A method for trace detection of Epstein-Barr virus

Abstract

The present application relates to a kind of trace detection methods of Epstein-Barr virus (EBV), belong to medical detection technical field.The present application provides a kind of EBV trace detection kit, including single-atom biomimetic nano-enzyme, Fe3O4 Magnetic bead and RPA isothermal amplification primer pair;The single-atom biomimetic nano-enzyme surface is equipped with digoxin antibody;Fe3O4 Magnetic bead surface is modified with streptavidin;The 5' end of the RPA isothermal amplification primer pair is modified with digoxin and / or biotin.The present application is single-atom biomimetic nano-enzyme as detection system, Fe3O4 Magnetic bead as capture system combines RPA isothermal amplification technology and carries out trace detection to EBV, and RPA isothermal amplification product is obtained, the product can be captured and enriched by Fe3O4 Magnetic bead while specifically combined with single-atom biomimetic nano-enzyme to form complex, add luminescent substrate can quickly detect the EBV concentration in sample, with the advantages of high specificity, high sensitivity, rapid detection.

Description

Technical Field

[0001] This invention relates to the field of medical testing technology, and in particular to a method for detecting trace amounts of EBV. Background Technology

[0002] Human herpesvirus type 4 (Epstein-Barr virus, EBV) is a herpesvirus that is tropistic towards human B lymphocytes. As an important tumor-associated virus, EBV is associated with the development of various human cancers, such as Burkitt lymphoma, Hodgkin's lymphoma, natural killer cell lymphoma, nasopharyngeal carcinoma, and some types of gastric cancer. Besides tumors, EBV infection can also cause various non-malignant lymphoproliferative disorders and autoimmune diseases. It is mainly transmitted through saliva and droplets, but can also be transmitted through blood transfusions. In the acute infection phase, EBV initially infects the squamous epithelial cells of the oropharynx, and then persists in B lymphocytes in a latent infection state. Under the stimulation of certain external factors, the latent infection state of the virus is disrupted, and the virus enters the lysis and replication cycle. During this process, the viral gene expresses a large number of viral products, promoting viral dissemination in host cells and causing host immune system disorders.

[0003] Early detection of EBV infection is crucial for the prevention and treatment of many serious diseases. Currently, the main clinical technique for detecting EBV nucleic acid is quantitative real-time PCR (qPCR), which typically has a detection sensitivity of 10. 2 -10 4 Copies / mL. Furthermore, qPCR requires specialized thermal cycling equipment and demands a high level of technical skill from the testing personnel. Therefore, developing a highly sensitive and easy-to-use nucleic acid detection system is of great research significance for the prevention and control of viruses such as EBV. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a highly sensitive method for detecting trace amounts of EBV.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides an EBV trace detection kit, comprising a single-atom biomimetic nanozyme, Fe3O4 magnetic beads and RPA isothermal amplification primer pair; The surface of the single-atom biomimetic nanoenzyme is coated with digoxigenin antibody. The Fe3O4 magnetic beads are surface-modified with streptavidin; The 5' end of the RPA isothermal amplification primer pair is modified with digoxigenin and / or biotin.

[0006] This invention utilizes a single-atom biomimetic nanozyme as the detection system and Fe3O4 magnetic beads as the capture system, combined with RPA isothermal amplification technology for trace detection of EBV. The RPA isothermal amplification primers target the EBV virus, amplifying trace EBV nucleic acid into an EBV product containing digoxigenin and biotin. This product can be captured and enriched by the Fe3O4 magnetic beads while specifically binding to the single-atom biomimetic nanozyme, forming a complex of single-atom biomimetic nanozyme-EBV product-Fe3O4 magnetic beads. Adding a luminescent substrate and reacting it with the single-atom biomimetic nanozyme allows for rapid detection of EBV concentration in the target sample. The EBV trace detection reagent obtained by this invention has the advantages of high specificity, high sensitivity, and rapid detection.

[0007] As a preferred embodiment of the EBV trace detection kit of the present invention, the single-atom biomimetic nanozyme is mainly composed of a metal-organic framework loaded with metal porphyrin ligands.

[0008] Nanozymes are a novel class of artificially induced enzymes possessing enzymatic catalytic properties. They catalyze enzyme substrates to produce reaction products similar to those of natural enzymes, following similar enzymatic reaction kinetics. They can serve as substitutes for natural enzymes in disease diagnosis and treatment. Since their initial report in 2007, over 300 laboratories in 29 countries worldwide have reported more than 500 nanozymes, gradually forming a new field of nanozyme research internationally. Due to their excellent peroxidase-like activity, nanozymes can efficiently catalyze chromogenic reagents (3,3',5,5'-tetramethylbenzidine, TMB) and chemiluminescent reagents (luminol) to produce colored substances and light radiation, enhancing detection sensitivity. Based on this, this invention selects a single-atom biomimetic nanozyme as the detection system. It binds with nucleic acid products containing digoxigenin, enabling rapid detection of EBV in samples using chemiluminescent or chromogenic reagents, thus achieving convenient and rapid EBV detection.

[0009] In a preferred embodiment of the EBV trace detection kit of the present invention, the metalloporphyrin includes at least one of iron porphyrin, magnesium porphyrin, cobalt porphyrin, manganese porphyrin, and zinc porphyrin.

[0010] In a preferred embodiment of the EBV trace detection kit of the present invention, the metalloporphyrin is iron porphyrin.

[0011] In a preferred embodiment of the EBV trace detection kit of the present invention, the metal atom of the single-atom biomimetic nanozyme is axially coordinated with histidine. Based on the structure-activity relationship of the active site of natural horseradish peroxidase (HRP), the inventors introduced histidine along the axial direction of the metal atom of the metal porphyrin, achieving true biomimicry of the HRP active site. This axial coordination plays a crucial role in stabilizing the electronic structure of the active site. Furthermore, it lowers the free energy of the peroxidase-like nanozyme's binding to the substrate H2O2, thereby promoting the smooth progress of the catalytic reaction, and the structure and activity remain unchanged after 60 days of storage at room temperature.

[0012] In a preferred embodiment of the EBV trace detection kit of the present invention, the mass percentage of metal atoms in the single-atom biomimetic nanozyme is 3-5 wt%. Preferably, the mass percentage of metal atoms may also be at least one of 3.5 wt%, 4 wt%, and 4.5 wt%.

[0013] In a preferred embodiment of the EBV trace detection kit of the present invention, the metal-organic framework is a two-dimensional metal-organic framework.

[0014] In a preferred embodiment of the EBV trace detection kit of the present invention, the metal ion in the metal-organic framework is a zinc ion.

[0015] As a preferred embodiment of the EBV trace detection kit of the present invention, the mass percentage of digoxigenin antibody in the single-atom biomimetic nanozyme is 0.2-0.5 wt%, and the mass percentage of streptavidin on the surface of the Fe3O4 magnetic beads is 0.5-1.5 wt%.

[0016] As a preferred embodiment of the EBV trace detection kit of the present invention, the nucleotide sequence of the RPA isothermal amplification primer pair is shown in SEQ ID NO.1-2.

[0017] As a preferred embodiment of the EBV trace detection kit of the present invention, the RPA isothermal amplification primer pair includes an upstream primer and a downstream primer, wherein the 5' end of the upstream primer is modified with digoxigenin and the 5' end of the downstream primer is modified with biotin.

[0018] As a preferred embodiment of the EBV trace detection kit of the present invention, the EBV trace detection kit further includes at least one of a luminescent substrate, a chromogenic substrate, and an RPA amplification system.

[0019] As a preferred embodiment of the EBV trace detection kit of the present invention, the luminescent substrate includes, but is not limited to, at least one of basic luminol and its derivatives, p-hydroxyphenylacetic acid, and 10-acetyl-3,7-dihydroxyphenoxazine.

[0020] In a preferred embodiment of the EBV trace detection kit of the present invention, the luminescent substrate is basic luminol.

[0021] Secondly, the present invention provides a method for preparing the above-mentioned EBV trace detection kit, comprising the following steps: (1) Mix metal salt, precursor ligand and regulator and react them, then add metal porphyrin ligand to react and obtain single-atom biomimetic nanozyme; A single-atom biomimetic nanozyme was reacted with hyaluronic acid activated by N-hydroxysuccinimide, and then digoxigenin antibody was added to obtain a single-atom biomimetic nanozyme with digoxigenin antibody modified on the surface. (2) Fe3O4 magnetic beads activated with glutaraldehyde were mixed with streptavidin solution and reacted, then sealed to obtain Fe3O4 magnetic beads with streptavidin surface modified. (3) Insert digoxigenin and / or biotin into the 5' end of the RPA isothermal amplification primer pair to obtain an RPA isothermal amplification primer pair with digoxigenin and / or biotin at the 5' end.

[0022] As a preferred embodiment of the preparation method of the present invention, in step (1), when the metal atom of the metal porphyrin is axially coordinated with histidine, the following operation is included: mixing the metal porphyrin with histidine to undergo a coordination reaction and obtain the metal porphyrin with histidine axial coordination.

[0023] As a preferred embodiment of the preparation method described in this invention, the molar ratio of metalporphyrin to histidine is metalporphyrin:histidine = 1:(0.5-1.5).

[0024] In a preferred embodiment of the preparation method described in this invention, the molar ratio of metalloporphyrin to histidine is metalloporphyrin:histidine = 1:1.

[0025] As a preferred embodiment of the preparation method described in this invention, the coordination reaction is carried out under nitrogen protection and stirring at 75-85°C for 9-10 h, followed by the addition of 0.1 M hydrochloric acid aqueous solution until no precipitate is formed, followed by filtration to obtain histidine-coordinated metalloporphyrin.

[0026] As a preferred embodiment of the preparation method described in this invention, the specific operation of the coordination reaction is as follows: under nitrogen protection, the reaction is stirred at 80°C for 10 h, 0.1 M hydrochloric acid aqueous solution is added until no precipitate is produced, and the mixture is filtered to obtain histidine-coordinated metalloporphyrin.

[0027] As a preferred embodiment of the preparation method described in this invention, in step (1), the mass ratio of the metal porphyrin ligand, metal salt, precursor ligand and regulator is metal porphyrin ligand: metal salt: precursor ligand: regulator = (1.5-3.5): (2-4): 1: (9-11).

[0028] As a preferred embodiment of the preparation method of the present invention, in step (1), the mass ratio of the metal porphyrin ligand, metal salt, precursor ligand and regulator is metal porphyrin ligand: metal salt: organic ligand: regulator = 2.5:3:1:10.

[0029] As a preferred embodiment of the preparation method of the present invention, in step (1), the precursor ligand includes at least one of pyrazine and 4,4'-bipyridine.

[0030] In a preferred embodiment of the preparation method of the present invention, in step (1), the regulator includes polyvinylpyrrolidone.

[0031] As a preferred embodiment of the preparation method of the present invention, in step (1), the specific operation of the reaction is as follows: react at 90 °C for 5 h, centrifuge, wash, and obtain single-atom biomimetic nanozyme.

[0032] As a preferred embodiment of the preparation method of the present invention, in step (2), the reaction conditions are 12 h at 23-27 °C.

[0033] As a preferred embodiment of the preparation method of the present invention, in step (2), the specific operation of the sealing is as follows: add 1v / v% bovine serum albumin borate solution, seal at 23-27 ℃ for 1 h, wash, and obtain Fe3O4 magnetic beads with streptavidin modified on the surface.

[0034] Thirdly, the present invention provides a method for using the above-mentioned EBV trace detection kit, comprising the following steps: S1. Take the sample to be tested and perform RPA isothermal amplification reaction to obtain RPA reaction products; S2. Add single-atom biomimetic nanozyme and Fe3O4 magnetic beads to the RPA reaction product obtained in step S1 and react. After the reaction is completed, wash by ultrasonic and magnetic adsorption separation to obtain single-atom biomimetic nanozyme-RPA reaction product-Fe3O4 magnetic bead complex. S3. Mix the single-atom biomimetic nanozyme-RPA reaction product-Fe3O4 magnetic bead complex obtained in step S2 with the luminescent substrate, detect the luminescence value, compare the luminescence value or the luminescence of the sample with the blank control to determine the EBV concentration in the sample to be tested, and deduce the EBV copy number of the sample to be tested based on the standard curve.

[0035] Fourthly, the present invention provides the application of the above-mentioned EBV trace detection kit in EBV detection.

[0036] Fifthly, the present invention provides a method for detecting trace amounts of EBV, comprising the following steps: S1. Take the sample to be tested and perform RPA isothermal amplification reaction to obtain RPA reaction products; S2. Add single-atom biomimetic nanozyme and Fe3O4 magnetic beads to the RPA reaction product obtained in step S1 and react. After the reaction is completed, wash by ultrasonic and magnetic adsorption separation to obtain single-atom biomimetic nanozyme-RPA reaction product-Fe3O4 magnetic bead complex. S3. Mix the single-atom biomimetic nanozyme-RPA reaction product-Fe3O4 magnetic bead complex obtained in step S2 with the luminescent substrate, detect the luminescence value, compare the luminescence value or the luminescence of the sample with the blank control to determine the EBV concentration in the sample to be tested, and deduce the EBV copy number of the sample to be tested based on the standard curve.

[0037] This invention utilizes isothermal RPA amplification to amplify EBV in test samples, simplifying the detection process and shortening the detection time. The streptavidin on Fe3O4 magnetic beads specifically binds to the biotin label of the RPA reaction product, and strong magnetic adsorption enables the capture and enrichment of the RPA reaction product. A single-atom biomimetic nanozyme carrying digoxigenin antibody specifically binds to the digoxigenin in the RPA reaction product, amplifying the signal of the RPA reaction product in the presence of a luminescent substrate. The luminescence can be detected using imaging equipment or a chemiluminescence analyzer, enabling qualitative and preliminary quantitative detection of EBV. Furthermore, the EBV copy number in the test sample can be deduced based on the established standard curve for trace detection. This invention organically combines RPA isothermal amplification, single-atom biomimetic nanozyme, and Fe3O4 magnetic beads into a complete EBV trace detection method, enabling rapid, convenient, and accurate detection of EBV and its copy number in samples.

[0038] As a preferred embodiment of the EBV trace detection method of the present invention, in step S1, the RPA isothermal amplification reaction system can be prepared according to the instructions of the RPA kit.

[0039] As a preferred embodiment of the EBV trace detection method of the present invention, in step S1, the RPA isothermal amplification reaction includes the following operations: mixing primers, test sample, RPA buffer and initiator, and reacting at 38-40 °C for 18-22 min.

[0040] In a preferred embodiment of the EBV trace detection method of the present invention, the RPA buffer contains recombinase and DNA polymerase.

[0041] As a preferred embodiment of the EBV trace detection method of the present invention, in step S2, the ratio of RPA reaction product, single-atom biomimetic nanozyme and Fe3O4 magnetic beads is RPA reaction product: single-atom biomimetic nanozyme: Fe3O4 magnetic beads = 50 μL: (2.5-5) mg: (1.5-4) mg.

[0042] As a preferred embodiment of the EBV trace detection method of the present invention, in step S2, the ratio of the RPA reaction product, the single-atom biomimetic nanozyme and the Fe3O4 magnetic beads is RPA reaction product: single-atom biomimetic nanozyme: Fe3O4 magnetic beads = 50 μL: 3 mg: 2 mg.

[0043] As a preferred embodiment of the EBV trace detection method of the present invention, in step S2, the reaction conditions are: incubation at 23-27 °C for 5 min.

[0044] In a preferred embodiment of the EBV trace detection method of the present invention, in step S2, the washing is performed 2-3 times, and the washing reagent is sodium chloride solution and / or water.

[0045] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention uses a single-atom biomimetic nanozyme as the detection system and Fe3O4 magnetic beads as the capture system, combined with RPA isothermal amplification technology, to detect trace amounts of EBV. The RPA isothermal amplification primers target the EBV virus, amplifying trace EBV nucleic acid into an EBV product containing digoxigenin and biotin. This product can be captured and enriched by Fe3O4 magnetic beads and specifically binds to the single-atom biomimetic nanozyme, forming a complex of single-atom biomimetic nanozyme-EBV product-Fe3O4 magnetic beads. By adding a luminescent substrate and reacting it with the single-atom biomimetic nanozyme, the concentration of EBV in the target sample can be rapidly detected. The EBV trace detection reagent obtained by this invention has the advantages of high specificity, high sensitivity, and rapid detection.

[0046] (2) This invention utilizes RPA isothermal amplification to amplify EBV in the test sample, simplifying the detection process and shortening the detection time. The streptavidin on Fe3O4 magnetic beads specifically binds to the biotin label of the RPA reaction product, and then strong magnetic adsorption is used to capture and enrich the RPA reaction product. A single-atom biomimetic nanozyme carrying digoxigenin antibody specifically binds to the digoxigenin in the RPA reaction product, amplifying the signal of the RPA reaction product in the presence of a luminescent substrate. The luminescence can be detected using a camera or chemiluminescence analyzer, enabling qualitative and preliminary quantitative detection of EBV. Simultaneously, the EBV copy number in the test sample can be deduced based on the established standard curve for trace detection. This invention organically combines RPA isothermal amplification, single-atom biomimetic nanozyme, and Fe3O4 magnetic beads into a complete method for trace detection of EBV, enabling rapid, convenient, and accurate detection of EBV and its copy number in samples. Attached Figure Description

[0047] Figure 1 This is a flowchart illustrating the preparation process of the single-atom biomimetic nanozyme MFePH in Example 1 of the present invention; Figure 2 The images shown are scanning electron microscope (SEM) image (A), transmission electron microscope (TEM) image (B), high-resolution transmission electron microscope (TEM) image (C), and atomic force microscope (AFM) image (D) of MFePH in Embodiment 1 of the present invention. Figure 3 The energy spectrum of MFePH in Example 1 of this invention; Figure 4 The image shows a spherical aberration electron microscope image and a magnified partial image of MFePH in Embodiment 1 of the present invention. Figure 5 The results of chemiluminescence catalytic activity detection of different single-atom biomimetic nanozymes in Example 1 of the present invention are shown. A is the result of MFeP catalytic activity detection, B is the result of MFePH catalytic activity detection, C is the result of HRP catalytic activity detection, and D is the result of comparison of catalytic activity of different reagents. Figure 6 The effect of different catalytic conditions on the catalytic activity of MFePH in Example 1 of the present invention is shown. The evaluation index of A is pH value, the evaluation index of B is temperature, the evaluation index of C is MFePH concentration, the evaluation index of D is luminol concentration, and E is hydrogen peroxide concentration. Figure 7 This is an example of the effect of different storage times on the particle size distribution of MFePH in Example 1 of the present invention, where A is the particle size distribution diagram after 0 days of storage, B is the particle size distribution diagram after 60 days of storage, and C is the catalytic activity detection results for different storage times. Figure 8The following are the characterization results of MFePH modified with digoxigenin antibody in Example 1 of the present invention, where A is the particle size distribution map and B is the zeta potential detection result; Figure 9 The image shows the agarose gel electrophoresis of the RPA reaction products in Example 2 of this invention. In the image, A is the electrophoresis diagram of the products obtained by RPA isothermal amplification reaction with different templates, and B is the electrophoresis diagram of the products obtained by RPA isothermal amplification reaction and ordinary PCR amplification reaction. Figure 10 This is a flowchart of the EBV trace detection method described in Embodiment 5 of the present invention; Figure 11 This is a fitted curve of EBV nucleic acid concentration and maximum detection luminescence value in Example 1 of the present invention. Detailed Implementation

[0048] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0049] The terms “comprising,” “including,” “having,” “containing,” or any other variations thereof, as used herein, are intended to cover a non-exclusive inclusion. For example, a composition, step, method, article, or apparatus that includes the listed elements is not necessarily limited to those elements, but may include other elements not expressly listed or elements inherent to such composition, step, method, article, or apparatus.

[0050] When a quantity, concentration, or other value or parameter is expressed as a range, a preferred range, or a range defined by a series of upper and lower preferred values, this should be understood as specifically disclosing all ranges formed by any pair of any upper or preferred value with any lower or preferred value, regardless of whether the range is disclosed individually. For example, when the range “1-5” is disclosed, the described range should be interpreted as including ranges “1-4”, “1-3”, “1-2”, “1-2 and 4-5”, “1-3 and 5”, etc. When numerical ranges are described herein, unless otherwise stated, the range is intended to include its endpoints and all integers and fractions within that range.

[0051] "Parts by mass" refers to the basic unit of measurement that expresses the mass ratio of multiple components. One part can represent any unit mass, such as 1g or 3.1456g. If we say that component A has "a" parts by mass and component B has "b" parts by mass, it means the ratio of the mass of component A to the mass of component B is a:b. Alternatively, it can mean that the mass of component A is aK and the mass of component B is bK (where K is any number representing a multiplier). It is important to understand that, unlike parts by mass, the sum of the mass parts of all components is not limited to 100 parts.

[0052] "And / or" is used to indicate that one or both of the described situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0053] Unless otherwise specified, all other materials and reagents used in the examples, comparative examples, and effect examples are commercially available.

[0054] The reagents used below are described below: The metalloporphyrin is tetraphenylcarboxylated iron porphyrin (TCPP-Fe), CAS number 55266-17-6.

[0055] Histidine is L-histidine, and its CAS number is 71-00-1.

[0056] The metal salt used in the preparation of the metal-organic framework is zinc nitrate hexahydrate, CAS number 10196-18-6.

[0057] The precursor ligand used in the preparation of the metal-organic framework is pyrazine, CAS number 290-37-9.

[0058] The modifier used in the preparation of the metal-organic framework is polyvinylpyrrolidone (PVP), with an average molecular weight of 8000 and CAS number 9003-39-8.

[0059] The N-hydroxysuccinimide-activated hyaluronic acid was purchased from Xi'an Ruixi Biotechnology Co., Ltd., with an average molecular weight of 5000 and catalog number R-HF-011.

[0060] The digoxin antibody was purchased from Xiamen Tongrenxin Biotechnology Co., Ltd., product number XJ25.

[0061] Fe3O4 magnetic beads can be obtained commercially or prepared at home. One preparation method is provided here: Weigh out FeCl3·6H2O (1.35 g, 5 mmol) + FeCl2·4H2O (0.50 g, 2.5 mmol), i.e., the molar ratio Fe³⁺:Fe²⁺ = 2:1, dissolve them in 20 mL of deoxygenated deionized water (by passing N2 through it to remove O2), and stir until a transparent brownish-red solution is obtained; weigh out NaOH (2.4 g) or ammonia water (10 mL, 25 v / v%) and dissolve it in 10 mL of deoxygenated deionized water; The mixture was transferred to a polytetrafluoroethylene (PTFE) liner in a reactor, with a filling density ≤80%. The reactor was sealed and placed in an oven at 180±5 ℃ for 10–12 h. The temperature program was set from 25 ℃ to 180 ℃ (heating rate 2 ℃ / min) to prevent bumping. After the reaction, the oven was allowed to cool naturally to room temperature (25±2 ℃). The black precipitate was removed and separated from the supernatant using a magnet. The product was then ultrasonically washed three times (10 min each time) alternately with deionized water and ethanol to remove impurities, and then vacuum dried at 60 ℃ for 12 h to obtain black Fe3O4 powder, which is the Fe3O4 magnetic bead.

[0062] Glutaraldehyde-activated Fe3O4 magnetic beads can be obtained commercially or prepared in-house. One method for glutaraldehyde activation is provided here: 100 mg of Fe3O4 magnetic beads are dispersed in 50 mL of ethanol, and 1 mL of γ-aminopropyltriethoxysilane (APTES, CAS No. 919-30-2) is added. The mixture is refluxed at 80 °C for 6 h to obtain aminated Fe3O4 magnetic beads. 100 mg of aminated Fe3O4 magnetic beads are dispersed in 20 mL of borate buffer (pH=8.5), and 5 mL of 2.5 v / v% glutaraldehyde solution is added. The mixture is shaken at room temperature (25±2 °C) for 2 h. Excess glutaraldehyde is removed by strong magnetic separation, and the beads are washed three times with PBS (pH=7.4) to obtain glutaraldehyde-activated Fe3O4 magnetic beads.

[0063] Streptomycin was purchased from Beyotime Biotechnology Co., Ltd., product number P5084.

[0064] Fe3O4 magnetic beads modified with streptavidin can be obtained commercially or prepared in-house. One preparation method is provided here: 10 mg of streptavidin is dissolved in 10 mL of PBS (pH=7.4). Glutaraldehyde-activated Fe3O4 magnetic beads are added to the streptavidin solution and reacted with shaking at room temperature (25±2℃) for 12 h. Then, 1 v / v% bovine serum albumin solution (borate buffer) is added, and the mixture is blocked at room temperature (25±2℃) for 1 h to reduce non-specific adsorption. The mixture is washed three times with PBS buffer to remove free streptavidin, yielding streptavidin-modified Fe3O4 magnetic beads. The streptavidin-modified Fe3O4 magnetic beads are then processed according to step 2.1 of Example 1 to detect their catalytic activity in luminol chemiluminescence. Fe3O4 magnetic beads that do not exhibit catalytic activity in luminol chemiluminescence (denoted as SA-Fe3O4 magnetic beads) are selected as components of the EB virus trace detection reagent described in this invention.

[0065] The RPA primer pairs were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0066] The RPA isothermal amplification reaction can be performed according to the instructions of a commercially available RPA kit, or the reagents required for the RPA reaction can be purchased separately and prepared into an RPA reaction system. The RPA kit used below is brand name TwistAmp Basic kit, purchased from Beijing Libo Taiye Technology Co., Ltd., catalog number TABAS03KIT.

[0067] Nucleic acid in the sample can be extracted according to the instructions of commercially available products using nucleic acid extraction solutions or nucleic acid extraction kits. This invention does not impose specific limitations. Commercially available nucleic acid extraction solutions include, but are not limited to, RoomTemp SampleLysis Kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number P073-01); nucleic acid extraction kits include, but are not limited to, FastPure Cell / Tissue DNA Isolation Mini Kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number DC102-01).

[0068] Example 1 To improve the catalytic chemiluminescence activity of single-atom biomimetic nanozymes, a single-atom biomimetic nanozyme with catalytic activity close to that of HRP was synthesized using iron porphyrin as a precursor. The synthesis process is as follows: Figure 1 The specific synthesis steps are as follows: 0.1 mmol TCPP-Fe was dissolved in 5 mL of N,N-dimethylformamide (DMF) solution to prepare a 0.02 M TCPP-Fe solution. Under ultrasonic conditions, 0.1 mmol histidine was added, and the mixture was heated to 80 °C under nitrogen protection and stirred for 10 h. After the reaction was completed, 0.1 M hydrochloric acid aqueous solution was added dropwise until no precipitate was formed. The solution was filtered to obtain histidine-coordinated iron porphyrin FePH. 6.0 mg Zn(NO3)2·6H2O (0.02 mmol), 2 mg pyrazine (0.025 mmol), and 20 mg PVP were dissolved in 20 mL of DMF-ethanol mixture (DMF:ethanol = 3:1, volume ratio). The mixture was sonicated for 30 min and reacted at 90 °C for 5 min. Then, 5 mg of the obtained FePH (0.005 mmol) was added, and the mixture was reacted at 90 °C for 5 h. After cooling to 25±2 °C, the precipitate was obtained by centrifugation. The precipitate was washed three times with DMF and ethanol respectively, soaked in ethanol for 1-2 days, centrifuged, dispersed in pure water, freeze-dried, weighed, and diluted with double-distilled water to the appropriate concentration. The precipitate was then sonicated to obtain the single-atom biomimetic nanozyme MFePH. Simultaneously, following the same method, the FePH was replaced with iron porphyrin FeP without histidine axial coordination (same amount), and the single-atom biomimetic nanozyme MFeP was prepared.

[0069] 4 mg of the obtained MFePH and 2 mg of N-hydroxysuccinimide-activated hyaluronic acid were dissolved in 2 mL of pure water and reacted at 25±2℃ for 2 h. Then, 0.06 mg of digoxigenin antibody was added, and the reaction was continued at 25±2℃ for 1 h. After the reaction was completed, the precipitate was obtained by centrifugation. The precipitate was washed three times with pure water and freeze-dried to obtain the digoxigenin antibody-modified single-atom biomimetic nanozyme.

[0070] 1. Characterization of the obtained MFePH: The morphology and structure of the obtained MFePH were observed by scanning electron microscopy, transmission electron microscopy (including aberration-corrected transmission electron microscopy), and atomic force microscopy. The elemental distribution of MFePH was analyzed by energy dispersive spectroscopy (EDS) of the scanning electron microscope. The results are shown in [Figure number missing]. Figure 2-4 .

[0071] like Figure 2 As shown, MFePH has a sheet-like structure with a diameter of approximately 100 nm and is relatively uniform in size. (Atomic force microscopy image) Figure 2 D) shows that the thickness of MFePH is relatively uniform, with a maximum thickness of about 5 nm.

[0072] like Figure 3-4 As shown, the energy spectrum of MFePH ( Figure 3 The image shows that C, N, O, Fe, and Zn elements are uniformly distributed on MFePH; aberration-corrected electron micrograph and magnified partial image ( Figure 4 The data shows that Fe is uniformly distributed on MFePH in the form of isolated single atoms. These data indicate that the present invention has successfully synthesized MFePH single-atom biomimetic nanozymes.

[0073] 2. The chemiluminescent catalytic activity of MFePH was determined.

[0074] 2.1 Weigh the prepared MFePH or MFeP and dissolve it in double-distilled water to a concentration of 1 μg / mL. Sonicate the solution in an ice bath for 10 min to ensure complete dispersion of MFePH or MFeP in the aqueous solution. Then, perform a chemiluminescence activity test using the following system: 5 mL of MFePH or MFeP solution, with the chemiluminescent luminol solution adjusted to pH 9.0 using hydrochloric acid and sodium hydroxide. Before use, add 1 / 10 of the luminol solution volume to a 30 v / v% H2O2 aqueous solution to achieve a final luminol concentration of 1 mM. Mix and use immediately. Set the microplate reader to 428 nm (the chemiluminescence detection wavelength for luminol), the measurement time to 300 s, and the number of readings to 30. Add 1 μL of MFePH or MFeP solution to the bottom of a white opaque microplate. Then add 99 μL of alkaline luminol solution pre-equilibrated at 37 °C to the microplate. Simultaneously, add 100 μL of alkaline luminol solution to each well as a reagent blank. Wells without any reagents are used as blank correction wells. Immediately run the program to obtain the absorbance values. Divide the absorbance values ​​of the experimental group by the corresponding absorbance values ​​of the blank wells to obtain the final nanozyme luminescence intensity. The same concentration of HRP enzyme was used as a control group for the same experiment. The results are shown in the table below. Figure 5 .

[0075] like Figure 5 As shown, the catalytic chemiluminescence activity of MFePH with histidine axial coordination is about 1 times higher than that of MFeP nanozyme without histidine coordination, and the maximum luminescence intensity of MFePH is close to that of HRP.

[0076] 2.2 The effects of pH (8, 9, 10, 11, 12), temperature (4℃, 25℃, 37℃, 45℃, 60℃), MFePH concentration (5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL), luminol concentration (0.1 mM, 0.2 mM, 0.5 mM, 1 mM, 1.5 mM, 2 mM, 2.5 mM), and H2O2 concentration (0.1 mM, 0.2 mM, 0.5 mM, 1 mM, 2 mM, 5 mM, 10 mM) on MFePH activity were investigated according to step 2.1. The results are shown in [Figure 1]. Figure 6 .

[0077] like Figure 6 As shown in Figure A, the optimal pH for both MFePH and HRP catalytic reactions is 9.0. Figure 6As shown in B, the optimal temperature for HRP to exhibit chemiluminescence activity is 37℃, and the temperature range for optimal activity is relatively narrow. At 4℃ or 60℃, its catalytic activity drops sharply. In contrast, MFePH exhibits stable chemiluminescence activity over a wider temperature range (4-60℃), suggesting that it can be used in more detection scenarios.

[0078] like Figure 6 As shown in Figure C, when different concentrations of MFePH are added, the chemiluminescence intensity exhibits a near-linear relationship, demonstrating a strong dose-dependent effect. Figure 6 As shown in Figure D, the chemiluminescence intensity of MFePH was nearly linear when different concentrations of luminol were added. However, when the H2O2 concentration in the system was greater than 5 mM, the chemiluminescence intensity of MFePH no longer increased, indicating that the substrate H2O2 concentration had reached saturation. Figure 6 E), the above results together illustrate the interdependence between MFePH and the concentrations of luminol and H2O2 when MFePH exerts its chemiluminescent activity.

[0079] 2.3 The obtained MFePH was stored at room temperature (25±2℃) for 60 days. Its particle size distribution was evaluated using a particle size analyzer at storage days 0 and 60. The maximum luminescence intensity at different storage times was measured according to the method in step 2.1. The results are shown in [Figure 2.3]. Figure 7 .

[0080] like Figure 7 As shown, compared with storage day 0, the particle size increased only slightly after 60 days of storage, indicating good stability and dispersibility of the material structure. The maximum catalytic luminescence intensity of MFePH was measured at 0, 30, and 60 days of storage at room temperature, and remained essentially unchanged, demonstrating the high catalytic stability of MFePH, making it suitable as a molecular diagnostic reagent and allowing for long-term storage.

[0081] In summary, the single-atom biomimetic nanozyme MFePH obtained in this invention exhibits excellent chemiluminescent catalytic activity and stability.

[0082] 3. Characterization of digoxigenin antibody-modified MFePH: The particle size distribution and zeta potential of the digoxigenin antibody-modified MFePH were evaluated using a particle size analyzer, such as... Figure 8 As shown, after modification with digoxin antibody, the particle size and electronegativity of the complex increased, indicating that the digoxin antibody was successfully modified on the surface of MFePH.

[0083] Example 2 Specific RPA isothermal amplification primer pairs were designed for EB virus, as follows: A 131bp EBV nucleic acid sequence (SEQ ID NO.3) was selected from the NCBI database as a template. RPA isothermal amplification primers were designed for this template, and digoxigenin was modified at the 5' end of the forward primer and biotin was modified at the 5' end of the reverse primer. The sequences of the forward and reverse primers are shown below (5'-3'): Forward primer (SEQ ID NO.1): Digoxigenin-CTTGGAGACAGGCTTAACCAGACTCATGTC; Reverse primer (SEQ ID NO.2): Biotin-CCAGAGGTCCCCGGTCAGAATCTCGAGGGG.

[0084] EBV nucleic acid sequence (SEQ ID NO. 3): CTTGGAGACAGGCTTAACCAGACTCATGTCAAACCACGGTTTGTTCGGCAGGGGCCTCTGGCTGCGTTCTTGCCTCGCCTGCTTCCTTGTGCTCCTGCCGGCCCCTCGAGATTCTGACCGGGGACCTCTGG.

[0085] The above EBV nucleic acid sequence was synthesized into a DNA fragment. Using total DNA (or RNA) of human papillomavirus 16 (HPV16), SARS-CoV-2, Ebola virus, MERS-CoV, and Zika virus as templates, RPA isothermal amplification and / or conventional PCR amplification were performed with RPA isothermal amplification primer pairs, respectively. The system was prepared according to the kit instructions. The RPA isothermal amplification reaction conditions were: reaction in a 39 ℃ water bath for 4 min, followed by shaking, and then reaction in a 3 ℃ water bath for 16 min. After the reaction, the RPA reaction products were analyzed by agarose gel electrophoresis. The results are as follows: Figure 9 As shown, the designed primers specifically amplified the RPA reaction product within the approximately 100-250 bp range, which is close to the expected fragment size, while other viral nucleic acids showed no specific bands. This indicates that the RPA isothermal amplification primer pair designed in this invention can specifically bind to and amplify EBV DNA. Furthermore, the amplification efficiency of RPA isothermal amplification and conventional PCR systems for EBV nucleic acid templates showed no significant difference. These data demonstrate that this invention successfully designed primer pairs capable of specifically amplifying EBV DNA, and that the RPA amplification system is reliable.

[0086] Example 3 Example 3 provides an EBV trace detection kit, comprising MFePH and SA-Fe3O4 magnetic beads modified with digoxigenin antibody obtained in Example 1, and the RPA isothermal amplification primer pair obtained in Example 2.

[0087] Example 4 Example 4 provides an EBV trace detection kit, comprising MFePH modified with digoxigenin antibody obtained in Example 1, SA-Fe3O4 magnetic beads, RPA isothermal amplification primer pair obtained in Example 2, and chemiluminescent solution, wherein the chemiluminescent solution comprises luminol solution and H2O2 solution.

[0088] Example 5 Example 5 provides a method for detecting trace amounts of EBV, the entire detection process is as follows: Figure 10 As shown, it includes the following steps: S1. Take the sample to be tested and extract it using nucleic acid extraction solution or extraction kit to obtain nucleic acid sample. Use the nucleic acid sample as template and the RPA isothermal amplification primer pair obtained in Example 2 as primer. Prepare an RPA isothermal amplification reaction system with a total volume of 50 μL according to the kit instructions. The RPA isothermal amplification reaction conditions are: react in a 39℃ water bath for 4 min, take it out and shake it, and then place it in a 3℃ water bath for 16 min to obtain RPA reaction product. S2. Mix 50 µL of the RPA reaction product obtained in step S1, 50 µL of 0.6 mg / mL single-atom biomimetic nanozyme, and 50 µL of 4 mg / mL Fe3O4 magnetic beads to form a premix. Rinse the RPA reaction tube with 350 µL of buffer (50 mM Tris, 100 mM NaCl, pH 7.0), then add the rinsing solution to the premix and incubate at 25°C for 5 min. Wash the tube three times with buffer (50 mM Tris, 100 mM NaCl, pH 7.0) and twice with ultrapure water by ultrasonic mixing and strong magnetic adsorption separation to finally obtain the single-atom biomimetic nanozyme-RPA reaction product-Fe3O4 magnetic bead complex (MFePH-DNA-Fe3O4). S3. Disperse the MFePH-DNA-Fe3O4 obtained in step S2 with 250 μL of ultrapure water, transfer to a 96-well plate, separate by magnetic adsorption, aspirate the supernatant, add 200 μL of chemiluminescent solution (containing 1 mM luminol solution and 5 mM H2O2 solution, pH=9.0, freshly prepared and used immediately) to each well, mix quickly, and detect the maximum luminescence intensity at 428 nm using an ELISA reader. Compare the luminescence value or the luminescence of the sample with the blank control to determine the EBV concentration in the sample to be tested, and deduce the EBV copy number of the sample to be tested based on the standard curve.

[0089] Example 6 Example 6 provides a method for using an EBV trace detection kit, including the following steps: S1. Take the sample to be tested as a template, use the RPA isothermal amplification primer pair obtained in Example 2 as primers, and prepare an RPA isothermal amplification reaction system with a total volume of 50 μL according to the kit instructions. The RPA isothermal amplification reaction conditions are: react in a 39 ℃ water bath for 4 min, take it out and shake it, and then place it in a 3 ℃ water bath for 16 min to obtain the RPA reaction product. S2. The RPA reaction product obtained in step S1, 50 μL of 0.6 mg / mL single-atom biomimetic nanozyme, and 50 μL of 4 mg / mL Fe3O4 magnetic beads were mixed to form a premix. The RPA reaction tube was rinsed with 350 μL of Tris-HCl (pH=7.0) and 350 μL of NaCl buffer. The rinsed Tris-HCl and NaCl buffer were added to the premix, and the reaction was incubated at 25 °C for 5 min. The mixture was then washed with Tris-HCl (pH=7.0), NaCl buffer, and ultrapure water by ultrasonic mixing and strong magnetic adsorption separation. The Tris-HCl and NaCl buffer were washed 3 times each, and the ultrapure water was washed 2 times to obtain the single-atom biomimetic nanozyme-RPA reaction product-Fe3O4 magnetic bead complex (MFePH-DNA-Fe3O4). S3. Disperse the MFePH-DNA-Fe3O4 obtained in step S2 with 250 μL of ultrapure water, transfer to a 96-well plate, separate by magnetic adsorption, aspirate the supernatant, add 200 μL of chemiluminescent solution (containing 1 mM luminol solution and 5 mM H2O2 solution, pH=9.0, freshly prepared and used immediately) to each well, mix quickly, and detect the maximum luminescence intensity at 428 nm using an ELISA reader. Compare the luminescence value or the luminescence of the sample with the blank control to determine the EBV concentration in the sample to be tested, and deduce the EBV copy number of the sample to be tested based on the standard curve.

[0090] Example of effect 1 The sensitivity of the EBV trace detection method described in Example 5 was evaluated using the following specific method: Using the EBV nucleic acid sequence (SEQ ID NO.3) as a template and the RPA isothermal amplification primer pair as primers, PCR products were obtained by amplification according to the RPA kit instructions (TwistAmp® Basic kit, catalog number: TABAS03KIT, TwistDx). The PCR products were used as the target gene, and the copy number was calculated according to the conversion formula. The samples were diluted to 4, 8, 16, 32, 64, 128, 256, 512, 1024, 2048, 4096, 8192, and 16384 copies / mL. These were used as test samples, and their maximum luminescence intensity was measured according to the method in Example 5. A standard curve was constructed with the copy number of the test sample as the x-axis and the maximum luminescence intensity as the y-axis. The obtained standard curve was y = (132.28 × x) / (0.933 + x) (see Example 5). Figure 11 The conversion formula is as follows: In the formula, the unit of plasmid concentration is ng / mL, and the unit of base number is bp.

[0091] like Figure 11 As shown, when the template copy number is 4 copies / mL, its maximum luminescence value is 0.3 × 10⁻⁶. 5 This indicates that the EBV trace detection method of the present invention has high sensitivity and can detect EBV at a concentration as low as 4 copies / mL.

[0092] Example 2 The EBV trace detection method described in Example 5 was applied clinically, and the results are as follows: Plasma was collected from 5 patients who presented with clinical symptoms such as fever, pharyngitis, and swollen lymph nodes. The maximum EBV luminescence value was detected according to the method in Example 5. The corresponding EBV nucleic acid copy number was calculated according to the standard curve formula obtained in Example 1. At the same time, the EBV copy number of the same sample was determined by referring to the qPCR method in the reference. The results are shown in Table 1.

[0093] Reference: Nolan, T., Hands, R. & Bustin, S. Quantification of mRNA using real-time RT-PCR. Nat Protoc 1, 1559–1582 (2006). https: / / doi.org / 10.1038 / nprot.2006.236.

[0094] Table 1. EBV nucleic acid copy number measured by different samples and detection methods.

[0095] As shown in Table 1, the detection results of this system are similar to those of the clinically commonly used quantitative real-time PCR method. Importantly, patient number 3 exhibited several typical clinical phenotypes of EBV infection, including fever, pharyngitis, and lymphadenopathy, but quantitative real-time PCR showed a negative result for EBV nucleic acid in the plasma. Re-examination using the detection technology established in this application revealed the presence of 35 copies / mL of EBV nucleic acid in the plasma. Therefore, the detection system established in this invention has higher sensitivity than quantitative real-time PCR, enabling earlier detection of EBV infection and facilitating timely treatment strategy development.

[0096] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. An EBV trace detection kit, characterized in that, This includes single-atom biomimetic nanozymes, Fe3O4 magnetic beads, and RPA isothermal amplification primer pairs; The surface of the single-atom biomimetic nanoenzyme is coated with digoxigenin antibody. The Fe3O4 magnetic beads are surface-modified with streptavidin; The 5' end of the RPA isothermal amplification primer pair is modified with digoxigenin and / or biotin.

2. The EBV trace detection kit as described in claim 1, characterized in that, Includes at least one of the following (I)-(IV): (I) The single-atom biomimetic nanozyme is mainly composed of a metal-organic framework loaded with metal porphyrin ligands; (II) The mass percentage of digoxigenin antibody in the single-atom biomimetic nanozyme is 0.2-0.5 wt%; The mass percentage of streptavidin on the surface of the Fe3O4 magnetic beads is 0.5-1.5 wt%. (III) The nucleotide sequences of the RPA isothermal amplification primer pair are shown in SEQ ID NO.1-2; (IV) The RPA isothermal amplification primer pair includes an upstream primer and a downstream primer. The 5' end of the upstream primer is modified with digoxigenin, and the 5' end of the downstream primer is modified with biotin.

3. The EBV trace detection kit as described in claim 2, characterized in that, Includes at least one of the following (I)-(II): (I) The metal atoms of the metalloporphyrin in the single-atom biomimetic nanozyme are axially coordinated with histidine; (II) The metal-organic framework is a two-dimensional metal-organic framework.

4. The EBV trace detection kit according to any one of claims 1-3, characterized in that, The EB virus trace detection reagent also includes at least one of a luminescent substrate, a chromogenic substrate, and an RPA amplification system.

5. The method for preparing the EBV trace detection kit according to any one of claims 1-4, characterized in that, Includes the following steps: (1) Mix metal salt, precursor ligand and regulator and react them, then add metal porphyrin ligand to react and obtain single-atom biomimetic nanozyme; A single-atom biomimetic nanozyme was reacted with hyaluronic acid activated by N-hydroxysuccinimide, and then digoxigenin antibody was added to obtain a single-atom biomimetic nanozyme with digoxigenin antibody modified on the surface. (2) Fe3O4 magnetic beads activated with glutaraldehyde were mixed with streptavidin solution and reacted, then sealed to obtain Fe3O4 magnetic beads with streptavidin surface modified. (3) Insert digoxigenin and / or biotin into the 5' end of the RPA isothermal amplification primer pair to obtain an RPA isothermal amplification primer pair with digoxigenin and / or biotin at the 5' end.

6. The preparation method according to claim 5, characterized in that, Includes at least one of the following (I)-(III): (I) In step (1), when the metal atom of the metal porphyrin is axially coordinated with histidine, the following operation is included: mixing the metal porphyrin with histidine to undergo a coordination reaction and obtain the metal porphyrin with histidine axial coordination. (II) In step (1), the mass ratio of the metalloporphyrin ligand, metal salt, precursor ligand and regulator is metalloporphyrin ligand: metal salt: precursor ligand: regulator = (1.5-3.5): (2-4): 1: (9-11); (III) In step (2), the specific operation of the sealing is as follows: add 1v / v% bovine serum albumin borate solution, seal at 23-27℃ for 1h, wash, and obtain Fe3O4 magnetic beads with streptavidin modified on the surface.

7. The method of using the EBV trace detection kit as described in any one of claims 1-4, characterized in that, Includes the following steps: S1. Take the sample to be tested and perform RPA isothermal amplification reaction to obtain RPA reaction products; S2. Add single-atom biomimetic nanozyme and Fe3O4 magnetic beads to the RPA reaction product obtained in step S1 and react. After the reaction is completed, wash by ultrasonic and magnetic adsorption separation to obtain single-atom biomimetic nanozyme-RPA reaction product-Fe3O4 magnetic bead complex. S3. Mix the single-atom biomimetic nanozyme-RPA reaction product-Fe3O4 magnetic bead complex obtained in step S2 with the luminescent substrate, detect the luminescence value, compare the luminescence value or the luminescence of the sample with the blank control to determine the EBV concentration in the sample to be tested, and deduce the EBV copy number of the sample to be tested based on the standard curve.

8. The EBV trace detection kit as described in any one of claims 1-4 is used in EBV detection.

9. A method for detecting trace amounts of EBV, characterized in that, Includes the following steps: S1. Take the sample to be tested and perform RPA isothermal amplification reaction to obtain RPA reaction products; S2. Add single-atom biomimetic nanozyme and Fe3O4 magnetic beads to the RPA reaction product obtained in step S1 and react. After the reaction is completed, wash by ultrasonic and magnetic adsorption separation to obtain single-atom biomimetic nanozyme-RPA reaction product-Fe3O4 magnetic bead complex. S3. Mix the single-atom biomimetic nanozyme-RPA reaction product-Fe3O4 magnetic bead complex obtained in step S2 with the luminescent substrate, detect the luminescence value, compare the luminescence value or the luminescence of the sample with the blank control to determine the EBV concentration in the sample to be tested, and deduce the EBV copy number of the sample to be tested based on the standard curve.

10. The EBV trace detection method as described in claim 9, characterized in that, In step S2, the ratio of the RPA reaction product, single-atom biomimetic nanozyme, and Fe3O4 magnetic beads is RPA reaction product: single-atom biomimetic nanozyme: Fe3O4 magnetic beads = 50 μL: (2.5-5) mg: (1.5-4) mg.

Images