SNP molecular markers associated with pvv virus resistance genes and uses thereof

Abstract

This invention belongs to the field of marker-assisted breeding technology, and particularly relates to SNP molecular markers associated with PVY virus resistance genes and their applications. The SNP molecular markers are selected from at least one of SNP1 and SNP2 molecular markers, with SNP1 located in Ry sto At the 5411bp base position of the gene, a G / T polymorphism is observed, with SNP2 located in Ry chc At the 1557 bp position of the gene, a C / T polymorphism is observed. The SNP molecular marker provided by this invention is derived from Ry sto Genes and Ry chc Internal sequence variations in genes are closely related to their genotype and disease resistance / susceptibility, and are highly correlated with phenotypic resistance. This can accurately determine whether potatoes carry Ry. sto Genes and Ry chc The resistance genotype of the gene has higher accuracy in predicting resistance genes and more stable selection performance, and has important economic value in the field of PVY resistance identification and breeding.

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to SNP molecular markers associated with PVY virus resistance genes and their applications. Background Technology

[0002] Potato (Solanum tuberosum L.) is an asexually reproduced crop, susceptible to viral infection during its growth, which accumulates and leads to seed tuber degeneration and yield reduction. Potato virus Y (PVY) is one of the most destructive viral pathogens, posing a serious threat to many important economic crops. PVY belongs to the genus Pottyvirus in the family Pottyviridae, and its genome consists of single-stranded positive-sense RNA. This virus has a wide host range, infecting plants from various families including Solanaceae, Chenopodiaceae, and Fabaceae, causing symptoms such as mosaic, wrinkling, and necrosis. It is particularly damaging to Solanaceae crops such as potatoes, tobacco, peppers, and tomatoes. Among various measures to reduce the impact of PVY, breeding resistant potato varieties remains the most sustainable and effective method. Understanding the molecular mechanisms of PVY resistance, developing specific molecular markers for assisted selection, effectively identifying, tracking, and utilizing resistance genes, and screening resistant varieties are crucial.

[0003] To date, three major Ry genes conferring extreme resistance (ER) to potato PVY virus have been identified. Two of these have been successfully cloned: one is the Ry gene derived from S. stoloniferum. sto And Rychc, derived from S. chacoense. Ry sto The first cloned Ry gene, located on chromosome 12, encodes a nucleotide-binding leucine-rich repeat (NB-LRR) protein with an N-terminal Toll / interleukin-1 receptor (TIR)-like domain, characteristic of the TIR-NLR immune receptor. Similarly, Ry... chc Located on chromosome 9, it also encodes a TIR-NLR protein and has undergone a type I evolutionary pattern, indicating dynamic structural diversification in response to pathogen stress. Multiple studies have demonstrated that the PVY virus ER gene Ry... sto and Ry chc It has good application prospects in commercial potato cultivars and breeding populations.

[0004] Conventional disease resistance breeding selection is time-consuming and inefficient, requiring significant time, financial, and material resources. However, marker-assisted breeding (MAS) allows for rapid detection in the early stages of breeding, is not limited by environmental conditions, and can accelerate the breeding process, improving selection efficiency. Currently, with Ry sto and Ry chc Several tightly linked molecular markers have been developed and widely used. For Ry sto Genes, including GP122 (Valkonen et al., 2008; Lopez-Pardo et al., 2013), STO4 (Cernák et al., 2008), Yes3-3A and Yes3-3B (Song and Schwarzfischer, 2008; Bhardwaj et al., 2019), target Ry chc These molecular markers include RY186 (Kneib et al., 2017; Rogozina et al., 2019; Biryukova et al., 2020), CT220 (Rouppe van der Voort et al., 2000), and TG506 (Park et al., 2005). Because these molecular markers are closely linked to their corresponding resistance genes, they can serve as reliable tools for predicting resistance genotypes in potato plants.

[0005] While some progress has been made, these commonly used genetically linked molecular markers have limitations in practical breeding applications. Some markers are located outside the resistance gene, at a significant genetic distance from the target resistance gene, making them susceptible to recombination events during meiosis, leading to discrepancies between the marker genotype and the actual resistance phenotype. Furthermore, the complex genetic background of tetraploid potato varieties, coupled with widespread genetic variation in germplasm resources, further weakens the reliability of the markers. The high genetic variability of PVY virus exacerbates this problem—it reduces the polymorphic stability of some markers, leading to an increase in false positives or false negatives. These issues significantly hinder the integration of traditional genetically linked molecular markers into modern high-throughput breeding systems and restrict the selection and genetic improvement of PVY-resistant varieties. Therefore, developing high-throughput, gene-specific markers to overcome the limitations of traditional molecular markers has become a current research focus. Summary of the Invention

[0006] To address the problems existing in the prior art, this invention discovers a method for [the application of a technology] with two points located at Ry... sto Genes and Ry chc SNP variations within genes, these molecular markers can more accurately detect Ry in various potato genotypes and breeding populations. sto and Ry chcThe present invention provides detection primers or detection kits for detecting this SNP variant, and provides the application of the aforementioned SNP molecular markers, detection primers or detection kits in identifying potato PVY resistance genes and corresponding detection methods.

[0007] This invention is specifically achieved through the following technical solutions:

[0008] The first aspect of this invention provides an SNP molecular marker, its detection primers, or a detection kit for the identification of potato PVY resistance genes, wherein the SNP molecular marker is selected from at least one of SNP1 and SNP2 molecular markers, wherein:

[0009] The SNP1 molecular marker is located in Ry sto At the 5411 bp position of the gene, a G / T polymorphism is observed, which is described as Ry sto The nucleotide sequence of the gene is shown in SEQ ID NO.1; when the genotype of the SNP1 molecular marker carries the allele G, the Ry sto The gene is a resistance genotype. When the genotype of the SNP1 molecular marker only carries the allele T, the Ry sto The gene is a disease-susceptible genotype;

[0010] The SNP2 molecular marker is located in Ry chc At the 1557th bp position of the gene, a C / T polymorphism is observed, which is described as Ry chc The nucleotide sequence of the gene is shown in SEQ ID NO.2; when the genotype of the SNP2 molecular marker carries allele C, the Ry chc The gene is a resistance genotype. When the genotype of the SNP2 molecular marker only carries the allele T, the Ry chc The gene is a disease-susceptible genotype.

[0011] A second aspect of the present invention provides a detection primer for detecting the SNP molecular marker as described above, wherein:

[0012] The detection primers for the SNP1 molecular marker include forward primer SNP1-F1, forward primer SNP1-F2 and reverse primer SNP1-R, with nucleotide sequences shown in SEQ ID NO.3-5, respectively.

[0013] The detection primers for the SNP2 molecular marker include the forward primer SNP2-F, the reverse primer SNP2-R1, and the reverse primer SNP2-R2, with nucleotide sequences shown in SEQ ID NO.7-9, respectively.

[0014] A third aspect of the present invention provides a detection kit for detecting SNP molecular markers as described above, the detection kit comprising the detection primers as described above.

[0015] Furthermore, the molar ratio of forward primer SNP1-F1, forward primer SNP1-F2 and reverse primer SNP1-R is 2:2:5, and the molar ratio of forward primer SNP2-F, reverse primer SNP2-R1 and reverse primer SNP2-R2 is 5:2:2.

[0016] Furthermore, the detection kit also includes PCR amplification reagents, which include DNA polymerase, dNTPs, and buffer reagents.

[0017] A fourth aspect of this invention provides a method for identifying the PVY resistance gene in potatoes, comprising the following steps:

[0018] Using the genomic DNA of the potato to be tested as a template, SNP1 and SNP2 molecular markers were amplified separately by competitive allele-specific PCR. The fluorescence signal during amplification was detected, and the resistance type of the potato to be tested was determined based on the fluorescence signal; wherein:

[0019] The forward primer SNP1-F1 of the SNP1 molecular marker is connected to a first fluorescent group at one end, and the forward primer SNP1-F2 is connected to a second fluorescent group at one end; when only the first fluorescent group is detected or when both the first and second fluorescent groups are detected simultaneously, it is determined that the potato to be tested carries Ry. sto Resistance gene; conversely, if the tested potato does not contain the resistance gene, it is determined that the potato carries Ry. sto Disease-susceptibility genes;

[0020] The reverse primer SNP2-R1 of the SNP2 molecular marker is connected to a first fluorescent group at one end, and a second fluorescent group at one end of the reverse primer SNP2-R2. When only the first fluorescent group or the signals of both the first and second fluorescent groups are detected, it is determined that the potato to be tested carries Ry. chc Resistance gene; conversely, if the tested potato does not contain the resistance gene, it is determined that the potato carries Ry. chc Disease-causing genes.

[0021] Furthermore, the PCR amplification system, in 10 μL increments, contains: 2.5 μL of genomic DNA template, 0.15 μL of primer mixture, 5 μL of 2×KASP Master mix, and 2.35 μL of ddH2O.

[0022] Furthermore, the PCR reaction procedure includes a thermal cycling phase and a recovery phase. The thermal cycling phase includes: pre-denaturation at 94℃ for 15 min; using landing PCR, denaturation at 94℃ for 20 s, annealing and extension at 61-55℃ for 60 s, for 10 cycles, with a decrease of 0.6℃ per cycle; followed by denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, for 26 cycles; and a reading at 37℃ for 1 min. The recovery phase includes: denaturation at 94℃ for 20 s, extension at 57℃ for 60 s, and a reading at 37℃ for 1 min.

[0023] Furthermore, the first fluorescent group is FAM, and the second fluorescent group is HEX.

[0024] The fifth aspect of this invention provides an application of the method for identifying the potato PVY resistance gene as described above, wherein the application is selected from any of the following:

[0025] (a) Application in the identification of PVY resistance in potatoes;

[0026] (b) Application in potato PVY resistance breeding or assisted breeding.

[0027] The advantages and positive effects of this invention are as follows:

[0028] The SNP molecular markers provided by this invention are derived from Ry sto Genes and Ry chc Internal sequence variations in genes are closely related to their genotype and disease resistance / susceptibility, and are highly correlated with phenotypic resistance. This can accurately determine whether potatoes carry Ry. sto Genes and Ry chc The resistance genotype of the gene has higher accuracy in predicting resistance genes and more stable selection performance. Compared with existing linked molecular markers, the molecular markers within the gene of this invention greatly reduce the false positive and false negative rates, providing valuable resources for potato PVY virus resistance identification and breeding. It is beneficial to significantly improve the accuracy and efficiency of resistance gene typing, improve the accuracy of identifying PVY virus-resistant potato materials, and improve the efficiency of potato PVY resistance breeding. It has important economic value in the field of PVY resistance identification and breeding. Attached Figure Description

[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0030] Figure 1This diagram illustrates the distribution of SNP variant sites in the resistance gene according to an embodiment of the present invention. Figures A and B represent Ry... sto Genes and Ry chc Gene;

[0031] Figure 2 This is a schematic diagram illustrating the design principle of KASP primers for detecting SNP sites associated with resistance genes in an embodiment of the present invention.

[0032] Figure 3 The newly developed SNP1-2 molecular marker and the existing Ry in the embodiments of the present invention sto Ry chc Genotyping results of linkage molecular markers for 67 potato plants, where A and D represent SNP1, SNP2, and Ry, respectively. sto -KASP(old), Ry chc -KASP(old) molecular marker;

[0033] Figure 4 The newly developed SNP1-2 molecular marker and the existing Ry in the embodiments of the present invention sto Ry chc The graph shows the correspondence between different genotypes and PVY phenotypes after gene linkage molecular markers were used to genotype 67 potato plants.

[0034] Figure 5 The newly developed SNP1-2 molecular marker and the existing Ry in the embodiments of the present invention sto Ry chc The detection efficiency of gene-linked molecular markers for 67 potato strains is shown in Figure A, where Ry sto Gene molecular markers, Figure B shows Ry chc Gene molecular markers;

[0035] Figure 6 The newly developed SNP1-2 molecular marker in this embodiment of the invention is used in Ry sto Genes and Ry chc The validation results in the F1 generation of the hybridization breeding population are shown in the figure. In the figure, A and B are Ry respectively. sto Genes and Ry chc Genotyping cluster diagram of F1 generation from gene hybridization, with C and D representing Ry in order. sto Genes and Ry chc Mendelian segregation diagram of the F1 generation of gene hybridization. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0037] Based on the information contained in this application, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0038] To better understand the invention and not to limit its scope, all figures indicating amounts, percentages, and other numerical values ​​used in this application should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0039] To make the above-mentioned objectives, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below.

[0040] Identifying and screening disease-resistant varieties is one of the most fundamental and effective methods for potato resistance breeding. Conventional methods for identifying resistance to Potato virus Y (PVY) suffer from problems such as long cycles and low efficiency. Molecular marker-assisted selection can help to quickly screen materials with different resistance markers, improve breeding efficiency, and shorten the breeding cycle.

[0041] Several molecular markers linked to potato virus disease resistance genes have been identified. To overcome the limitations of traditional molecular markers, such as the disruption of linkage during generational transitions, this invention directly utilizes the R gene sequence to design molecular markers, specifically, using Ry... sto Reference gene (MN393235.1, see SEQ ID NO.1) and Ry chcThe reference gene (LC726345.1, see SEQ ID NO.2) was used as the comparison object. Homologous sequences were searched from the NCBI database. Through sequence alignment, SNP variant sites in the coding and regulatory regions of the gene were identified. Then, the disease resistance / susceptibility phenotype was associated with the SNP sites using the SniPlay online software to screen for molecular markers originating from the R gene sequence.

[0042] The aforementioned molecular markers include those located in Ry sto The SNP1 at 5411 bp of the reference gene sequence has both G and T alleles, indicating G / T polymorphism. Allele G represents resistance (favorable) and allele T represents susceptibility (unfavorable). The SNP1 at Ry... chc The reference gene sequence contains SNP2 at 1557 bp, which has alleles C and T, indicating C / T polymorphism. Allele C is a resistance (favorable) gene, and T is a susceptibility (unfavorable) gene.

[0043] Primers designed for competitive allele-specific PCR of SNPs 1-2 were used for detection. The results showed that the SNP sites of this invention can distinguish Ry in various potato breeding populations. sto and Ry chc The resistance / susceptibility genotype of the gene, and different genotypes reflect different resistances to PVY. Specifically, when the genotype at the SNP1 locus of the potato plant being tested is detected to be a genotype carrying the allele G (homozygous resistance and heterozygous resistance genotype), for example, tetraploids can have GGGG, GGGT, GGTT, and GTTT genotypes, and diploids can have GG and GT genotypes, then the potato plant is Ry sto The resistance gene exhibits a PVY virus resistance phenotype; when the tested potato plant carries only the T allele at the SNP1 locus (homozygous susceptible genotype), such as TTTT in tetraploid potatoes or TT in diploid potatoes, then the plant is predicted to be resistant to Ry virus. sto The locus carries an unfavorable (susceptibility) allele, thus lacking Ry. sto PVY resistance is mediated by SNP1. However, it should be noted that the overall PVY resistance phenotype of a plant may be influenced by other resistance genes in its genetic background. Therefore, SNP1 should be considered a predictive marker of Rysto status, rather than the sole determinant of total PVY resistance. Similarly, when the genotype at SNP2 locus of the tested potato plant is detected as carrying allele C (homozygous and heterozygous resistance genotypes), the potato plant carries Rysto resistance. chcThe resistance gene exhibits a PVY virus resistance phenotype; when the genotype of the SNP1 locus of the potato plant being tested is detected to be the genotype that carries only the T allele (homozygous susceptible genotype), the potato plant carries the disease-susceptibility gene.

[0044] Based on the above findings, one embodiment of the present invention provides the application of SNP molecular markers, their detection primers, or detection kits in identifying potato PVY resistance genes, wherein the SNP molecular markers are selected from at least one of SNP1 and SNP2 molecular markers, wherein:

[0045] The SNP1 molecular marker is located in Ry sto At the 5411 bp position of the gene, a G / T polymorphism is observed, which is described as Ry sto The nucleotide sequence of the gene is shown in SEQ ID NO.1; when the genotype of the SNP1 molecular marker carries the allele G, the Ry sto The gene is a resistance genotype. When the genotype of the SNP1 molecular marker only carries the allele T, the Ry sto The gene is a disease-susceptible genotype;

[0046] The SNP2 molecular marker is located in Ry chc At the 1557th bp position of the gene, a C / T polymorphism is observed, which is described as Ry chc The nucleotide sequence of the gene is shown in SEQ ID NO.2; when the genotype of the SNP2 molecular marker carries allele C, the Ry chc The gene is a resistance genotype. When the genotype of the SNP2 molecular marker only carries the allele T, the Ry chc The gene is a disease-susceptible genotype.

[0047] The SNP molecular markers provided by this invention are derived from Ry sto Genes and Ry chc Internal sequence variations in genes, specifically the genotype at this locus, are closely associated with gene resistance and susceptibility, and are highly correlated with phenotypic resistance identification. This can accurately determine whether potatoes carry Ry. sto Genes and Ry chc The resistance genotypes of the gene have higher accuracy in predicting resistance genes and more stable selection performance, providing a valuable resource for breeding potato PVY virus-resistant varieties. Compared with existing linkage molecular markers, the molecular markers within the gene in this invention are beneficial to significantly improve the accuracy and efficiency of resistance gene typing, thereby improving the accuracy of identifying PVY virus-resistant potato materials and the efficiency of potato PVY resistance breeding. Specifically, the molecular marker detection results of SNP1 in the population material of this application achieve 100% accuracy in resistance identification results. In contrast, the two reported Ry... stoThe detection accuracies of gene-linked molecular markers YES3-3A and Sto-M45 for the above materials were 95.5% and 64.2%, respectively; the accuracy of SNP2 in both marker detection and resistance identification of the aforementioned materials reached 97.2%. In comparison, the two previously reported Ry... chc The detection accuracies of the gene-linked molecular markers Ry364 and MG64-17 were 74.6% and 56.7%, respectively; and SNP1-2 had lower false positive and false negative rates, which greatly improves selection accuracy and breeding efficiency. This invention provides an effective auxiliary tool for potato PVY resistance detection and important support for PVY resistance breeding. By retaining plants carrying dominant alleles for propagation during the breeding process, the proportion of superior genes in offspring can be gradually increased, achieving the aggregation of resistance genes and thus improving the PVY resistance of the population. This has significant economic value in the fields of PVY resistance identification and breeding.

[0048] The detection of the SNP molecular marker genotype of this invention can be performed using methods commonly used in the prior art, such as gene chip technology, competitive allele-specific PCR (KASP) technology, Taqman probe technology, high-resolution melting curve (HRM) method, allele-specific PCR (AS-PCR) technology, direct sequencing method, and matrix-assisted laser desorption / ionization time-of-flight mass spectrometry.

[0049] This invention preferably employs KASP technology, a genotyping technique based on fluorescence detection after PCR amplification. KASP uses three primers: two genotyping primers and one universal primer. The genotyping primers consist of a universal sequence and a genotyping site. Different fluorescent groups are attached to one end of the universal sequence. The universal primer and genotyping sequence are used to specifically amplify the target gene, while the genotyping site at the end is used to specifically match different alleles of the SNP molecular marker. This allows for the differentiation of SNP genotypes based on the color signal of the detected fluorescent group, thus enabling rapid determination of whether the target gene is a resistance genotype. Taking the SNP1 genotyping primer with a first fluorescent group (detecting the G allele) and a second fluorescent group (detecting the T allele) as an example, when only the fluorescence signal of the first fluorescent group is detected, or when both the first and second fluorescent groups are detected simultaneously, the SNP allele is G or both G and T, and the tested plant is identified as Ry. chc In genetically resistant varieties, when only the fluorescence signal of the second fluorophore is detected, the allele at the SNP locus is T, and the tested plant is determined to be Ry. chc Genetically susceptible varieties.

[0050] Another embodiment of the present invention provides a detection primer for detecting SNP molecular markers, wherein the SNP molecular markers are selected from at least one of SNP1 molecular markers and SNP2 molecular markers, wherein:

[0051] The detection primers for the SNP1 molecular marker include forward primer SNP1-F1, forward primer SNP1-F2 and reverse primer SNP1-R, with nucleotide sequences shown in SEQ ID NO.3-5, respectively.

[0052] The detection primers for the SNP2 molecular marker include the forward primer SNP2-F, the reverse primer SNP2-R1, and the reverse primer SNP2-R2, with nucleotide sequences shown in SEQ ID NO.7-9, respectively.

[0053] The above sequence is shown below:

[0054] SNP1-F1: AGGTCCATCCCTCTCTTGGACAG (see SEQ ID NO.3);

[0055] SNP1-F2: AGGTCCATCCCTCTCTTGGACAT (see SEQ ID NO.4);

[0056] SNP1-R: ACAACCTTCCAAACTCAAATAAGTAAGCA (see SEQ ID NO.5);

[0057] SNP2-F: GCAATTCCTCATGGTGATATTCAAAAGA (see SEQ ID NO.7);

[0058] SNP2-R1: GGAAAACACTCTGAGTATTGGCG (see SEQ ID NO.8);

[0059] SNP2-R2: GGAAAACACTCTGAGTATTGGCA (see SEQ ID NO.9).

[0060] The detection primers provided in this application can effectively distinguish between homozygous / heterozygous disease-resistant genotypes and homozygous disease-susceptible genotypes. Compared with traditional molecular markers, detection results can be obtained without electrophoresis, which significantly improves the ease of operation in the process of high-throughput molecular marker-assisted selection for potato PVY virus resistance.

[0061] Another embodiment of the present invention provides a detection kit for detecting SNP molecular markers as described above, the detection kit comprising the detection primers as described above.

[0062] The advantages of the detection kit over the prior art are the same as the advantages of the detection primers over the prior art as described above, and will not be repeated here.

[0063] Optionally, the molar ratio of forward primer SNP1-F1, forward primer SNP1-F2 and reverse primer SNP1-R is 2:2:5, and the molar ratio of forward primer SNP2-F, reverse primer SNP2-R1 and reverse primer SNP2-R2 is 5:2:2.

[0064] Optionally, the detection kit further includes PCR amplification reagents. The present invention does not have any special limitation on the source of the PCR amplification reagents, and conventional commercially available products in the art can be used.

[0065] In a typical implementation, the PCR amplification reagent includes KASP Master mix (manufacturer: LGCBiosearch Technologies, catalog number: KBS-1050-131), which includes DNA polymerase, dNTPs, and buffer reagents.

[0066] This invention does not impose special limitations on the total amount of PCR amplification reagents and primers used in the detection kit; the amounts can be set according to the conventional requirements of the kit.

[0067] Based on the same inventive concept as described above, another embodiment of the present invention provides a method for identifying the PVY resistance gene in potatoes, comprising the following steps:

[0068] Using the genomic DNA of the potato to be tested as a template, SNP1 and SNP2 molecular markers were amplified separately by competitive allele-specific PCR. The fluorescence signal during amplification was detected, and the resistance type of the potato to be tested was determined based on the fluorescence signal; wherein:

[0069] One end of the forward primer SNP1-F1, labeled with the SNP1 molecule, is connected to a first fluorescent group, and one end of the forward primer SNP1-F2 is connected to a second fluorescent group. When only the first fluorescent group is detected, or when both the first and second fluorescent groups are detected simultaneously, the potato to be tested is determined to carry Ry. sto Resistance gene; conversely, if the tested potato does not contain the resistance gene, it is determined that the potato carries Ry. sto Disease-susceptibility genes;

[0070] The reverse primer SNP2-R1, labeled with SNP2, has a first fluorescent group attached to one end and a second fluorescent group attached to one end. When only the first fluorescent group or both the first and second fluorescent groups are detected, the potato to be tested is determined to carry Ry. chcResistance gene; conversely, if the tested potato does not contain the resistance gene, it is determined that the potato carries Ry. chc Disease-causing genes.

[0071] This invention requires only two steps: conventional PCR amplification and fluorescence signal detection. It can efficiently distinguish the PVY resistance gene of the test plant at the genotype level, and has the advantages of low cost, high throughput, and good accuracy.

[0072] This invention does not specifically limit the method for extracting genomic DNA from potatoes to be tested. Commonly used genomic DNA extraction methods or kits in the field can be used, such as the CTAB extraction method.

[0073] Optionally, the PCR amplification system, in 10 μL, contains: 2.5 μL of genomic DNA template, 0.15 μL of primer mixture, 5 μL of 2×KASP Master mix, and 2.35 μL of ddH2O.

[0074] Optionally, the concentration of genomic DNA is 20 ng / μL.

[0075] Optionally, the PCR reaction procedure includes a thermal cycling phase and a recovery phase. The thermal cycling phase includes: pre-denaturation at 94℃ for 15 min; using landing PCR, denaturation at 94℃ for 20 s, annealing and extension at 61-55℃ for 60 s, for 10 cycles, with each cycle decreasing by 0.6℃; followed by denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, for 26 cycles; and a reading at 37℃ for 1 min. The recovery phase includes: denaturation at 94℃ for 20 s, extension at 57℃ for 60 s, and a reading at 37℃ for 1 min.

[0076] This invention also provides an application of the method for identifying the potato PVY resistance gene as described above, wherein the application is selected from any of the following:

[0077] (a) Application in the identification of PVY resistance in potatoes;

[0078] (b) Application in potato PVY resistance breeding or assisted breeding.

[0079] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0080] Germplasm resources: The potato germplasm resources used in this invention can all be obtained from the research group of Nie Bihua at Huazhong Agricultural University, but they can only be used to repeat the experiments of this invention and must not be used for other purposes.

[0081] Reference gene: Ry sto Reference gene can be found in NCBI accession number: MN393235.1, Ry chc The reference gene can be found in NCBI accession number: LC726345.1.

[0082]

[0083]

[0084] In the above sequences, the underlined parts represent primers, and the shaded and bolded parts represent SNP sites.

[0085] 1. Identification of potato PVY virus resistance phenotype

[0086] Sixty-seven potato germplasm resources from Huazhong Agricultural University were inoculated using PVY friction inoculation and grafting. At the 6-8 leaf stage, inoculation was performed using the method described by Chen et al. (Chen R, Tu Z, He C, Nie X, Li K, Fei S, Song B, Nie B, Xie C. Susceptibility factor StEXA1 interacts with StnCBP to facilitate potato virus Y accumulation through the stress granule-dependent RNA regulatory pathway in potato. Horticulture Research. 2022a;9:uhac159. Chen R, Yang M, Tu Z, Xie F, Chen J, Luo T, Hu X, Nie B, He C. Eukaryotic translationinitiation factor 4E family member nCBP facilitates the accumulation of TGB-encoding viruses by recognizing the viral coat protein in potato and tobacco. Frontiers in Plant Science. 2022b;13:946873.). Inoculation buffers (10 mM phosphate buffer, 32...) were used. Inoculate plants with PVY (mM sodium sulfite, pH 7.5) 0 strains.

[0087] Three weeks after inoculation, newly grown leaves were collected, and the virus titer was detected using an enzyme-linked immunosorbent assay (ELISA) kit (Agdia Potato Virus Y Detection Kit, catalog number: PSA20001 / 0288). Materials in which no virus infection was detected by either friction inoculation or grafting inoculation were identified as PVY extreme resistant materials. (This is based on existing research confirming the presence of Ry...) sto The genetically modified potato variety Barbara as Ry sto Positive controls for resistance genes, which have been confirmed by studies to contain Ry chc The wild-type relative of the gene, *S. chacoense* (CHC-40-3), is a Ry chc The positive control for the resistance gene, which does not contain Ry sto and Ry chc Two materials, MPI.44.1016 / 10 and Shepody, were used as negative controls for the resistance gene.

[0088] Twenty-eight potato accessions exhibiting extreme resistance to PVY virus were obtained through resistance identification. These accessions are: Huashu 2, Huashu 4, Huashu 10, Huashu 11, Huashu 13, Huashu 15, Huashu 16, Huaen 1, Huaen 2, ES5, ES8, ES14, ES15, J1, J2, J4, G8, G14, G22, NZ103, NZ104, NZ105, NZ106, MPI.63.613 / 63, Barbara, Ursus, Tacna, and CHC-40-3. The remaining 39 accessions were identified as susceptible to PVY virus.

[0089] 2. PVY resistance gene Ry sto and Ry chc Analysis of variant sites and disease resistance phenotypes

[0090] Retrieve from publicly available NCBI databases and Ry stoFifty-five highly similar gene sequences were found (MN393235.1), of which 12 sequences were confirmed as resistance variants by Paluchowska et al. (Paluchowska P, Lim Rossmann S, Lysøe E, Janiszewska M, Michalak K, Heydarnajad Giglou R, Torabi Giglou M, Brurberg MB, Śliwka J, Yin Z. Diversity of the Rysto gene conferring resistance to potato virus Y inwild relatives of potato. BMC Plant Biology. 2024; 24(1): 375.), and the rest were susceptibility variants. For Ry... chc The gene (LC726345.1) yielded 50 Ry genes when retrieved from NCBI. chc Homologous sequences, of which 2 sequences are resistance variants and the remaining 48 sequences are susceptibility variants (Li G, Shao J, Wang Y, Liu T, Tong Y, Jansky S, Xie C, Song B, Cai X. Rychc confers extreme resistance to potatovirus Y in potato. Cells. 2022 Aug 18;11(16):2577).

[0091] Using MEGAXI software (version 0.13), the obtained sequences were compared with Ry... sto Reference gene (MN393235.1) and Ry chc By comparing with the reference gene (LC726345.1) and combining the PVY resistance identification results of the sequence, single nucleotide polymorphism (SNP) variant sites related to disease resistance and susceptibility were discovered using SNiplay (https: / / sniplay.southgreen.fr).

[0092] Figure 1 The frequency distribution of SNP variant sites in resistance genes is shown in Figure A, which represents the Rysto gene, and Figure B, which represents the Rychc gene. The horizontal axis represents the location of SNPs in the reference gene, and the vertical axis represents the SNP frequency (percentage, %). The red dashed line indicates the significance threshold (Ry). sto Corresponding to P < 10 -7.5 Ry chc(Corresponding to P < 0.01), the SNPs below the dashed line represent SNPs related to PVY resistance. Through correlation analysis, in Ry sto and Ry chc 27 and 23 significantly associated SNPs were detected, respectively. Based on statistical significance, genotype-phenotype correspondence, sequence conservation, and primer design feasibility, candidate SNPs were prioritized, and two SNPs located in Ry were selected. sto and Ry chc The resistance-associated sites within the gene are named SNP1 and SNP2, respectively.

[0093] SNP1 is located in Ry sto At the 5411 bp of the reference gene sequence (MN393235.1, see SEQ ID NO.1), there is a G / T polymorphism, where the allele G is the resistant (favorable) genotype.

[0094] SNP2 is located in Ry chc At the 1557th bp of the reference gene sequence (LC726345.1, see SEQ ID NO.2), there is a C / T polymorphism, where allele C is the resistant (favorable) genotype.

[0095] 3. Development and application of SNP molecular marker KASP detection technology

[0096] Based on resistance-related variant sites and a reference genome sequence, specific competitive allele-specific PCR primers were designed. The primers consist of two genotyping primers (each carrying a different fluorescent label) and one universal primer. The primer design principle is described in [link to primer design]. Figure 2 .

[0097] Ry sto The primers for amplifying the SNP1 (G / T) gene site consist of two allele-specific forward primers and one universal reverse primer, with the following sequences:

[0098] SNP1-F1: FAM-AGGTCCATCCCTCTCTTGGACAG (see SEQ ID NO.3);

[0099] SNP1-F2: HEX-AGGTCCATCCCTCCTTGGACAT (see SEQ ID NO.4);

[0100] SNP1-R: ACAACCTTCCAAACTCAAATAAGTAAGCA (see SEQ ID NO.5);

[0101] The SNP1 (G / T) amplification product sequence is as follows:

[0102] aggtccatccctctcttggacaKtgcagagtgcttacttatttgagtttggaaggttgt (see SEQ IDNO.6), K=G or T.

[0103] Ry chc The primers for amplifying the SNP2 (C / T) gene site include one universal forward primer and two allele-specific reverse primer sequences, as follows:

[0104] SNP2-F: GCAATTCCTCATGGTGATATTCAAAAGA (see SEQ ID NO.7);

[0105] SNP2-R1: FAM-GGAAAACACTCTGAGTATTGGCG (see SEQ ID NO.8);

[0106] SNP2-R2: HEX-GGAAAACACTCTGAGTATTGGCA (see SEQ ID NO.9);

[0107] The SNP2 (C / T) amplification product sequence is as follows:

[0108] gcaattcctcatggtgatattcaaaagattctcaagataagctttgatggacttgaYgccaatactcagagtgttttcc (see SEQ ID NO. 10), Y=C or T.

[0109] In the primer sequences above, F represents the upward primer, R represents the downward primer, FAM represents the FAM fluorescent group, and HEX represents the HEX fluorescent group.

[0110] The method for detecting the PVY resistance gene in potatoes includes the following steps:

[0111] Genomic DNA extraction: Genomic DNA was extracted from the potato plants to be tested using the CTAB method;

[0112] Competitive allele-specific PCR amplification and fluorescence detection of products: The SNP1 primer set was used to specifically amplify the genomic DNA of the plants to be tested; or the SNP2 primer set was used to specifically amplify the genomic DNA of the plants to be tested, and the amplification products of these genomic DNAs were detected by fluorescence detection.

[0113] The KASP reaction system (per 10 μL) includes: 2.5 μL of 20 ng / μL genomic DNA template, 0.15 μL of primer mixture (containing 30 μM universal primers and 12 μM genotyping primers), 5 μL of 2×KASP Master mix (purchased from LGC Biosearch Technologies, catalog number: KBS-1050-131), and 2.35 μL of ddH2O. The primer molar ratio is F1:F2:R = 2:2:5 (SNP1) or F:R1:R2 = 5:2:2 (SNP2).

[0114] The reaction procedure consists of two phases, I and II. Thermal cycling phase (Phase I): Pre-denaturation at 94℃ for 15 min; using falling PCR, denaturation at 94℃ for 20 s, annealing and extension at 61-55℃ for 60 s, for 10 cycles, decreasing the temperature by 0.6℃ per cycle (i.e., decreasing from 61℃ to 55℃ at a rate of 0.6℃ per cycle); denaturation at 94℃ for 20 s; annealing and extension at 55℃ for 60 s, for 26 cycles; reading at 37℃ for 1 min. Recovery phase (Phase II): Denaturation at 94℃ for 20 s; extension at 57℃ for 60 s; reading at 37℃ for 1 min. If the separation of different alleles on the two-dimensional graph is not ideal, step II can be repeated twice (3 times in total), with readings at 37℃ for 1 min each time. After the reaction, allele typing is determined based on the two fluorescence signals.

[0115] Detection of only FAM fluorescence signal (red) or superimposed FAM and HEX fluorescence signals indicates the presence of a resistance-favorable allele in the genome; detection of only HEX fluorescence signal (green) indicates the presence of only a susceptibility-unfavorable allele in the genome. More specifically, in Ry... sto In the KASP gene assay, if only FAM fluorescence signal is detected, the SNP1 locus of the tested plant is determined to be a homozygous favorable genotype (GGGG). If both FAM and HEX fluorescence signals are detected simultaneously, the SNP1 locus is determined to be a heterozygous favorable genotype (GGGT, GGTT, GTTT), which theoretically possess disease resistance. If only HEX fluorescence signal is detected, the SNP1 locus is determined to be a homozygous unfavorable genotype (TTTT), which theoretically possesses susceptibility. Similarly, in Ry... chcIn the KASP gene assay, if only FAM fluorescence signal is detected, the SNP2 locus of the tested plant is determined to be a homozygous favorable genotype (CCCC). If both FAM and HEX fluorescence signals are detected simultaneously, the SNP2 locus is determined to be a heterozygous favorable genotype (CCCT, CCTT, CTTT), theoretically indicating disease resistance. If only HEX fluorescence signal is detected, the SNP2 locus is determined to be a homozygous unfavorable genotype (TTTT), theoretically indicating susceptibility. Since current potato cultivars are all autotetraploids, their four alleles often contain only one or two resistance genotypes. Therefore, the frequency of homozygous resistance genotypes is extremely low and can be ignored.

[0116] Figure 3 This demonstrates the use of the SNP1-2 molecular marker of the present invention and Ry from previous studies. sto Gene-linked molecular markers (Ry sto -KASP(old)) and Ry chc Gene-linked molecular markers (Ry chc -KASP(old)) results of genotyping of the aforementioned 67 potato varieties, where Figures A and D represent SNP1, SNP2, and Ry in order. sto -KASP(old), Ry chc-KASP(old) molecular marker, NTC represents the control group that does not contain the genomic DNA to be tested, but retains only the primers, enzymes, buffers and all other reaction components. The horizontal and vertical axes represent different fluorescence channels, and different colors of fluorescence reflect different allelic variations. The molecular markers are disclosed in the literature “Sood S, Bhardwaj V, Chourasia KN, Kaur RP, Kumar V, Kumar R, Sundaresha S, Bohar R, Garcia-Oliveira AL, Singh RK, Kumar M. KASP markers validation for late blight, PCN and PVY resistance in a large germplasm collection of tetraploid potato (Solanum tuberosum L.). Scientia Horticulturae. 2022 Mar 15;295:110859.” and “Asano K, Endelman JB. Development of KASP markers for the potato virus Y resistance gene Ry chc using whole-genomeresequencing data. American Journal of Potato Research. 2024 Apr;101(2):114-21.”. The detection primers are as follows:

[0117] Rysto-KASP(old)-F1:GGAGAAACGTTCAACTCTAGAAGCA (see SEQ ID NO. 11);

[0118] Rysto-KASP(old)-F2: GAGAAACGTTCAACTCTAGAAGCC (see SEQ ID NO. 12);

[0119] Rysto-KASP(old)-R:GCTTAACTCAAGCGGAATAACCCCTT (see SEQ ID NO.13);

[0120] Rychc-KASP(old)-F1:GAATGGATTCTGCAGTGAAGTACAATTA (see SEQ ID NO. 14);

[0121] Rychc-KASP(old)-F2:AATGGATTCTGCAGTGAAGTACAATTG (see SEQ ID NO. 15);

[0122] Rychc-KASP(old)-R: CTCCCTAGTATAAAGATGATCGACATGAT (see SEQ ID NO. 16).

[0123] The results show that the molecular markers of the present invention can effectively divide plants with different phenotypes into corresponding population clusters. The typing effect of heterozygous resistance genotype and homozygous susceptibility genotype is good, and the typing effect is better than that of the KASP molecular markers of Rysto and Rychc that have been developed.

[0124] Figure 4 The results show the statistical findings of PVY resistance identification and the detection of molecular markers YES3-3A, Sto-M45, Ry364, and MG64-17 in previous studies, as well as the SNP1-2 molecular markers of this invention. The meanings of each column are as follows: "Genotype" indicates the variety; "Ry genes" indicates the presence of one or more PVY resistance genes (Ry...). adg Ry sto or Ry chc The "Ry" indicates the resistant genotype, while "-" indicates the resistant genotype in which none of the three specific resistance genes mentioned above were detected. "ELISA" indicates the ELISA test result. Genotypes with absorbance values ​​below 0.1 are classified as resistant (R), and genotypes with absorbance values ​​above 0.5 are classified as susceptible (S). sto "and "Ry chc "The results of testing PVY resistant and susceptible plants using existing molecular markers and the molecular marker of this invention (denoted as KASP) are as follows: '+' indicates a positive molecular marker test, meaning the genotype is resistant; '-' indicates a negative marker test, meaning the genotype is susceptible. It is important to note that these symbols only indicate the presence or absence of a specific molecular marker and do not represent the definitive existence of a resistance phenotype or the resistance gene itself. For example, if the SNP1 test result is '-', the plant may be resistant due to non-Ry..." sto Genes such as those carrying Ry adg The resistance gene manifests as PVY resistance. The cells highlighted in red indicate discrepancies between the phenotypic resistance and the molecular marker detection results, used to identify false positives (resistance markers are present, but ELISA results show susceptibility) or false negatives (resistance markers are absent, but ELISA results show resistance). Figure 5 These molecular markers were shown to be used to detect the potato PVY resistance gene Ry. sto (A) and Ry chc(B) Detection efficiency, expressed as a percentage of accuracy (including accurate identification of positive and negative plants), false positives, and false negatives. The yellow line represents the performance of the newly developed KASP molecular marker. Molecular markers are disclosed in the literature "Bhardwaj V, Salej S, Ashwani K, Vanishree G, Sanjeev S, Sundaresha S. Efficiency and reliability of marker-assisted selection for resistance tomajor biotic stresses in potato. Potato Journal. 2019; 46:56–66.", "Herrera M, Vidalon LJ, Montenegro JD, Cinzia Riccio, Guzman F, Bartolini I, Ghislain M. Molecular and genetic characterization of the Ryadg locus on chromosome XI from Andigena potatoes conferring extreme resistance to potato virus Y. Theoretical and Applied Genetics. 2018; 131:1925-1938. GavrilenkoTA. Screening of Russian potato cultivars (Solanum tuberosum L.) with DNAmarkers linked to the genes conferring extreme resistance to Potato virus Y,Agricultural Biology. 2019; 54:958–969." and "Li G, Shao J, Wang Y, Liu T, TongY, Jansky S, Xie C, Song B, Cai X. Ry chcThe study investigated the extreme resistance of potatovirus Y in potato. Cells. 2022; 11(16): 2577. The detection primers are as follows:

[0125] YES3-3A-F: TAACTCAAGCGGAATAACCC (see SEQ ID NO. 17);

[0126] YES3-3A -R:AAATTCACCTGTTTACATGCTTCTTGTG (see SEQ ID NO.18);

[0127] Sto-M45-F: CCTAGTTTCTGAGCATGTAATTTC (see SEQ ID NO.19);

[0128] Sto-M45-R: TGCAGCTATTCAAAACACATAAGG (see SEQ ID NO.20);

[0129] Ry364-F: CTATTATAAGTCTGGTACTAGGACG (see SEQ ID NO. 21);

[0130] Ry364-R: GGCTATATGTTCAATGAATTCATGCTAA (see SEQ ID NO. 22);

[0131] MG64-17-F: TAAGTAAGAAACCTACTTATTCTCCG (see SEQ ID NO. 23);

[0132] MG64-17-R: GTTTGACAACCTCCCTAGTATAAA (see SEQ ID NO. 24).

[0133] The aforementioned results showed that 4 out of 67 potato plants carried Ry sto Gene, 3 plants carry Ry chc The gene, or other plants may carry Ry adg The gene may not carry any resistance gene (SNP1-2 test result is negative), while carrying Ry sto and Ry chc In plants with resistance genes, for Ry stoFor the gene, the SNP1 KASP detection accuracy reached 100.0%, while the detection accuracy of molecular markers YES3-3A and Sto-M45 was 95.5% (false positive rate 4.8%) and 64.2% (false positive rate 36.5%, false negative rate 25.0%), respectively. Furthermore, the previously developed Ry... sto -KASP flag in detecting Ry sto The genotyping also showed shortcomings, with an accuracy rate of 76.1% across 67 potato varieties (false positive rate of 20.5%, false negative rate of 25.0%); for Ry chc For the gene, the SNP2 KASP detection accuracy reached 97.2% with a false positive rate of 2.8%, while the accuracy rates for molecular markers Ry364 and MG64-17 were 74.6% (false positive rate 23.4%, false negative rate 66.7%) and 56.7% (false positive rate 43.8%, false negative rate 33.3%), respectively. Furthermore, the previously developed Ry... chc -KASP flag in detecting Ry chc The genotype also showed shortcomings, with an accuracy rate of 0.0% (false negative rate of 100%) across 67 potato varieties.

[0134] The KASP-based method for detecting molecular marker genotypes in this invention eliminates the need for gel electrophoresis, making the process more efficient. Furthermore, the results demonstrate that the newly developed molecular markers can accurately and with high throughput identify carriers of Ry. sto and Ry chc The PVY resistance phenotype of the gene shows high consistency between the genotyping results and the actual PVY resistance phenotype. The probability of false positives and false negatives is significantly lower than that of previously reported molecular markers. The accuracy in detecting the resistance phenotype of the target resistance gene is significantly improved compared with existing molecular markers, and it has broad application prospects in the fields of PVY resistance identification and breeding.

[0135] 4. Population validation of SNP molecular marker KASP detection technology

[0136] Population building: using MPI.63.613 / 63 (Ry sto : Ryryryry (disease-resistant genotype) × MPI.44.1016 / 10 (Ry sto Using ryryryry (susceptibility genotype) as parents, Ry was constructed. sto The F1 generation of the tetraploid cross was produced, and CHC-40-3 (Ry) was also used. chc : Ryry (disease-resistant genotype) × RH89-039-16 (abbreviated as RH) (Ry chc Using Ryry (susceptibility genotype) as the parent, construct Ry chcThe F1 generation was obtained by crossing diploid genes. Subsequently, the resistance genotype of the target resistance gene was detected in the F1 breeding population using the newly developed SNP1-2 molecular marker.

[0137] Figure 6 The validation results of two independent crosses of the F1 breeding population are shown, where Figures A and B represent Ry, respectively. sto Genes and Ry chc KASP fluorescent clustering (genotyping) diagram of F1 generation from gene hybridization. In the diagram, red clusters represent genotypes carrying both resistance and susceptibility alleles (heterozygous resistance genotypes), green clusters represent genotypes carrying only susceptibility alleles (homozygous susceptibility genotypes), and gray represents the no-template control (NTC). Figures C, D, and E represent Ry... sto Genes and Ry chc The Mendelian segregation diagram of the F1 generation of the gene hybridization is shown. Rysto represents a functional resistance allele, conferring extreme resistance to PVY, while rysto represents a non-functional allele, associated with susceptibility to PVY. Similarly, Rychc represents a functional resistance allele, conferring extreme resistance to PVY; while rychc represents a non-functional allele, associated with susceptibility to PVY. The results show that the KASP clustering of the SNP1-2 molecular markers of this invention is clear and reproducible, effectively distinguishing resistant and susceptible individuals. Specifically, in both populations, heterozygous genotypes carrying resistance and susceptibility alleles formed different clusters, while homozygous susceptible individuals clustered separately. Clear segregation was also observed even without a template control, confirming the reliability of the molecular markers. Segregation analysis of the F1 population showed no significant deviation from the expected Mendelian proportions. For Ry... sto The segregating population from the hybridization population showed the expected 1:1 haploid (Ryryryry) × haploid (ryryryry) ratio, with a chi-square value (χ²). 2 The value was 0.409 (p=0.522). Similarly, for Ry... chc The segregating populations from the hybridization also exhibited the expected 1:1 haploid (Ryry) × haploid (ryry) ratio, χ² 2 =2.528 (p = 0.112) (D). Standardized residual analysis further supports these results. For the two groups, the observed biases are Ry sto ±0.45, Ry chc The mean ±1.12 did not exceed the significance threshold of ±2, confirming the non-significant separation and the reliability and accuracy of the newly developed molecular marker in accurately tracking the two resistance genes.

[0138] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of an SNP molecular marker, its detection primers, or detection kit in identifying potato PVY resistance genes, characterized in that, The SNP molecular marker is selected from at least one of SNP1 molecular marker and SNP2 molecular marker, wherein: The SNP1 molecular marker is located in Ry sto At the 5411 bp position of the gene, a G / T polymorphism is observed, which is described as Ry sto The nucleotide sequence of the gene is shown in SEQ ID NO.1; when the genotype of the SNP1 molecular marker carries the allele G, the Ry sto The gene is a resistance genotype. When the genotype of the SNP1 molecular marker only carries the allele T, the Ry sto The gene is a disease-susceptible genotype; The SNP2 molecular marker is located in Ry chc At the 1557th bp position of the gene, a C / T polymorphism is observed, which is described as Ry chc The nucleotide sequence of the gene is shown in SEQ ID NO.2; when the genotype of the SNP2 molecular marker carries allele C, the Ry chc The gene is a resistance genotype. When the genotype of the SNP2 molecular marker only carries the allele T, the Ry chc The gene is a disease-susceptible genotype.

2. The application of the SNP molecular marker, its detection primers, or detection kit according to claim 1 in the identification of potato PVY resistance genes, characterized in that, The detection primers include a forward primer and a reverse primer, wherein: The detection primers for the SNP1 molecular marker include forward primer SNP1-F1, forward primer SNP1-F2 and reverse primer SNP1-R, with nucleotide sequences shown in SEQ ID NO.3-5, respectively. The detection primers for the SNP2 molecular marker include the forward primer SNP2-F, the reverse primer SNP2-R1, and the reverse primer SNP2-R2, with nucleotide sequences shown in SEQ ID NO.7-9, respectively.

3. The application of the SNP molecular marker, its detection primers, or detection kit according to claim 1 in the identification of potato PVY resistance genes, characterized in that, The molar ratio of forward primer SNP1-F1, forward primer SNP1-F2 and reverse primer SNP1-R is 2:2:5, and the molar ratio of forward primer SNP2-F, reverse primer SNP2-R1 and reverse primer SNP2-R2 is 5:2:

2.

4. The application of the SNP molecular marker, its detection primers, or detection kit according to claim 1 in the identification of potato PVY resistance genes, characterized in that, The detection kit includes detection primers, wherein: The detection primers for the SNP1 molecular marker include forward primer SNP1-F1, forward primer SNP1-F2 and reverse primer SNP1-R, with nucleotide sequences shown in SEQ ID NO.3-5, respectively. The detection primers for the SNP2 molecular marker include the forward primer SNP2-F, the reverse primer SNP2-R1, and the reverse primer SNP2-R2, with nucleotide sequences shown in SEQ ID NO.7-9, respectively.

5. The application of the SNP molecular marker, its detection primers, or detection kit according to claim 4 in the identification of potato PVY resistance genes, characterized in that, The detection kit also includes PCR amplification reagents, which include DNA polymerase, dNTPs, and buffer reagents.

6. A detection primer for detecting the SNP molecular marker as described in claim 1, characterized in that, The SNP molecular marker is selected from at least one of SNP1 molecular marker and SNP2 molecular marker, wherein: The detection primers for the SNP1 molecular marker include forward primer SNP1-F1, forward primer SNP1-F2 and reverse primer SNP1-R, with nucleotide sequences shown in SEQ ID NO.3-5, respectively. The detection primers for the SNP2 molecular marker include the forward primer SNP2-F, the reverse primer SNP2-R1, and the reverse primer SNP2-R2, with nucleotide sequences shown in SEQ ID NO.7-9, respectively.

7. A method for identifying the PVY resistance gene in potato, characterized in that, Includes the following steps: Using the genomic DNA of the potato to be tested as a template, and employing the detection primers as described in claim 6, competitive allele-specific PCR technology is used to amplify the SNP1 and SNP2 molecular markers, respectively. The fluorescence signals during amplification are detected, and the resistance type of the potato to be tested is determined based on the fluorescence signals; wherein: The forward primer SNP1-F1 of the SNP1 molecular marker is connected to a first fluorescent group at one end, and the forward primer SNP1-F2 is connected to a second fluorescent group at one end. When only the first fluorescent group is detected, or when both the first and second fluorescent groups are detected simultaneously, the potato to be tested is determined to carry Ry. sto Resistance gene; conversely, if the tested potato does not contain the resistance gene, it is determined that the potato carries Ry. sto Disease-susceptibility genes; The reverse primer SNP2-R1 of the SNP2 molecular marker is connected to a first fluorescent group at one end, and a second fluorescent group at one end of the reverse primer SNP2-R2. When only the first fluorescent group is detected, or when both the first and second fluorescent groups are detected simultaneously, the potato to be tested is determined to carry Ry. chc Resistance gene; conversely, if the tested potato does not contain the resistance gene, it is determined that the potato carries Ry. chc Disease-causing genes.

8. The method for identifying the potato PVY resistance gene according to claim 7, characterized in that, The PCR amplification system, in 10 μL increments, includes: 2.5 μL genomic DNA template, 0.15 μL primer mixture, 5 μL 2×KASP Master mix, and 2.35 μL ddH2O; The PCR reaction procedure includes a thermal cycling phase and a recovery phase. The thermal cycling phase consists of: pre-denaturation at 94℃ for 15 min; using landing PCR, denaturation at 94℃ for 20 s, annealing and extension at 61-55℃ for 60 s, for 10 cycles, with a decrease of 0.6℃ per cycle; followed by denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, for 26 cycles; and a reading at 37℃ for 1 min. The recovery phase consists of: denaturation at 94℃ for 20 s, extension at 57℃ for 60 s, and a reading at 37℃ for 1 min.

9. The method for identifying the potato PVY resistance gene according to claim 7, characterized in that, The first fluorescent group is FAM, and the second fluorescent group is HEX.

10. The application of the method for identifying the potato PVY resistance gene as described in any one of claims 7-9, characterized in that, The application is selected from any of the following: (a) Application in the identification of PVY resistance in potatoes; (b) Application in potato PVY resistance breeding or assisted breeding.

Images