequence as shown in SEQ ID NO:1, specifically 5′-GAAGGTGACCAAGTTCATGCTCGGGCTGGATTTCTGGACC-3′

[0017] SNP_Chr7_139007656_F2, nucleotide sequence as shown in SEQ ID NO:2, specifically 5′-GAAGGTCGGAGTCAACGGATTCGGGCTGGATTTCTGGACG-3′

[0018] SNP_Chr7_139007656_R, nucleotide sequence as shown in SEQ ID NO:3, specifically 5′-GCATAGGCAATCACAATTCAT-3′.

[0019] Preferably, the nucleotide sequence of SNP_Chr7_139007656_F1 includes a universal tag for the FAM fluorescent channel, and the nucleotide sequence of SNP_Chr7_139007656_F2 includes a universal tag for the HEX fluorescent channel. It should be noted that in the nucleotide sequence of SNP_Chr7_139007656_F1, the prefix sequence GAAGGTGACCAAGTTCATGCT is the universal tag for the FAM fluorescent channel (corresponding to allele C), and in the nucleotide sequence of SNP_Chr7_139007656_F2, GAAGGTCGGAGTCAACGGATT is the universal tag for the HEX fluorescent channel (corresponding to allele G).

[0020] Thirdly, the present invention provides an application of the aforementioned molecular marker in detecting or predicting the phenotypic level of maize stalk thickness, wherein when the genotype of the maize plant at the above-mentioned locus is CC, it exhibits a thinner stalk; and when the genotype is GG, it exhibits a thicker stalk.

[0021] Fourthly, the present invention provides an application of the aforementioned molecular marker in marker-assisted selection breeding of maize.

[0022] Fifthly, the present invention provides an application of the aforementioned molecular marker in the genetic improvement of maize germplasm resources.

[0023] Sixthly, the present invention provides a method for detecting the thickness of corn stalks, comprising the following steps:

[0024] S1. Extract genomic DNA from the maize sample to be tested;

[0025] S2. Using the DNA as a template and the primer pair combination, add KASP genotyping premix to prepare the KASP reaction system.

[0026] S3. Perform PCR amplification and genotyping the amplification products by fluorescence signal detection;

[0027] S4. Determine the phenotypic tendency of corn stalk thickness based on genotyping results: If the genotype of the SNP locus is CC, the plant is determined to have a thinner stalk; if the genotype is GG, the plant is determined to have a thicker stalk.

[0028] Preferably, in step S2, the KASP reaction system comprises: 2.5 μL of KASP2×PCRMix; 0.6 μL of primer premix; and 1.5 μL of template DNA (DNA concentration 15-30 ng / μL).

[0029] Preferably, in step S3, the PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 61℃ annealing / extension for 60 s, for a total of 10 cycles, with the annealing temperature decreasing by 0.6℃ in each cycle; followed by 30 cycles: 95℃ denaturation for 15 s, 55℃ annealing / extension for 60 s; and finally incubation at 37℃ for 30 s.

[0030] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0031] (1) Based on field trial data from six locations over two years, this invention investigated the phenotypic characteristics of the stem cross-section (short axis D1 and long axis D2) of an associated population composed of 561 maize inbred lines. Combined with genome-wide association analysis (GWAS), a SNP locus that was significantly associated with D1 / D2 under all experimental conditions was identified: SNP_Chr7_139007656. This molecular marker can rapidly and accurately screen maize materials with ideal plant type (such as thicker stems) at the seedling stage, significantly improving breeding efficiency.

[0032] (2) This invention utilizes KASP genotyping technology to achieve rapid, low-cost, and high-throughput genotyping at the maize seedling stage without the need for enzyme digestion, electrophoresis, or sequencing. This method is simple to operate and provides reliable results, which can significantly reduce the workload of field phenotyping, shorten the breeding cycle, and provide an efficient tool for molecular design breeding of ideal maize plant types (thick stalks, lodging resistance). Attached Figure Description

[0033] Figure 1 The GWAS analysis results of the short axis D1 of the stem cross section of the maize associated population in Tieling City, Liaoning Province (TL) in 2024, provided in Example 1, are based on the Manhattan plots of the GLM, Q model and K model;

[0034] Figure 2 The GWAS analysis results of the long axis D2 of the stem cross section of the maize associated population in Tieling City, Liaoning Province (TL) in 2024, provided in Example 1, are based on the Manhattan plots of the GLM, Q model and K model;

[0035] Figure 3The Manhattan plot is based on the genome-wide association analysis (GWAS) results of the short axis D1 of the stalk cross section of the maize associated population in Haidian District, Beijing (BJ) in 2025, as provided in Example 1, and is analyzed using the general linear model (GLM), Q model, and K model.

[0036] Figure 4 The Manhattan plot is based on the genome-wide association analysis (GWAS) results of the long axis D2 of the stalk cross section of the maize associated population in Haidian District, Beijing (BJ) in 2025, as provided in Example 1, and is analyzed using the general linear model (GLM), Q model, and K model.

[0037] Figure 5 Haplotype box plot of the genotypes (CC vs GG) and stem cross-sectional short axis D1 trait of the 561 related population inbred lines provided in Example 1 at the SNP_Chr7_139007656 locus;

[0038] Figure 6 Haplotype box plots of the genotypes (CC vs GG) and stem cross-sectional long axis D2 trait of the 561 related population inbred lines provided in Example 1 at the SNP_Chr7_139007656 locus;

[0039] Figure 7 The image shows the KASP genotyping results of the 80 maize inbred lines provided in Example 2.

[0040] Note: Figure 7 - Blue square (FAM fluorescence channel): represents genotype CC (reference allele, corresponding to thinner stem); - Red square (HEX fluorescence channel): represents genotype GG (mutant allele, corresponding to thicker stem); - Black square: negative control (NTC) (Note: Each material was tested twice in duplicate, and the results were consistent). Detailed Implementation

[0041] The present invention will be further described in detail below with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention. Unless otherwise specified, the technical means used in the embodiments are all conventional methods in the art, and the reagents used are all commercially available. The maize materials used in the embodiments of the present invention are all from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0042] Example 1: GWAS analysis and haplotype analysis related to maize stalk thickness.

[0043] 1.1 Building Related Groups

[0044] This embodiment uses 561 high-quality maize inbred lines with rich genetic backgrounds collected from multiple breeding units across the country as the associated population, covering major maize producing areas in my country (such as Northwest, Southwest, North China and Northeast regions).

[0045] 1.2 Field phenotypic survey

[0046] Experimental materials were planted in Haidian District, Beijing (BJ), Tieling City, Liaoning Province (TL), Gongzhuling County, Jilin Province (JL), and Harbin City, Heilongjiang Province (HEB) in 2024. Planting continued in Haidian District, Beijing (BJ) and Tieling City, Liaoning Province (TL) in 2025. Conventional water and fertilizer management was used. After pollen shedding, the width of the minor and major axes of the first stem segment above ground was measured using vernier calipers, in millimeters (mm). Three plants were measured per row, and the average value was taken.

[0047] 1.3 GWAS analysis and SNP locus identification

[0048] Whole-genome resequencing was performed on 561 accessions, yielding approximately 6.25 million high-quality SNP markers after quality control. GWAS analysis was conducted using TASSEL 5.0 software based on three models:

[0049] (1) Generalized Linear Model (GLM);

[0050] (2) GLM (Q model) with population structure correction added;

[0051] (3) Hybrid linear model integrating group structure and kinship (K model, MLM).

[0052] The results are as follows Figures 1 to 4 As shown, the analysis results identified a SNP locus on chromosome 7 of maize that is significantly associated with both the short and long axes of the elliptical cross-section of the stalk:

[0053] SNP_Chr7_139007656 (Location: 139,007,656bp, Polymorphism: C / G)

[0054] The above-mentioned loci were significantly correlated with the short axis D1 and long axis D2 of the stem elliptical cross section in all experimental years (2024-2025) and geographical locations (see Table 1 for details). Analysis of the data in Table 1 shows that the loci exhibited extremely high statistical significance (P values ​​all reached the significance level) in detection in different years and ecological zones, and the results were highly consistent, indicating that it has broad applicability.

[0055] Table 1. P-values ​​of significant SNP sites in maize stalk cob thickness in multi-year, multi-location GWAS (based on multiple models).

[0056]

[0057] Note: StemDiam1 = minor axis D1 (mm) of the elliptical cross section of the stem; StemDiam2 = major axis D2 (mm) of the elliptical cross section of the stem.

[0058] 1.4 Haplotype-Phenotype Association Analysis

[0059] Haplotypes constructed based on SNP sites:

[0060] Reference haplotype (CC): 221 materials (frequency 0.3940), the mean values ​​of the minor axis D1 and major axis D2 of the elliptical cross section of the stem of the corresponding population were significantly lower, and the stems were slender;

[0061] Mutant haplotype (GG): 340 materials (frequency 0.6060), the corresponding population had significantly larger mean values ​​for stem D1 and D2, thicker stems, and stronger resistance to stem breakage.

[0062] In 561 associated populations, the short and long axis phenotypes of the stem elliptical cross-sections of the two haplotypes showed highly significant differences. Figure 5 , Figure 6 ).

[0063] Example 2: Development and validation of KASP molecular markers related to maize stalk thickness

[0064] 2.1 Test materials

[0065] Eighty maize inbred lines with significant differences in the minor axis (D1) and major axis (D2) of their elliptical stem cross-sections were selected for KASP typing verification. Among them:

[0066] Low phenotype group (40 samples): The average minor axis D1 was 18.23 mm and the major axis D2 was 21.14 mm in the two-year, six-location test; High phenotype group (40 samples): The average minor axis D1 was 23.28 mm and the major axis D2 was 25.92 mm.

[0067] All materials were obtained from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. Detailed SNP genotype and multi-site phenotypic data are shown in Tables 2 (short axis D1) and 3 (long axis D2). Statistical results showed that the mean short axis and long axis of the CC genotype materials were significantly lower than those of the GG genotype materials. Furthermore, in the two-year, seven-site experiment, the short axis D1 and long axis D2 of the two genotypes showed highly significant differences, demonstrating the close linkage between this marker and the target trait.

[0068] Table 2. Stalk short axis D1 data and genotypes of 80 maize materials

[0069]

[0070]

[0071]

[0072] Table 3. D2 data and genotypes of stalk long axis of 80 maize materials.

[0073]

[0074]

[0075] Note: "NA" indicates missing values ​​due to abnormalities such as seedling emergence.

[0076] 2.2 Development of KASP molecular markers

[0077] Based on SNP_Chr7_139007656 (C / G) of the maize B73 reference genome (RefGen_v5), 200bp flanking sequences were extracted from its upstream and downstream sides for KASP primer design.

[0078] The developed KASP marker consists of three primers:

[0079] Two allele-specific forward primers (corresponding to C / G alleles respectively).

[0080] A universal reverse primer.

[0081] The primer sequences are as follows (synthesized by Beijing Liuhe BGI Genomics Co., Ltd.):

[0082] SNP_Chr7_139007656_F1 (SEQ ID NO:1):

[0083] 5′-GAAGGTGACCAAGTTCATGCTCGGGCTGGATTTCTGGACC-3′

[0084] SNP_Chr7_139007656_F2 (SEQ ID NO:2):

[0085] 5′-GAAGGTCGGAGTCAACGGATTCGGGCTGGATTTCTGGACG-3′

[0086] SNP_Chr7_139007656_R (SEQ ID NO:3):

[0087] 5′-GCATAGGCAATCACAATTCAT-3′

[0088] Among them, the prefix GAAGGTGACCAAGTTCATGCT is a universal tag for the FAM fluorescence channel (corresponding to allele C); the prefix GAAGGTCGGAGTCAACGGATT is a universal tag for the HEX fluorescence channel (corresponding to allele G).

[0089] 2.3 Genomic DNA Extraction

[0090] Genomic DNA was extracted from 80 fresh maize seedling leaves using a modified CTAB method. The specific steps are as follows:

[0091] (1) Take 3-5 mg of leaf tissue, place it in a 2.0 mL centrifuge tube, add a steel ball, freeze it with liquid nitrogen, and then shake it for 30 s using an automatic grinder;

[0092] (2) Add 500 μL of CTAB buffer (containing 2% β-mercaptoethanol) preheated to 65°C and mix gently.

[0093] (3) Incubate in a water bath at 65℃ for 1 hour, inverting and mixing once every 15-20 minutes during the period;

[0094] (4) After cooling to room temperature, centrifuge briefly, add 500 μL of chloroform:isoamyl alcohol (24:1), gently invert and mix, let stand for 30 min and mix again, repeat twice, centrifuge at 12,000 rpm for 10 min.

[0095] (5) Pipette 400 μL of supernatant into a new tube, add an equal volume (400 μL) of pre-cooled isopropanol, and precipitate at -20℃ for 30 min;

[0096] (6) Centrifuge at 4℃ and 12,000 rpm for 10 min, and discard the supernatant;

[0097] (7) Add 300 μL of 70% ethanol to wash the precipitate, centrifuge at 12,000 rpm for 5 min, and air dry at room temperature;

[0098] (8) Dissolve the DNA in 50 μL ddH2O.

[0099] DNA quality testing:

[0100] Integrity was verified by agarose gel electrophoresis (1%, 60V, 35min);

[0101] NanoDrop was used to determine the concentration and purity, ensuring that the OD260 / 280 ratio was between 1.8 and 2.0.

[0102] 2.4KASP Genotyping and Validation

[0103] Dilute the DNA sample to a final concentration of 15-30 ng / μL, and perform two technical replicates for each sample. The KASP reaction system (5 μL) consists of the following:

[0104] KASP2×PCR Mix: 2.5 μL;

[0105] Primer premix: 0.6 μL (mix 10 μM of SEQ ID NO:1, NO:2, NO:3 with ddH2O in a volume ratio of 1:1:2:6*).

[0106] Template DNA (15-30 ng / μL): 1.5 μL.

[0107] Note: The standard KASP primer mixing ratio is usually F1:F2:R=1:1:2, and the total primer concentration needs to be balanced.

[0108] PCR amplification procedure:

[0109] Pre-denaturation at 95℃ for 10 min;

[0110] 95℃ denaturation for 15s, 61℃ annealing / extending for 60s, 10 cycles (annealing temperature decreases by 0.6℃ per cycle);

[0111] 95℃ denaturation for 15s, 55℃ annealing / extending for 60s, 30 cycles;

[0112] Incubate at 37℃ for 30s, and collect FAM and HEX dual-channel fluorescence signals (QuantStudio™ Design & Analysis Software v1.5.2).

[0113] Interpretation of classification results:

[0114] Blue clusters (strong FAM signal): genotype CC, corresponding to thinner stems;

[0115] Red clusters (strong HEX signal): genotype GG, corresponding to thicker stems;

[0116] Black dots: Negative control (NTC), no amplification.

[0117] Compared with whole-genome resequencing results, KASP genotyping accuracy reached 100%. Figure 7 This confirms that the tag was successfully developed.

[0118] Therefore, the KASP molecular marker of the present invention can be used efficiently and accurately for seedling prediction and screening of maize plants with thicker coarser growth and stronger lodging resistance, significantly improving the efficiency of molecular-assisted breeding.

[0119] 2.5 Application Value

[0120] The KASP tag has the following advantages:

[0121] (1) High accuracy: 100% interpretation accuracy was achieved in 80 extreme phenotypic materials;

[0122] (2) Wide adaptability: It exhibits stability in multiple ecological zones spanning Northeast, North, and Southwest China;

[0123] (3) Breeding practicality: Selection can be completed during the seedling stage, avoiding large-scale phenotypic identification in the field, and significantly reducing labor and land costs.

[0124] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.

[0125] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A SNP molecular marker closely linked to the thickness of maize stalks, characterized in that, The molecular marker was a single SNP locus, SNP_Chr7_139007656. Based on the maize B73 reference genome RefGen_v5, this locus is located at 139,007,656 bp on maize chromosome 7, with a nucleotide polymorphism of C / G. Based on multi-year, multi-location phenotypic genotype analysis of the short axis D1 and long axis D2 of the elliptical cross-section of the stem, this locus was significantly associated with stem thickness under all experimental conditions. When the genotype was CC, both the long and short axes of the maize stem were smaller, resulting in a slender stem. When the genotype was GG, both the long and short axes of the maize stem were larger, resulting in a robust stem.

2. A primer pair combination, characterized in that, The primer pair combinations include: SNP_Chr7_139007656_F1, nucleotide sequence as shown in SEQ ID NO:1; SNP_Chr7_139007656_F2, nucleotide sequence as shown in SEQ ID NO:2; SNP_Chr7_139007656_R, nucleotide sequence as shown in SEQ ID NO:

3.

3. The primer pair combination according to claim 2, characterized in that, The nucleotide sequence of SNP_Chr7_139007656_F1 includes a universal tag for the FAM fluorescent channel, and the nucleotide sequence of SNP_Chr7_139007656_F2 includes a universal tag for the HEX fluorescent channel.

4. The application of the molecular marker according to claim 1 in detecting or predicting the phenotypic level of maize stalk thickness, characterized in that, When the genotype of the maize plant at the above loci is CC, it exhibits a thinner stem; when the genotype is GG, it exhibits a thicker stem.

5. The application of the molecular markers according to claim 1 in marker-assisted selection breeding of maize.

6. The application of the molecular markers according to claim 1 in the genetic improvement of maize germplasm resources.

7. A method for detecting the thickness of corn stalks at maturity, characterized in that, Includes the following steps: S1. Extract genomic DNA from the maize sample to be tested; S2. Using the DNA as a template, and employing the primer pair combination described in claim 2 or 3, add KASP genotyping premix to prepare the KASP reaction system. S3. Perform PCR amplification and genotyping the amplification products by fluorescence signal detection; S4. Determine the phenotypic tendency of corn stalk thickness based on genotyping results: If the genotypes of the SNP loci are CC, the plant is determined to have a thinner stalk; if the genotypes are GG, the plant is determined to have a thicker stalk.

8. The detection method according to claim 7, characterized in that, In step S2, the KASP reaction system comprises: 2.5 μL of KASP 2×PCR Mix; 0.6 μL of primer premix; and 1.5 μL of template DNA (DNA concentration 15-30 ng / μL).

9. The detection method according to claim 7, characterized in that, In step S3, the PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 61℃ annealing / extension for 60 s, for a total of 10 cycles, with the annealing temperature decreasing by 0.6℃ in each cycle; followed by 30 cycles: 95℃ denaturation for 15 s, 55℃ annealing / extension for 60 s; and finally incubation at 37℃ for 30 s.

Images