An Indel marker tightly linked to the all-female gene CmoQC in Cucurbita moschata, along with its primers, kits, and applications.

Abstract

The application discloses a kind of and Chinese pumpkin (Cucurbita moschata) Cucurbita moschata Gynoecy gene CmoQC Indel marker, primer, kit and application thereof are closely linked to the field of biotechnology assisted breeding.The application discloses a kind of and Chinese pumpkin (Cucurbita moschata) Cucurbita moschata Gynoecy gene CmoQC Indel marker is closely linked to Chinese pumpkin (Cucurbita moschata) Cucurbita moschata Gynoecy gene CmoQC Compared with the 37-97 site of the fragment closely linked to Chinese pumpkin (Cucurbita moschata) Cucurbita moschata Non-gynoecy gene exists base deletion mutation;The base of the deletion mutation is AAAATTATCATTAACTTACATTTGTTTTTTTTTTTATATTAAATTTTATAACGGGTTTAAT.Using the Indel marker, 89 Chinese pumpkin varieties are verified, and the result shows that the accuracy of CmoQC-INDEL marker used for molecular marker assisted selection is 100%.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology-assisted breeding, and specifically relates to a method for breeding Chinese pumpkin (…). Pumpkin muskrat All-female gene CmoQC Tightly linked Indel markers, their primers, kits, and applications. Background Technology

[0002] Chinese pumpkin ( Musk gourd Cucurbita moschata (Chinese squash) is an annual vine-like herbaceous plant belonging to the Cucurbitaceae family and the Cucurbita genus. Native to the Americas, it is an important dual-purpose vegetable crop in my country, with a long history of cultivation and wide distribution. Chinese squash is not only rich in carbohydrates, vitamins, carotenoids, minerals, and dietary fiber, but also possesses strong adaptability, good storage and transportation properties, and suitability for processing. It plays a vital role in ensuring vegetable supply, promoting agricultural efficiency, and increasing farmers' income. Furthermore, it shows broad application prospects in functional food development and feed processing.

[0003] In the field of pumpkin variety breeding and promotion in my country, hybrid varieties, with their significant heterosis, such as strong resistance, high yield, and stable quality, have become the main form of promotion for improved pumpkin varieties in China, playing a core supporting role in promoting the standardization and high-efficiency development of the pumpkin industry. The superior characteristics of hybrid varieties directly determine the economic benefits of pumpkin cultivation; therefore, optimizing hybrid seed production technology, reducing seed production costs, and improving hybrid purity are among the core research directions in the current field of pumpkin breeding.

[0004] In the practice of hybrid seed production of cucurbitaceous crops, the application of female lines has proven to be a crucial technical means to overcome traditional seed production bottlenecks. Using female lines to produce F1 hybrids offers numerous advantages: First, the female flowers are densely distributed and have a high fruit set rate, significantly increasing the yield per plant and directly improving economic benefits; second, the flowering time of female lines is concentrated, and the number of female flowers is stable, shortening the pollination window and improving the efficiency of artificial pollination; third, female line plants differentiate only female flowers and have no male flowers, significantly simplifying pollination operations and improving seed production efficiency. Therefore, female lines have high application value and promising prospects in the hybrid seed production industry of cucurbitaceous crops.

[0005] The gynoecious trait, as a core genetic basis for breeding female lines, has been the subject of research on its regulatory mechanisms and applications in several Cucurbitaceae crops. In cucumber (… Cucumber The inheritance pattern of the femaleness gene in watermelon has been well understood, and related molecular markers have been successfully applied to female-assisted breeding, achieving efficient selection of the female trait; Citrullus woolly ),melon( Cucumber melonIn other crops such as watermelon and melon, a series of key genes regulating the all-female trait have been cloned, and corresponding molecular markers have been developed, providing technical support for the rapid breeding of female lines. However, compared with the above-mentioned crops, research on the all-female trait in Chinese pumpkin is still lagging behind, and there are significant gaps in related basic research and applied technologies.

[0006] Currently, obtaining the all-female trait in Chinese pumpkins mainly relies on the application of chemical agents such as plant growth regulators, including gibberellins, CPPU, and fruit-setting agents, to induce female flower differentiation. However, this method has several insurmountable drawbacks: First, the effectiveness of these agents is greatly affected by environmental factors (temperature, light, and humidity), with significant differences in spraying effects across different cultivation regions and growth stages, resulting in extremely poor stability. Second, controlling the concentration of these agents is difficult; too low a concentration leads to insufficient female flower induction, while too high a concentration can cause plant malformation, abnormal female flower development, and even fruit deformities and reduced quality. Third, these chemical agents tend to remain in the plant, potentially harming human health through the food chain and causing potential pollution to the soil and the ecological environment. Therefore, analyzing the regulatory mechanisms of the all-female trait at the genetic level, identifying key genes regulating this trait, and developing molecular markers have become urgent needs for the breeding of female pumpkin lines in China.

[0007] In recent years, with the development of molecular biology techniques, gene cloning and molecular marker technology have become core tools for crop trait improvement. By locating key genes that regulate target traits and developing tightly linked molecular markers, early screening and precise breeding of target traits can be achieved, significantly shortening the breeding cycle. However, research on the all-female gene in Chinese pumpkin is extremely scarce, the genetic regulation mechanism is still unclear, gene localization, cloning, and functional verification have not yet been carried out, and the development of related molecular markers is completely lacking.

[0008] The aforementioned research gaps mean that the breeding of all-female lines of Chinese pumpkin still relies on traditional phenotypic screening, which suffers from problems such as long breeding cycles, low efficiency, and poor accuracy, thus hindering the breeding and high-efficiency production of Chinese pumpkin varieties. Therefore, conducting research on the localization, cloning, and molecular marker development of all-female genes in Chinese pumpkin, and establishing a molecular-assisted breeding technology system for all-female traits, has significant theoretical and practical value for promoting the innovation of superior varieties of Chinese pumpkin and enhancing the competitiveness of the industry. Summary of the Invention

[0009] Based on the aforementioned gaps in the field, this invention provides a method for processing Chinese pumpkins. Musk gourd All-female genes CmoQC The tightly linked Indel markers were identified, and their application in selecting Chinese pumpkin germplasm resources was provided.

[0010] The technical solution of the invention is as follows: A type of pumpkin similar to Chinese pumpkin ( Musk gourdAll-female gene CmoQC Closely linked Indel markings, with Chinese pumpkin ( Musk gourd All-female gene CmoQC Closely linked segments compared to Chinese pumpkin ( Pumpkin muskrat A base deletion mutation exists at positions 37-97 of the tightly linked segment of the non-all-female gene; the base of the deletion mutation is AAAATTATCATTAACTTACATTTGTTTTTTTTTTTTTATATTAAATTTTATAACGGGTTTAAT.

[0011] With Chinese pumpkin ( Musk gourd All-female gene CmoQC The nucleotide sequence of the tightly linked fragment is shown in Seq ID No. 2; Preferably, with Chinese pumpkin ( Musk gourd The nucleotide sequence of the tightly linked fragment of the non-all-female gene is shown in Seq ID No.1.

[0012] Used for screening for all-female genes in Chinese pumpkins CmoQC The primers are characterized in that they can amplify the Indel marker.

[0013] The gene for screening all-female Chinese pumpkins is described. CmoQC The primers contain the following upstream and downstream primers: CmoQC-INDEL-F: GTCCTTGTGGTTAAAATGAGAATTAATTT CmoQC-INDEL-R:CACGTCTTTTCTATCGGGAGACTTT.

[0014] Used to identify those carrying the all-female gene. CmoQC A kit for Chinese pumpkin germplasm resources, characterized in that it includes primers for amplifying the Indel marker, and / or the gene for screening all-female Chinese pumpkins. CmoQC Primers.

[0015] The aforementioned method for identifying those carrying the all-female gene CmoQC The kit for Chinese pumpkin germplasm resources also includes: PCR reagents, and / or, electrophoresis reagents.

[0016] The PCR reagents include: dNTPs, Taq enzyme, buffer, and double-distilled water; Preferably, the electrophoresis reagents include: electrophoresis buffer, Tris-HCl, SDS, acrylamide, ammonium persulfate, TEMED, double-distilled water, and silver staining reagent.

[0017] A method for identifying individuals carrying the all-female gene CmoQC A method for obtaining germplasm resources of Chinese pumpkin, which uses primers capable of amplifying the Indel marker, and / or the method for screening for all-female genes in Chinese pumpkin. CmoQC Primers, and / or the primers used to identify those carrying the all-female gene. CmoQC A kit for Chinese pumpkin germplasm resources was developed to test the Chinese pumpkin materials to be tested.

[0018] The detection includes PCR; The PCR system includes: 0.75 ng / μl DNA template, 5 ng / μl each of forward and reverse primers, and 0.5 μL / μl 2×3G Taq Master Mix for PAGE (Red Dye); Preferably, the PCR system is as follows: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double-distilled water to 10 μL; The DNA template is the DNA of the Chinese pumpkin material to be tested; Preferably, the PCR program is as follows: pre-denaturation at 95°C for 3 minutes; one cycle consists of denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, and extension at 72°C for 30 seconds, for a total of 35 cycles; and incubation at 72°C for 5 minutes.

[0019] The detection also includes: electrophoresis and / or sequencing of the PCR products; The electrophoresis refers to the separation of PCR products using a 6% non-denaturing polyacrylamide gel. Preferably, the electrophoresis conditions are: constant power electrophoresis at 150V for 1 hour and 10 minutes, followed by silver staining for color development. Preferably, when the electrophoresis result is 214bp and / or the sequencing result is as shown in Seq ID No.1, the genotype of the Chinese pumpkin material to be tested is non-all-female, and the phenotype is non-all-female. When the electrophoresis result is 154bp and / or the sequencing result is as shown in Seq ID No.2, the genotype of the Chinese pumpkin to be tested is all-female, and the phenotype is all-female.

[0020] A type of Chinese pumpkin Musk gourd The method for efficiently formulating first-generation hybrids is characterized by employing the aforementioned method for screening Chinese pumpkins. Musk gourd Primers for the all-female gene, and / or the kit for identifying Chinese pumpkin germplasm resources carrying the all-female gene, and / or the method for identifying Chinese pumpkin germplasm resources carrying the all-female gene, which is used to identify and screen Chinese pumpkin germplasm resources carrying the all-female gene for self-pollination or hybridization, to obtain Chinese pumpkin varieties containing homozygous all-female genes and to produce first-generation hybrids.

[0021] Previous research in this invention revealed that obtaining the all-female trait in Chinese pumpkins currently relies primarily on the application of plant growth regulators. The effectiveness of these regulators is influenced by various environmental factors, including temperature, light, and humidity, as well as the plant's own developmental stage. This results in poor stability, difficulty in concentration control, potential teratogenicity, and the risk of pesticide residues harming human health and polluting the environment. Therefore, elucidating the regulatory mechanism of the all-female trait at the genetic level, identifying key genes, and developing molecular markers have become urgent needs for the breeding of female lines in Chinese pumpkins. Currently, research on the all-female gene in Chinese pumpkins is extremely scarce, the genetic regulatory patterns are unclear, gene mapping and cloning have not yet been carried out, and the development of related molecular markers is completely lacking. This leads to the breeding of all-female lines still relying on traditional phenotypic screening, which suffers from long cycles, low efficiency, and poor accuracy, severely hindering the industry's development.

[0022] To fill the aforementioned research gaps and meet the practical needs of the industry, researchers used the all-female Chinese pumpkin variety Defeng Nen 5 and the all-female variety Defeng Zaoxiu as parental materials, and constructed an F2 population for genetic analysis through hybridization. Genetic analysis revealed that the all-female trait in Chinese pumpkin is controlled by a single dominant gene, which was named... CmoQC This invention involves deep resequencing of two parental materials and the development of a series of InDel molecular markers for Chinese pumpkin based on the sequencing results. By screening these molecular markers for polymorphisms, combined with phenotypic identification and genetic linkage analysis of the F2 population, the key genes regulating the all-female trait were ultimately identified. CmoQC The gene was located within the 50 kb range. This mapping of the all-female gene and the development of related molecular markers not only fills a gap in molecular research on the all-female trait in Chinese pumpkins, but also lays a core foundation for marker-assisted selection of the all-female trait, providing key technical support for the efficient breeding and improved varieties of all-female lines.

[0023] The characteristic nucleotide sequence of the Indel marker amplified by the present invention, linked to the non-all-female gene of *Cucurbita chinensis*, is shown in Seq ID No. 1, with a sequence length of 214 bp. This fragment has an insertion of 60 bases at the 37th base, indicating a non-all-female gene. The characteristic nucleotide sequence of the Indel marker amplified, linked to the all-female gene of *Cucurbita chinensis*, is shown in Seq ID No. 2, with a sequence length of 154 bp. This fragment has a deletion of 60 bases at the 37th base, indicating an all-female gene.

[0024] In another aspect, this invention also provides the application of the Indel marker in screening Chinese pumpkin germplasm resources with all-female genes, the steps of which are as follows: (1) Extract genomic DNA from the pumpkin to be tested; (2) Using the genomic DNA of the sample to be tested as a template, perform PCR amplification using the primers described in claim 1; (3) Sequencing or polyacrylamide gel electrophoresis is performed on the PCR amplified fragments; If the sequencing results are as shown in Seq ID No.1, the Chinese pumpkin material is not entirely female; if the sequencing results are as shown in Seq ID No.2, the Chinese pumpkin material is entirely female. If the fragment after electrophoresis is 214bp, the Chinese pumpkin material is not entirely female; if the fragment after electrophoresis is 154bp, the Chinese pumpkin material is not entirely female.

[0025] (4) According to claim 2, the PCR reaction system is: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G Taq Master Mix for PAGE (Red Dye), and double-distilled water to 10 μL.

[0026] (5) The PCR amplification program is as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ incubation for 5 minutes, storage at 10℃.

[0027] The gel electrophoresis detection refers to the separation of the bands by electrophoresis at a constant power of 150 V for 1 hour and 10 minutes using a 6% non-denaturing polyacrylamide gel, followed by silver staining and band analysis.

[0028] (6) A method for screening for genes that are exclusively female CmoQC A kit for Chinese pumpkin germplasm resources, characterized by including primers in powder or solution form with the following nucleotide sequences: CmoQC-INDEL-F: GTCCTTGTGGTTAAAATGAGAATTAATTT CmoQC-INDEL-R:CACGTCTTTTCTATCGGGAGACTTT.

[0029] With the all-female gene of Chinese pumpkin CmoQC Closely linked indel markers are characterized by: Its nucleotide sequence is as follows: CmoQC-INDEL-F: GTCCTTGTGGTTAAAATGAGAATTAATTT CmoQC-INDEL-R:CACGTCTTTTCTATCGGGAGACTTT.

[0030] The Indel marker amplification is related to the all-female gene of Chinese pumpkin. CmoQC The characteristic nucleotide sequence of the linkage band is shown in Seq ID No. 1, with a sequence length of 214 bp. This fragment has a 60-base insertion at the 37th base, indicating a non-all-female gene. The Indel marker amplification is related to the all-female gene of *Cucurbita indica*. CmoQC The characteristic nucleotide sequence of the linkage band is shown in SeqID No.2, with a sequence length of 154 bp. This fragment has a 60-base deletion at the 37th base, which indicates that it is entirely female.

[0031] The application of the above-mentioned Indel marker in screening pumpkin germplasm resources follows these steps: (1) Extract genomic DNA from the sample to be tested; (2) Using the genomic DNA of the sample to be tested as a template, perform PCR amplification using the primers described in claim 1; (3) Sequencing of the PCR amplified fragments; If the sequencing results are as shown in Seq ID No.1, the Chinese pumpkin is not entirely female; if the sequencing results are as shown in Seq ID No.2, the Chinese pumpkin is entirely female. The PCR reaction system consisted of: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double-distilled water to a final volume of 10 μL.

[0032] The PCR amplification program is as follows: pre-denaturation at 95℃ for 3 minutes; denaturation at 95℃ for 15 seconds, annealing at 58℃ for 15 seconds, extension at 72℃ for 30 seconds, 35 cycles; incubation at 72℃ for 5 minutes, storage at 10℃.

[0033] The gel electrophoresis detection refers to the separation of the bands by electrophoresis at a constant power of 150V for 1 hour and 10 minutes using a 6% non-denaturing polyacrylamide gel, followed by silver staining and band analysis.

[0034] The beneficial effects of this invention are as follows: The Indel marker developed in this invention was developed using resequencing data from the all-female parent Defeng Nen 5 and the all-female material Defeng Zaoxiu. Validation was performed using 89 Chinese pumpkin varieties, and the results showed that the CmoQC-INDEL marker had a 100% accuracy rate in marker-assisted selection.

[0035] This invention not only provides a gene for all-female Chinese pumpkins CmoQC This invention lays the foundation for precise localization and molecular cloning, and also provides an efficient approach for using molecular markers to assist in the breeding of all-female varieties of Chinese pumpkin. Based on the developed Indel marker, this invention provides a method for assisting in the screening of varieties with all-female genes. CmoQCA method for developing new varieties of Chinese pumpkin. In this method, the DNA of the test material is amplified using the CmoQC-INDEL specific primers, followed by sequencing and electrophoresis of the amplified products. The method provided by this invention allows for the screening of all-female traits in candidate Chinese pumpkin materials at any stage. Compared to traditional field phenotypic observation and identification methods, this method can be used for identification during the seedling stage and indoors, and is faster and more efficient than field phenotypic observation during flowering. It is suitable for large-scale screening of breeding materials, saves land and labor costs, and has advantages such as high efficiency, fewer restrictions, and accuracy. Attached Figure Description

[0036] Figure 1 These are photographs of the all-female and all-female phenotypes of the Chinese pumpkin materials Defeng Nen 5 and Defeng Zaoxiu used in the experimental examples of this invention.

[0037] Figure 2 This is an embodiment of the invention that provides a gene for the all-female Chinese pumpkin. CmoQC The linked Indel marker CmoQC-INDEL was used to detect amplified bands of Chinese pumpkin varieties Defeng Nen 5 (a band), Defeng Zaoxiu (b band), and 89 other different types of Chinese pumpkin cultivars. Detailed Implementation

[0038] The present invention will be further described in detail below with reference to specific embodiments, but this does not limit the scope of the invention. Unless otherwise specified, the operations used in the following embodiments are conventional methods, and the reagents used are commercially available.

[0039] I. Sources of biological materials (I) The Chinese pumpkin materials used in Experimental Example 1 of this invention: the all-female Chinese pumpkin material Defeng Nen 5 and the non-all-female material Defeng Zaoxiu are both well-known and publicly available Chinese pumpkin materials, and their purchase channels are as follows: Purchase link for Defeng Nen No. 5: http: / / www.defengseed.com / h-pd-153.html?fromColId=0#pfc=%7B%7D&_pp=0_694_7 Defeng Early Show Purchase Link: http: / / www.defengseed.com / h-pd-119.html?fromColId=0#pfc=%7B%7D&_pp=0_694_7; (II) The experimental materials used in Experimental Example 2 of this invention were Defeng Nen 5 (a-type), Defeng Zaoxiu (b-type), and 89 Chinese pumpkin varieties. The applicant declares that verification materials for the technical effects of this invention may be released to the public within 20 years from the date of application of this invention.

[0040] All 89 Chinese pumpkin varieties are publicly known and commercially available varieties. Their purchase sources are shown in Table 1 below: Table 1

[0041] II. Main Reagents PCR experiments were performed using 2×3G Taq Master Mix for PAGE (Red Dye) from Vazyme; gel electrophoresis was performed using 40% non-denaturing polyacrylamide from Beijing Coolplay Technology Co., Ltd., diluted to 6%. Sequencing was performed at Sangon Biotech (Shanghai) Co., Ltd.

[0042] Group 1 Embodiments, Indel Markers of the Present Invention This set of embodiments provides a method related to Chinese pumpkin ( Musk gourd All-female gene CmoQC Closely linked Indel markers. All embodiments in this group share the following common feature: (related to Chinese pumpkin) Musk gourd All-female gene CmoQC Closely linked segments compared to Chinese pumpkin ( Musk gourd A base deletion mutation exists at positions 37-97 of the tightly linked segment of the non-all-female gene; the base of the deletion mutation is AAAATTATCATTAACTTACATTTGTTTTTTTTTTTTTATATTAAATTTTATAACGGGTTTAAT.

[0043] In some embodiments, the term "all-female gene" has the conventional technical meaning known to those skilled in the art of molecular biology and is a common term in the biological field. For example, it may mean the term "all-female gene" as described in the article "Development and localization analysis of AFLP linkage markers for all-female genes in South China cucumber".

[0044] In a specific embodiment, it is related to Chinese pumpkin ( Musk gourd All-female gene CmoQC The nucleotide sequence of the tightly linked fragment is shown in Seq ID No. 2; Preferably, with Chinese pumpkin ( Musk gourd The nucleotide sequence of the tightly linked fragment of the non-all-female gene is shown in Seq ID No.1.

[0045] It should be noted that the Seq ID No.1 can be aligned on the Pumpkin Genome website (http: / / cucurbitgenomics.org / blast), but the Seq ID No.1 sequence of this invention was cloned and sequenced from the Defeng Nen 5 and Defeng Zaoxiu used in this invention. However, the reference genome on the aforementioned Pumpkin Genome website is not the two materials mentioned above, so it is difficult to guarantee that their sequences are exactly the same. It is normal for there to be some individual differences. Therefore, the alignment result shows a homology of 98.6%.

[0046] Those skilled in the art can use the above-described Indel markers to design primers and use the primers to screen germplasm resources containing the all-female gene of Chinese pumpkin according to the teachings of this invention. Any use of the above-described Indel markers to design primers and use the primers to screen germplasm resources containing the all-female gene of Chinese pumpkin, or direct use of the above-described Indel markers to screen germplasm resources containing the all-female gene of Chinese pumpkin, or use of the above-described Indel markers in screening germplasm resource products, production or services, or artificial synthesis, production, manufacturing, sale, offering for sale, or use of the above-described Indel markers, all fall within the protection scope of this invention.

[0047] Group 2 Examples, Primers of the Present Invention This set of examples provides a method for screening for all-female genes in Chinese pumpkin. CmoQC The primers. All embodiments in this group share the following common feature: the primers can amplify any of the Indel markers described in the embodiments of group 1.

[0048] In a specific embodiment, the gene for screening all-female Chinese pumpkin is described. CmoQC The primers include the following upstream and downstream primers: CmoQC-INDEL-F: GTCCTTTGTGGTTAAAATGAGAATTAATTT (SEQ ID NO.3); CmoQC-INDEL-R: CACGTCTTTTCTATCGGGAGACTTT (SEQ ID NO. 4).

[0049] Based on the Indel marker characteristic sequences described in this invention, feasible specific primers for experimental design can be routinely adjusted, selected, and designed by those skilled in the art using common primer design software with the aforementioned Indel marker sequences as templates, according to the specific needs of actual experimental operations. Theoretically, due to the varying primer lengths and loci, there are countless possibilities for primers. The aforementioned CmoQC-INDEL-F and CmoQC-INDEL-R are merely one pair of primers designed by this invention. Due to factors such as experimental cycle and length, this invention cannot exhaustively design or list all primers that can be used to screen for all-female genes in Chinese pumpkin. Therefore, primers used for screening for all-female genes in Chinese pumpkin are not limited to the aforementioned CmoQC-INDEL-F and CmoQC-INDEL-R. Any usable primers designed based on the Indel markers of this invention fall within the protection scope of this invention.

[0050] Any act of artificially synthesizing, producing, manufacturing, selling, using, or offering for sale primers for screening the all-female gene of Chinese pumpkin falls within the protection scope of this invention.

[0051] Group 3 Examples, the reagent kit of the present invention This set of examples provides methods for identifying individuals carrying all-female genes. CmoQC A kit for Chinese pumpkin germplasm resources. All examples in this group share the following common feature: the kit includes primers for amplifying the Indel marker described in any of the examples in Group 1, and / or, the primers for screening all-female genes in Chinese pumpkin described in any of the examples in Group 2. CmoQC Primers.

[0052] In a further embodiment, the method for identifying those carrying the all-female gene... CmoQC The kit for Chinese pumpkin germplasm resources also includes: PCR reagents, and / or, electrophoresis reagents.

[0053] In a specific embodiment, the PCR reagent includes: dNTPs, Taq enzyme, buffer solution, and double-distilled water; Preferably, the electrophoresis reagents include: electrophoresis buffer, Tris-HCl, SDS, acrylamide, ammonium persulfate, TEMED, double-distilled water, and silver staining reagent.

[0054] Group 4 Examples, Identification Method of the Present Invention This set of examples provides a method for identifying individuals carrying all-female genes. CmoQC Methods for obtaining germplasm resources of Chinese pumpkin. All embodiments in this group share the following common features: the use of primers capable of amplifying the Indel marker described in any of the embodiments in Group 1, and / or, the method for screening all-female genes in Chinese pumpkin described in any of the embodiments in Group 2. CmoQCPrimers, and / or, as described in any of the examples in Group 3, for identifying those carrying the all-female gene. CmoQC A kit for Chinese pumpkin germplasm resources was developed to test the Chinese pumpkin materials to be tested.

[0055] In a specific embodiment, the detection includes PCR; The PCR system includes: 0.75 ng / μl DNA template, 5 ng / μl each of forward and reverse primers, and 0.5 μL / μl 2×3G Taq Master Mix for PAGE (Red Dye); Preferably, the PCR system is as follows: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double-distilled water to 10 μL; The DNA template is the DNA of the Chinese pumpkin material to be tested; Preferably, the PCR program is as follows: pre-denaturation at 95°C for 3 minutes; one cycle consists of denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, and extension at 72°C for 30 seconds, for a total of 35 cycles; and incubation at 72°C for 5 minutes.

[0056] In a further embodiment, the detection further includes: electrophoresis and / or sequencing of the PCR products; The electrophoresis refers to the separation of PCR products using a 6% non-denaturing polyacrylamide gel. Preferably, the electrophoresis conditions are: constant power electrophoresis at 150V for 1 hour and 10 minutes, followed by silver staining for color development. Preferably, when the electrophoresis result is 214bp and / or the sequencing result is as shown in Seq ID No.1, the genotype of the Chinese pumpkin material to be tested is non-all-female, and the phenotype is non-all-female. When the electrophoresis result is 154bp and / or the sequencing result is as shown in Seq ID No.2, the genotype of the Chinese pumpkin to be tested is all-female, and the phenotype is all-female.

[0057] Group 5 Examples, Chinese Pumpkin of the Present Invention Musk gourd Efficient method for producing first-generation hybrids This set of embodiments provides a Chinese pumpkin. Musk gourd A highly efficient method for breeding first-generation hybrids. All examples in this group share the following common feature: they employ one of the methods described in any of the examples in Group 1, combined with *Cucurbita chinensis* (Chinese pumpkin). Musk gourd All-female gene CmoQC Closely linked Indel markers, and / or, any of the examples in Group 2, for screening all-female genes in Chinese pumpkin. CmoQCPrimers, and / or, as described in any of the examples in Group 3, for identifying those carrying the all-female gene. CmoQC A kit for identifying pumpkin germplasm resources from China, provided in any of the examples in Group 4, is used to identify those carrying the all-female gene. CmoQC Methods for identifying and screening Chinese pumpkin germplasm resources carrying all-female genes were used to conduct self-pollination or hybridization to obtain Chinese pumpkin varieties containing homozygous all-female genes for efficient breeding.

[0058] In a specific embodiment, the efficient mating refers to the self-pollination or hybridization of Chinese pumpkin germplasm resources containing homozygous all-female Chinese pumpkins to obtain lines carrying all-female genes, with a new combination having an all-female phenotype.

[0059] The planting method also includes Chinese pumpkin. Musk gourd The conventional planting and cultivation steps, such as land preparation and fertilization, ditching and ridge preparation, transplanting, temperature control, fruit preservation treatment, fertilizer and water control, pest and disease control, and harvesting, can be referred to in the book "Technical Regulations for Pumpkin Cultivation in China", which is a well-known technology in the field of pumpkin cultivation in China.

[0060] Experimental Example 1. The all-female gene in Chinese pumpkin. CmoQC Acquisition of tightly linked Indel tags By combining Chinese genome sequence data with resequencing data of Defeng Nen 5 and Defeng Zaoxiu, and using bioinformatics combined with phenotypic identification of genetic populations, we analyzed and located fragment differences in this region. In Defeng Nen 5, a Chinese pumpkin material that expresses all-female genes, a deletion of 60 base pairs was found.

[0061] Based on the obtained Indel marker closely linked to the all-female gene of *Cucurbita chinensis*, an Indel marker closely linked to the all-female gene of *Cucurbita chinensis* was developed (named CmoQC-INDEL). The forward and reverse primers are as follows: CmoQC-INDEL-F: GTCCTTGTGGTTAAAATGAGAATTAATTT CmoQC-INDEL-R:CACGTCTTTTCTATCGGGAGACTTT.

[0062] Due to the indel insertion, PCR amplification was performed on Defeng Nen 5, Defeng Zaoxiu, and 89 other Chinese pumpkin varieties using the aforementioned primers (CmoQC-INDEL-F / CmoQC-INDEL-R). Specific bands were obtained. Specifically, a 154 bp band was obtained in Defeng Nen 5 (which expresses a fully female gene), and a 214 bp band was obtained in Defeng Zaoxiu (which does not express a fully female gene). A 214 bp band was also obtained from the 89 Chinese pumpkin varieties.

[0063] Specific operation method: Step 1. DNA extraction and PCR amplification Genomic DNA was extracted from tender leaves of Chinese pumpkin plants using a modified CTAB (hexadecyltrimethylammonium bromide) method.

[0064] The Indel-labeled PCR reaction system is as follows: 10 μL reaction volume, 3 μL DNA (5.0 ng / μL) -1 ), forward and reverse primers (50 ng·μL) -1 1 μL each, 5 μL of 2×3G Taq Master Mix for PAGE (Red Dye) (Vazyme product).

[0065] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ incubation for 5 minutes, storage at 10℃.

[0066] Step 2. Result Determination PCR products were separated using a 6% non-denaturing polyacrylamide gel electrophoresis with 0.5×TBE as the electrophoresis buffer. The electrophoresis was performed at a constant power of 150 V for 1 h 10 min. After electrophoresis, silver staining was performed, and the band patterns were statistically analyzed.

[0067] In material Defeng Nen 5 (which expresses a fully female gene), a 154bp band was obtained, and the band pattern is denoted as 'a'; in material Defeng Zaoxiu (which does not express a fully female gene)... CmoQc In the process, a 214bp strip is obtained, and the stripe type is denoted as b.

[0068] Experimental Example 2. Validation of the all-female gene marker in Chinese pumpkin Using 89 Chinese pumpkin varieties preserved in this study, the Indel marker, which is associated with all-female Chinese pumpkin, obtained in Experiment 1 was validated to determine the accuracy of this marker for marker-assisted selection: compared with the sex phenotype of the selected materials ( Figure 1 The study found that the genotypic data of this marker in 89 Chinese pumpkin varieties were consistent with the phenotypic results of the sex type survey. Figure 2 The calculated accuracy rate is 100%.

[0069] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent variations made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and variations made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A type of pumpkin similar to Chinese pumpkin ( Cucurbita moschata All-female gene CmoQC Closely linked indel markers are characterized by, With Chinese pumpkin ( Cucurbita moschata All-female gene CmoQC Closely linked segments compared to Chinese pumpkin ( Cucurbita moschata A base deletion mutation exists at positions 37-97 of the tightly linked segment of the non-all-female gene; the base of the deletion mutation is AAAATTATCATTAACTTACATTTGTTTTTTTTTTTTTATATTAAATTTTATAACGGGTTTAAT.

2. The method according to claim 1, which is similar to Chinese pumpkin ( Cucurbita moschata All-female gene CmoQC Closely linked indel markers are characterized by, With Chinese pumpkin ( Cucurbita moschata All-female gene CmoQC The nucleotide sequence of the tightly linked fragment is shown in Seq ID No. 2; And / or, with Chinese pumpkin ( Cucurbita moschata The nucleotide sequence of the tightly linked fragment of the non-all-female gene is shown in Seq ID No.

1.

3. Used for screening for all-female genes in Chinese pumpkins. CmoQC The primers are characterized by, The Indel marker described in claim 1 or 2 can be amplified.

4. The gene for screening all-female Chinese pumpkin as described in claim 3 CmoQC The primers are characterized by, Includes the following upstream and downstream primers: CmoQC-INDEL-F: GTCCTTGTGGTTAAAATGAGAATTAATTT CmoQC-INDEL-R:CACGTCTTTTCTATCGGGAGACTTT.

5. Used to identify those carrying the all-female gene. CmoQC A reagent kit for Chinese pumpkin germplasm resources, characterized in that, Includes primers capable of amplifying the Indel marker as described in claim 1 or 2, and / or, as described in claim 3 or 4, for screening for all-female genes in Chinese pumpkin. CmoQC Primers.

6. The method for identifying individuals carrying the all-female gene as described in claim 5. CmoQC A reagent kit for Chinese pumpkin germplasm resources, characterized in that, Also includes: PCR reagents, and / or electrophoresis reagents.

7. The method for identifying carriers of the all-female gene as described in claim 6 CmoQC A reagent kit for Chinese pumpkin germplasm resources, characterized in that, The PCR reagents include: dNTPs, Taq enzyme, buffer, and double-distilled water; And / or, the electrophoresis reagents include: electrophoresis buffer, Tris-HCl, SDS, acrylamide, ammonium persulfate, TEMED, double-distilled water, and silver staining reagent.

8. A method for identifying individuals carrying all-female genes. CmoQC The method for obtaining Chinese pumpkin germplasm resources is characterized by, Primers capable of amplifying the Indel markers described in claim 1 or 2, and / or, the primers described in claim 3 or 4 for screening all-female genes in Chinese pumpkin. CmoQC Primers, and / or, as described in any of claims 5-7, for identifying individuals carrying the all-female gene. CmoQC A kit for Chinese pumpkin germplasm resources was developed to test the Chinese pumpkin materials to be tested.

9. A method for identifying individuals carrying the all-female gene as described in claim 8. CmoQC The method for obtaining Chinese pumpkin germplasm resources is characterized by, The detection includes PCR; The PCR system includes: 0.75 ng / μl DNA template, 5 ng / μl each of forward and reverse primers, and 0.5 μL / μl 2×3 GTaq Master Mix for PAGE (Red Dye); And / or, the PCR system is: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double-distilled water to 10 μl; The DNA template is the DNA of the Chinese pumpkin material to be tested; And / or, the PCR program is as follows: pre-denaturation at 95°C for 3 minutes; 35 cycles consisting of denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, and extension at 72°C for 30 seconds; and incubation at 72°C for 5 minutes.

10. A method for identifying individuals carrying the all-female gene as described in claim 8 or 9. CmoQC The method for obtaining Chinese pumpkin germplasm resources is characterized by, The detection also includes: electrophoresis and / or sequencing of the PCR products; The electrophoresis refers to the separation of PCR products using a 6% non-denaturing polyacrylamide gel. And / or, the electrophoresis conditions are 150V constant power electrophoresis separation for 1 hour and 10 minutes, followed by silver staining for color development; And / or, when the electrophoresis result is 214bp and / or the sequencing result is as shown in Seq ID No.1, the genotype of the Chinese pumpkin material to be tested is non-all-female, and the phenotype is non-all-female; When the electrophoresis result is 154bp and / or the sequencing result is as shown in Seq ID No.2, the genotype of the Chinese pumpkin to be tested is all-female, and the phenotype is all-female.

Images