A molecular marker related to the branching angle and plant height of oilseed rape, a kasp primer combination and application thereof

Abstract

The application discloses a molecular marker related to a branch angle and plant height of rapeseed, a KASP primer combination and application thereof, and belongs to the technical field of molecular marker assisted breeding. The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1; there is A / G polymorphism at the 124th base of the nucleotide sequence, and the A / G polymorphism includes AA, AG and GG genotypes. The branch angle of the rapeseed with the polymorphism site A is greater than that of the rapeseed with the polymorphism site G; the plant height of the rapeseed with the polymorphism site A is lower than that of the rapeseed with the polymorphism site G. The application identifies a SNP site located on a chromosome A05 of the rapeseed and co-separating with a branch angle and plant height gene of the rapeseed, and simultaneously develops a rapid and efficient KASP primer combination which can be used for molecular assisted breeding of the branch angle and plant height of the rapeseed. The application provides an efficient and accurate molecular marker assisted selection tool for ideal plant type breeding and high-yield new variety breeding of the rapeseed.

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to a molecular marker, KASP primer combination and its application related to rapeseed branching angle and plant height. Background Technology

[0002] Rapeseed is an important oilseed crop, and improving its yield is crucial for ensuring food and oil security. Optimizing plant type is key to achieving high and stable yields and efficient mechanized production. Branching angle is a vital agronomic trait determining the canopy structure of rapeseed, directly affecting field ventilation, light penetration, and light energy utilization. An excessively large branching angle can lead to mutual shading between plants, increasing the risk of disease; an excessively small angle restricts the effective branching space of individual plants, reducing the overall yield potential. Plant height is closely related to lodging resistance; excessively tall plants are prone to lodging, leading to yield reduction, while excessively short plants may reduce biomass accumulation. Studies have shown that branching angle and plant height have a genetically synergistic regulatory effect, jointly influencing planting density, mechanized harvesting efficiency, and yield formation.

[0003] Traditional plant type improvement methods require manual measurement of plant height and branching angle during the plant maturity stage for screening. This method has drawbacks such as long breeding cycles and significant interference from environmental factors, resulting in limited accuracy in trait selection. Developing specific molecular markers based on the base polymorphism of target gene loci and establishing an early-stage auxiliary selection system is an effective way to improve the efficiency of rapeseed breeding. Kompetitive Allele-Specific PCR (KASP), as a novel SNP genotyping technique, combines the principle of Amplification Refractory Mutation System (ARMS) with a fluorescence detection system. It uses two forward primers carrying specific bases and one universal reverse primer for PCR amplification. The 5' ends of the forward primers are connected to different fluorescent label sequences. When the amplified product matches the corresponding allele, the difference in fluorescence signal at the terminal can be detected to achieve accurate SNP genotyping (He CL, et al. SNP genotyping: the KASP assay. Methods Mol Biol, 2014, 1145: 75-86). Therefore, creating KASP molecular markers closely linked to rapeseed branching angle and plant height traits to achieve seedling genotype screening has important practical value for optimizing the breeding process and accelerating the improvement of plant type. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker, KASP primer set, and its application related to branching angle and plant height in rapeseed, in order to solve the problems existing in the prior art. This invention identifies an SNP locus located on the A05 chromosome of rapeseed that co-segregates with genes for branching angle and plant height. Simultaneously, it develops a rapid and efficient KASP primer set that can be used for molecular-assisted breeding of rapeseed branching angle and plant height traits. This KASP primer set has significant value in rapeseed plant type breeding.

[0005] To achieve the above objectives, the present invention provides the following solution: This invention provides a molecular marker related to the branching angle and plant height of rapeseed, the nucleotide sequence of which is shown in SEQ ID NO.1; The nucleotide sequence shown in SEQ ID NO.1 has an A / G polymorphism at the 124th base, including AA, AG and GG genotypes.

[0006] Furthermore, the branching angle of rapeseed with polymorphic site A is greater than that of rapeseed with polymorphic site G; Rapeseed plants with polymorphism A were shorter than those with polymorphism G.

[0007] Furthermore, rapeseed with genotype AA is short and loose; rapeseed with genotype GG is tall and compact; and rapeseed with genotype AG is semi-short and semi-loose.

[0008] This invention also provides the application of the above-mentioned molecular markers in any of the following: A1. Detecting the branching angle of rapeseed; A2. Detecting rapeseed plant height; A3. Early identification or screening of rapeseed varieties with superior plant type; A4. Improve rapeseed plant type; A5. Increase rapeseed yield.

[0009] The present invention also provides a KASP primer combination for detecting the above-mentioned molecular marker, comprising an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.3, and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.4.

[0010] The present invention also provides a kit for detecting the above-mentioned molecular markers, comprising the above-mentioned KASP primer combination.

[0011] The present invention also provides an application of the above-described KASP primer combination or the above-described kit in any of the following: B1. Detect the above molecular markers; B2. Detecting the branching angle of rapeseed; B3. Detect rapeseed plant height; B4. Early identification or screening of rapeseed varieties with superior plant type; B5. Molecular marker-assisted breeding of superior rapeseed plant architecture; B6. Increase rapeseed yield.

[0012] This invention also provides a method for identifying the branching angle and plant height of rapeseed, comprising the following steps: Using the genomic DNA of the rapeseed sample to be tested as a template, the template was amplified by real-time quantitative PCR using the above-mentioned KASP primer combination or the above-mentioned kit. After the PCR amplification was completed, the fluorescence signal was read, the converted fluorescence signal was analyzed, the genotype was identified, and the branching angle and plant height of rapeseed were determined based on the genotype. The branching angle of rapeseed with genotype AA is greater than that of rapeseed with genotype GG and genotype AG; the branching angle of rapeseed with genotype GG is smaller than that of rapeseed with genotype AG. Rapeseed with genotype AA was shorter than rapeseed with genotypes GG and AG; rapeseed with genotype GG was taller than rapeseed with genotype AG.

[0013] Optionally, the procedure for the quantitative PCR amplification is as follows: activation at 94℃ for 15 min; denaturation at 94℃ for 20 sec, annealing at 61-55℃ for 60 sec, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 94℃ for 20 sec, annealing at 55℃ for 60 sec, for 26 cycles.

[0014] Optionally, the fluorescence quantitative PCR amplification system is as follows: 2 μL of 25 ng / μL DNA template; 5 μL of 2×KASP Mastermix; 0.14 μL of KASP mixed primers and 2.86 μL of water; The KASP mixed primers were obtained by mixing 10 μM upstream primer F1, 10 μM upstream primer F2, and 10 μM downstream primer R in a volume ratio of 2:2:5.

[0015] The present invention discloses the following technical effects: This invention identifies an SNP locus located on the A05 chromosome of rapeseed that co-segregates with genes for rapeseed branching angle and plant height. At the same time, it develops a rapid and efficient KASP primer set that can be used for molecular-assisted breeding of rapeseed branching angle and plant height. This KASP primer set has important value in rapeseed plant type breeding.

[0016] The KASP primer set provided by this invention can directly and specifically distinguish and detect the A or G bases at SNP variant sites. The application method of the KASP primer set provided by this invention is accurate, reliable, and easy to operate. In terms of both detection throughput and accuracy, it is superior to markers such as SSR, CAPS, or SCAR, and is suitable for identifying rapeseed branching angles and for marker-assisted selection breeding. In practical applications, the KASP primer set provided by this invention features low cost and high throughput, as well as high specificity, making it particularly suitable for screening and identifying rapeseed resources with short, loose plant types. This invention provides an efficient and accurate molecular marker-assisted selection tool for breeding ideal rapeseed plant types and selecting high-yielding new varieties, laying an important technical foundation for using this SNP site for targeted improvement of rapeseed plant type and identification of germplasm resources. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This represents the mature phenotype of both China's Double 11 and Ningbo MT5. Figure 2 The image shows the sequencing localization results of the F2 segregating population constructed based on Zhongshuang 11 and Ning MT5. Among them, A is the ΔSNP-index map of the whole genome, B is the ΔSNP-index map of chromosome A05, and C is the resequencing genotyping of SNPs corresponding to KASP markers in Zhongshuang 11, Ning MT5, and the two extreme pools. Figure 3 Genotyping diagrams of different oilseed plants using KASP primer pairs; where the blue signal is consistent with the Zhongshuang 11 genotype (GG), which is a tall and compact genotype; the green signal is consistent with the Ning MT5 genotype (AA), which is a short and loose genotype; the red signal is consistent with the F1 genotype (AG), which is a heterozygous genotype; and the gray signal is consistent with the blank control, which is an indeterminate genotype. Figure 4 The image shows the results of plant height and branching angle measurements for different plant types (genotypes). Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0025] The “Ning MT5” mentioned in the following examples is a rapeseed mutant variety, published in the “Bulletin on the Protection of New Varieties of Agricultural Plants” (Issue 5, 2026), and is currently held by the Jiangsu Academy of Agricultural Sciences, which is available to the public. “Zhongshuang 11” is a conventional rapeseed variety, approved by the state (National Approval Oil No. 2008030), and is available to the public through regular channels. The F2 segregating population constructed from “Ning MT5” and “Zhongshuang 11” was provided by the Jiangsu Academy of Agricultural Sciences.

[0026] Example 1: Obtaining Single Nucleotide Mutation Sites (SNPs) from Co-separated Branch Angles in Rapeseed 1. Experimental materials: The F2 segregating population, consisting of 727 individual plants, was constructed from “Ning MT5” and “Zhongshuang 11”.

[0027] 2. Rapeseed plant phenotyping (1) Determination of plant height: During the rapeseed maturity period, the plant height is the distance from the ground to the highest point of the main stem of the plant.

[0028] (2) Determining the branching angle: When the rapeseed matures, hold the camera so that the camera body is parallel to the plane formed by the branches and the main stem, and take a photo that includes the angle between the base of the branches and the main stem. Use Photoshop software to measure the angle formed by the branches and the main stem.

[0029] 3. High-throughput sequencing analysis of the rapeseed genome and acquisition of SNP sites (1) DNA extraction and high-throughput sequencing: Extremely short and loose single plants and tall and compact single plants were selected from the F2 segregating population. Flower buds were taken and mixed into two extreme pools. Genomic DNA of the parents and the mixed pools was extracted using the CTAB method. The parents were resequencing the whole genome at a coverage depth of 30×, and the two mixed pools were resequencing at 80×.

[0030] (2) Pooled Sequencing Analysis (BSA): Using BWA software, the sequencing files were aligned to the reference genome, and SNP calling analysis was performed using GATK. Based on the identified high-quality SNP information, QTL mapping was performed using QTLseqr software. A QTL BnDwf.A05.2 controlling the traits of dwarf and loose plant type was located in the 29.3-41.1 Mb region of chromosome A05. This region contains 233 SNPs, of which 41 fall within the gene exon region ( Figure 2 The peak of BnDwf.A05.2 is located in the range of 30.0-35.2 Mb. Within this range, there are 12 SNPs that fall within the gene exon region. Their |ΔSNP-index| values ​​are all >0.73. Among them, the SNP at 33,384,097 bp has a G-to-A substitution. The nucleotide sequence of this SNP is shown in SEQ ID NO.1.

[0031] SEQ ID NO.1: CCTTAACCAATGCAGCTCCGTAAGCTCCTCCGCCGCTATTTCCAGCCTTCTCGCTGCTGGCCTCCTCCTTGCCACTTGTCTTCTGCTGTGTGATGATGTTTTTCCTGTAGTTCCTCACAGGTGRCCATCCCACCACTTGGGCTCTACGTACAACGACATTTATTATATATGTACACATATCAATGTTATTACTAGATCTTTAATTTACTGTTATGGCTTGACTATAGATAAATGCTTTAATGTTTGCTTTTGCGATGAATAAATTGCTGTTTACGCATCAACCACGCTAAGTTGTTTCTTTTTTCTGTAGTGGTTTATATATAATATTGCTAACAAAAGTAACTTCAAA (The 124th bp of this sequence is an SNP site, indicating A / G polymorphism; R represents A / G).

[0032] Example 2: Development of KASP-labeled specific primers Using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / ), three primers were designed based on the sequence SEQ ID NO.1: upstream primer F1, upstream primer F2, and a universal downstream primer R. The 3' ends of upstream primers F1 and F2 are allelic variants, and their 5' ends are linked to specific FAM and HEX fluorescent linker sequences (underlined) from the KASP reagent from LGC (Laboratory of the Government Chemist), UK. The sequences are as follows: F1: 5'-gaaggtgaccaagttcatgctTCCTGTAGTTCCTCACAGGTGG-3' (SEQ ID NO. 2); F2: 5'-gaaggtcggagtcaacggattTTCCTGTAGTTCCTCACAGGTGA-3' (SEQ ID NO. 3); R: 5'-TTTTTGTTAGCAATATTATATATAAACCACTAC-3' (SEQ ID NO. 4).

[0033] Example 3: Detection of genotypes of extreme individual plants in a population and different rapeseed varieties at this SNP locus. 190 plants were randomly selected from the parents and the F2 segregating population. Genomic DNA was extracted from the selected plants, and the materials were amplified and genotyped using the KASP molecular marker primers of Example 2 on a real-time fluorescence quantitative PCR instrument.

[0034] The PCR amplification system consisted of: 2 μL of 25 ng / μL DNA template; 5 μL of 2×KASP Master mix; 0.14 μL of KASP mixed primers and 2.86 μL of water; wherein the volume ratio of upstream primer F1 (10 μM), upstream primer F2 (10 μM) and downstream primer R (10 μM) in the KASP mixed primers was 2:2:5.

[0035] The PCR reaction program was as follows: activation at 94℃ for 15 min; denaturation at 94℃ for 20 sec, annealing at 61-55℃ for 60 sec, decreasing the temperature by 0.6℃ for each cycle, for 10 cycles; denaturation at 94℃ for 20 sec, annealing at 55℃ for 60 sec, for 26 cycles.

[0036] After the reaction is complete, the ABI 7500 real-time quantitative PCR instrument directly reads the fluorescence data of the PCR reaction products. The fluorescence scan results are automatically converted into graphs, as shown in the figure. Figure 3 The results showed that the KASP molecular marker primers could clearly separate the three genotypes, and co-separated them with the branching angle and plant height phenotypes. Among them, the dots near the Y-axis were single plants carrying the A / A allelic variation, with 44 copies (one plant had no genotype detected), and the genotype was AA; the dots near the X-axis were single plants carrying the G / G allelic variation, with 94 copies (one plant had no genotype detected), and the genotype was GG; the dots on the diagonal line at approximately 45° on the coordinate axis were single plants carrying the A / G allelic variation, with 50 copies, and the genotype was AG; the gray dots near the origin of the coordinate axis were blank controls.

[0037] The phenotypes of plants with different genotypes were measured and statistically analyzed. The results are shown in Table 1 and 2. Figure 4 Plants with genotype AA were significantly shorter than those with genotypes GG and AG, with plants with genotype GG being the tallest. Plants with genotype AA had significantly larger branching angles than those with genotypes GG and AG, with plants with genotype GG having the smallest branching angle. Based on these results, plants with genotype AA were categorized as short-stemmed and loose, plants with genotype GG as tall and compact, and plants with genotype AG as semi-short-stemmed and semi-loose. The specific genotyping results for each type of plant are shown in Table 2.

[0038] Table 1. Phenotypic results of different genotypes Table 2 Genotyping Results The above results demonstrate that the KASP molecular marker primers developed based on the SNP locus of this invention can accurately identify the genotype of rapeseed at 33,384,097 bp on chromosome A05. When using these KASP molecular marker primers to determine the genotype of rapeseed, if the genotype is AA, it is identified as a short-stemmed, loosely planted rapeseed, characterized by short stature and large branching angles; if the genotype is GG, it is identified as a tall, compact rapeseed, characterized by tall stature and small branching angles. This invention provides an efficient and accurate molecular marker-assisted selection tool for breeding ideal rapeseed plant types and selecting high-yielding new varieties, laying an important technical foundation for targeted improvement of rapeseed plant type and identification of germplasm resources using this SNP locus.

[0039] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker related to branching angle and plant height in rapeseed, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; The nucleotide sequence shown in SEQ ID NO.1 has an A / G polymorphism at the 124th base, including AA, AG and GG genotypes.

2. The molecular marker according to claim 1, characterized in that, The branching angle of rapeseed with polymorphic site A is greater than that of rapeseed with polymorphic site G; Rapeseed plants with polymorphism A were shorter than those with polymorphism G.

3. The molecular marker according to claim 2, characterized in that, Rapeseed with genotype AA is short and loose; rapeseed with genotype GG is tall and compact; and rapeseed with genotype AG is semi-short and semi-loose.

4. The use of the molecular marker according to any one of claims 1-3 in any of the following: A1. Detecting the branching angle of rapeseed; A2. Detecting rapeseed plant height; A3. Early identification or screening of rapeseed varieties with superior plant type; A4. Improve rapeseed plant type; A5. Increase rapeseed yield.

5. A KASP primer combination for detecting the molecular marker according to any one of claims 1-3, characterized in that, It includes upstream primer F1 with nucleotide sequence as shown in SEQ ID NO.2, upstream primer F2 with nucleotide sequence as shown in SEQ ID NO.3, and downstream primer R with nucleotide sequence as shown in SEQ ID NO.

4.

6. A kit for detecting the molecular marker according to any one of claims 1-3, characterized in that, It includes the KASP primer combination as described in claim 5.

7. The use of the KASP primer combination of claim 5 or the kit of claim 6 in any of the following: B1. Detection of the molecular marker according to any one of claims 1-3; B2. Detecting the branching angle of rapeseed; B3. Detect rapeseed plant height; B4. Early identification or screening of rapeseed varieties with superior plant type; B5. Molecular marker-assisted breeding of superior rapeseed plant architecture; B6. Increase rapeseed yield.

8. A method for identifying the branching angle and plant height of rapeseed, characterized in that, Includes the following steps: Using the genomic DNA of the rapeseed sample to be tested as a template, the template is amplified by real-time quantitative PCR using the KASP primer combination described in claim 5 or the kit described in claim 6. After the PCR amplification is completed, the fluorescence signal is read, the converted fluorescence signal is analyzed, the genotype is identified, and the branching angle and plant height of rapeseed are determined based on the genotype. The branching angle of rapeseed with genotype AA is greater than that of rapeseed with genotype GG and genotype AG; the branching angle of rapeseed with genotype GG is smaller than that of rapeseed with genotype AG. Rapeseed with genotype AA was shorter than rapeseed with genotypes GG and AG; rapeseed with genotype GG was taller than rapeseed with genotype AG.

9. The method according to claim 8, characterized in that, The procedure for quantitative real-time PCR amplification is as follows: activation at 94℃ for 15 min; denaturation at 94℃ for 20 sec, annealing at 61-55℃ for 60 sec, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 94℃ for 20 sec, annealing at 55℃ for 60 sec, for 26 cycles.

10. The method according to claim 8, characterized in that, The quantitative PCR amplification system consisted of: 2 μL of 25 ng / μL DNA template; 5 μL of 2×KASP Master mix; 0.14 μL of KASP mixed primers; and 2.86 μL of water. The KASP mixed primers were obtained by mixing 10 μM upstream primer F1, 10 μM upstream primer F2, and 10 μM downstream primer R in a volume ratio of 2:2:5.

Images