Method for electrochemical detection of middle east respiratory syndrome coronavirus nucleic acid based on crisper-cas13a system and application thereof

Abstract

The application relates to a method for electrochemically detecting a Middle East respiratory syndrome coronavirus nucleic acid based on a CRISPR-Cas13a system and application, wherein the kit comprises the following components: 1) a set of (RT) RAA primers for electrochemically detecting a Middle East respiratory syndrome coronavirus nucleic acid based on a CRISPR-Cas13a system; 2) a CRISPR-Cas13a system for electrochemically detecting a Middle East respiratory syndrome coronavirus nucleic acid based on a CRISPR-Cas13a system, which comprises a Cas13a protein and a crRNA, or a complex formed by the two. The crRNA comprises an anchor sequence for being combined with the Cas13a protein and a guide sequence for targeting a target sequence of a conserved region of an Orf1ab gene of the Middle East respiratory syndrome coronavirus; and the Cas13a protein is an LwaCas13a protein. The application can realize high-sensitivity and high-specificity detection of the electrochemically detecting a Middle East respiratory syndrome coronavirus nucleic acid based on the CRISPR-Cas13a system; the application does not need complex and accurate temperature control equipment, has the advantages of low cost, portability, on-site development, integration and the like, and the minimum detection limit can reach 10 ‑ copies / muL.

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic technology, specifically relating to a method and application of electrochemical detection of Middle East Respiratory Syndrome Coronavirus nucleic acid based on the CRISPR-Cas13a system. Background Technology

[0002] Middle East Respiratory Syndrome Coronavirus (MERS-CoV) is a highly pathogenic beta coronavirus that is endemic in the Middle East, with a fatality rate of approximately 35%, posing a serious threat to public health. MERS-CoV is primarily transmitted through respiratory droplets and close contact. Infected patients typically present with severe lower respiratory symptoms such as fever, cough, and difficulty breathing; some may develop acute respiratory distress syndrome, kidney failure, or even death. Due to the high fatality rate and potential for large-scale transmission of MERS-CoV, early diagnosis is crucial for epidemic prevention and control and clinical treatment. Currently, the main detection methods for MERS-CoV include real-time quantitative PCR (RT-qPCR) and antigen detection, but these require specialized equipment and personnel, and are time-consuming and relatively complex. Therefore, developing a simple, rapid, and highly sensitive detection technology is essential for the prevention and control of MERS-CoV. Summary of the Invention

[0003] In view of the problems existing in the prior art, the present invention provides a method and application for electrochemical detection of Middle East Respiratory Syndrome Coronavirus nucleic acid based on the CRISPR-Cas13a system, which can detect Middle East Respiratory Syndrome Coronavirus rapidly, simply and with high sensitivity.

[0004] According to a first aspect of the technical solution of the present invention, the present invention first provides a kit for electrochemical detection of Middle East Respiratory Syndrome Coronavirus nucleic acid based on the CRISPR-Cas13a system, which comprises the following components: 1) A set of (RT)RAA primers for electrochemical detection and / or electrochemical nucleic acid detection of Middle East Respiratory Syndrome Coronavirus based on the CRISPR-Cas13a system; 2) A CRISPR-Cas13a system for electrochemical detection of Middle East Respiratory Syndrome Coronavirus nucleic acid based on a CRISPR-Cas13a system, comprising Cas13a protein and crRNA, or a complex of the two; 3) A CRISPR-Cas13a electrochemical system for electrochemical nucleic acid detection of Middle East Respiratory Syndrome Coronavirus, Cas13a protein and crRNA, or a complex of the two; The crRNA is an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting conserved regions of the Middle East Respiratory Syndrome Coronavirus Orf1ab gene; the Cas13a protein is the LwaCas13a protein.

[0005] In the kit for electrochemical nucleic acid detection of Middle East Respiratory Syndrome Coronavirus, the conserved target sequence of the Middle East Respiratory Syndrome Coronavirus Orf1ab gene is shown as positions 19600-19900 of the gene sequence numbered MG912600.1 in the GenBank database.

[0006] Preferably, the sequences of the (RT)RAA primers are shown in SEQ ID No. 1-SEQ ID No. 6, and the sequences of the crRNA primers are shown in SEQ ID No.-SEQ ID No. 22.

[0007] According to a second aspect of the present invention, a method for detecting Middle East Respiratory Syndrome Coronavirus (MERS-CoV) nucleic acid using an electrochemical detection system based on CRISPR-Cas13a is provided, comprising using the aforementioned kit for electrochemical detection of MERS-CoV nucleic acid using a CRISPR-Cas13a system.

[0008] Preferably, the method further includes using a primer combination for specifically amplifying the target sequence of Middle East Respiratory Syndrome Coronavirus; the primer combination consists of SEQ ID No. 1 and SEQ ID No. 4.

[0009] According to a third aspect of the technical solution of the present invention, an application of the above-mentioned reagent kit in the preparation of a product having the following function: detecting whether the target nucleic acid is pathogen nucleic acid.

[0010] According to a fourth aspect of the technical solution of the present invention, any of the following substances is provided: A1) The aforementioned crRNA; A2) The aforementioned Cas13a protein and crRNA, or a complex formed by the two; A3) The primer combination mentioned above.

[0011] According to the fifth aspect of the technical solution of the present invention, any of the following applications are provided: B1) The application of the above-mentioned kits or substances in the detection or auxiliary electrochemical detection of Middle East Respiratory Syndrome Coronavirus nucleic acid based on the CRISPR-Cas13a system; B2) The use of the above-described kits or substances in the preparation of products for the detection or assistance of electrochemical detection of Middle East Respiratory Syndrome Coronavirus nucleic acid based on the CRISPR-Cas13a system; B3) The application of the above-mentioned kits or substances in detecting or assisting in the detection of whether a sample contains Middle East Respiratory Syndrome Coronavirus; B4) The use of the above-mentioned kits or substances in the preparation of products for detecting or assisting in the detection of whether a sample contains Middle East Respiratory Syndrome Coronavirus; B5) The use of the above-mentioned kits or substances in screening or assisting in the screening of drugs for the prevention and treatment of Middle East Respiratory Syndrome Coronavirus. B6) The use of the above-mentioned kits or substances in the preparation of products for screening or assisting in the screening of drugs for the prevention and treatment of Middle East Respiratory Syndrome Coronavirus. B7) The use of the above-mentioned substances in the preparation of the aforementioned kit.

[0012] Preferably, the application is for non-diagnostic purposes.

[0013] According to a sixth aspect of the present invention, a method for electrochemical detection of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) nucleic acid based on a CRISPR-Cas13a system is provided. The method for electrochemical detection of MERS-CoV nucleic acid based on a CRISPR-Cas13a system is a non-diagnostic method, and the method includes using the above-mentioned technology to detect whether the sample to be tested is or is a candidate for MERS-CoV.

[0014] Compared with existing technologies, the method and application of the electrochemical detection of Middle East Respiratory Syndrome Coronavirus nucleic acid based on the CRISPR-Cas13a system of the present invention have the following beneficial effects: 1. This invention provides a technology for detecting Middle East Respiratory Syndrome Coronavirus (MERS-CoV) based on (RT)RAA / CRISPR-Cas13a nucleic acid detection technology. It includes a CRISPR-Cas13a system for electrochemical detection of MERS-CoV nucleic acid based on a CRISPR-Cas13a system and a CRISPR-Cas13a electrochemical system for electrochemical nucleic acid detection of MERS-CoV. Through design, construction, and screening, it ultimately provides a (RT)RAA amplification primer combination for detecting MERS-CoV, the target sequence to be detected, and a specific crRNA that can target the target sequence, enabling highly sensitive and specific detection of MERS-CoV.

[0015] 2. This invention eliminates the need for complex and precise temperature control equipment; the entire process requires only a simple constant-temperature heating device and a small chip, greatly alleviating limitations imposed by the scenario and conditions. Furthermore, this invention has a shorter detection time, nearly halving the time compared to traditional detection methods, and its sensitivity can reach 10. - ¹ copies / μL, which has important application value in the detection and identification of Middle East Respiratory Syndrome Coronavirus infection. Attached Figure Description

[0016] Figure 1 This is a schematic diagram of the present invention.

[0017] Figure 2 A schematic diagram for target selection.

[0018] Figure 3A To amplify 10 using (RT)RAA-F1 and (RT)RAA-R1 primer sets 3 Figure 1 shows the results of CRISPR fluorescence detection of crRNA screening after plasmid concentration of copies / μL; Figure 3B To amplify 10 using (RT)RAA-F1 and (RT)RAA-R1 (RT)RAA primers 3 Figure 1 shows the analysis of CRISPR fluorescence detection results for crRNA screening after plasmid concentration of copies / μL; Figure 4A To amplify 10 using (RT)RAA 9 sets of primers respectively 3 Figure 1 shows the primer screening results for CRISPR-Cas13a fluorescence detection using crRNA5 at a plasmid concentration of copies / μL. Figure 4B Based on Figure 4A At the end of the reaction, an analysis graph of the primer screening results based on fluorescence values ​​is shown. Figure 4C Based on Figure 4A A heatmap analysis of the primer screening results based on fluorescence values ​​at the end of the reaction; Figure 5A Figure showing the sensitivity results of the CRISPR-Cas13a electrochemical system for detecting Middle East Respiratory Syndrome Coronavirus nucleic acid. Figure 5B Figure showing the sensitivity analysis of the CRISPR-Cas13a electrochemical system for detecting Middle East Respiratory Syndrome Coronavirus nucleic acid. Figure 6AFigure showing the results of CRISPR-Cas13a electrochemical system for detecting the specificity of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) nucleic acid based on the CRISPR-Cas13a system. Figure 6B Figure 1 shows the results of CRISPR-Cas13a electrochemical system detection of the specificity of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) nucleic acid.

[0019] Appendix Explanation Table 1 is a description of the (RT) RAA primer sequences.

[0020] Table 2 is a description of crRNA sequences and their primer sequences.

[0021] Table 3 shows the PCR reaction system for preparing crRNA. Table 4 is a description of the crRNA in vitro transcription system. Detailed Implementation The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0022] The reagents and their sources involved in the following examples are as follows: NTP mix (Beyotime, D7387-1ml), Murine RNase inhibitor (Vazyme, R301-03), T7 RNA Polymerase (Vazyme, GMP4101PC-01), 2×TaqPCR MasterMix (Jiangsu Kangwei Century, CW2965M), NEB T7 Rapid and High-Efficiency RNA Synthesis Kit (NEB, USA, E2050S), Tris Balanced Phenol (Solepro, T0250), Chloroform (Sinopharm Group, 10006818), RNA Purification Magnetic Beads (Beckman Coulter, A63987), (RT)RAA Amplification Kit (Hangzhou Zhongce, S001ZC), RNase-free ddH2O (Vazyme, P071-P201), HEPES buffer (ThermoFisher, 15630080), MgCl2 solution (ThermoFisher, AM9530G), LwCas13a protein (GenScript, P50502002).

[0023] This invention relates to a molecular diagnostic technology based on nucleic acid detection using clustered regularly interspaced short palindromic repeats (CRISPR). A platform for pathogen nucleic acid detection has been developed based on the CRISPR-Cas13a (CRISPR-associated protein 13) system. This platform, combined with isothermal amplification techniques such as recombinase-aided amplification ((RT)RAA), enables the detection of single-copy pathogen nucleic acids. CRISPR-Cas13a detection technology can be combined with electrochemical detection technology to achieve CRISPR-Cas13a electrochemical nucleic acid detection, enabling immediate, highly specific, and highly sensitive nucleic acid detection. This technology offers advantages such as speed, simplicity, and on-site detection capabilities. Based on this nucleic acid detection technology, methods for detecting various pathogens, including Middle East Respiratory Syndrome Coronavirus (MERS-CoV) and the novel coronavirus, can be developed.

[0024] The following specific embodiments further illustrate the technical solution of the electrochemical detection method and application of Middle East Respiratory Syndrome Coronavirus nucleic acid based on the CRISPR-Cas13a system according to the present invention.

[0025] Example 1: Detection Principle of Electrochemical Detection Technology for Middle East Respiratory Syndrome Coronavirus Nucleic Acid Based on CRISPR-Cas13a System Detection designs based on (RT)RAA / CRISPR, such as Figure 1 As shown, it includes the following steps: 1. RT-RAA isothermal amplification The isothermal amplification system was the reaction system recommended in the RT-RAA nucleic acid amplification kit instructions (template volume: 5 μL). The reaction system consisted of: 1 tube of reaction powder, 25 μL of Buffer A, 2.5 μL of Buffer B, 2 μL of RT-RAA upstream primer (10 μM), 2 μL of RT-RAA downstream primer (10 μM), 13.5 μL of RNase-free ddH2O, and 5 μL of RNA sample. The RT-RAA amplification steps are as follows: (1) Prepare a solution containing A Buffer, RT-RAA upstream primer (10 μM), RT-RAA downstream primer (10 μM), and RNase-free-ddH2O according to the reaction system. Mix the solution evenly and add it to the detection unit tube containing the reaction powder. Dissolve the reaction powder completely. (2) Add the RNA sample to the detection unit tube. (3) Add B Buffer to the cap of the detection unit tube. (4) Cap the tube and shake it upside down to mix thoroughly 5-6 times. Centrifuge briefly for 10 seconds. (5) Place the prepared detection unit tube in a 42℃ constant temperature metal bath and react for 30 minutes. The amplification is complete.

[0026] RT-RAA (Reverse Transcription Recombinase-Aided Amplification) isothermal amplification technology offers advantages such as high sensitivity, rapid efficiency, no need for complex equipment, and ease of operation. It enables rapid RNA amplification at relatively low temperatures, making it suitable for high-sensitivity applications such as virus detection. Furthermore, it eliminates the need for expensive thermal cyclers, requiring only simple temperature control equipment. Results are typically available within 20-30 minutes, making it ideal for rapid on-site testing.

[0027] 2. CRISPR-Cas13a fluorescence detection method The CRISPR-Cas13a fluorescence detection system is as follows: NTP Buffer Mix (25mM) 2μL, Murine RNase Inhibitor (40U / μL) 1μL, T7 RNA Polymerase (50U / μL) 0.5μL, HEPES (1M) 0.5μL, MgCl2 (1M) 0.25μL, RNase-free ddH2O 10.75μL, RNaseAlert™ Substrate V2 (2μmol / L) 2.5μL, crRNA (100 ng / μL) 1.5μL, GenCRISPR™ LwaCas13a Nuclease (1μM) 1μL, RT-RAA amplification product 5μL, total 25μL.

[0028] CRISPR-Cas13a fluorescence detection method operation procedure: After preparing the appropriate amount of fluorescence detection system according to the experimental plan, mix thoroughly by pipetting and aliquot 20 μL / well into white eight-packs. After adding the amplification product, centrifuge briefly. Place the white eight-packs in the corresponding position of the real-time PCR instrument, select the FAM channel (excitation wavelength 490 nm, emission wavelength 520 nm), and set the parameters as follows: 37℃ for 15 s, 37℃ for 1 min 45 s, 2 min as one cycle, for a total of 30 cycles. Acquire fluorescence signal every 2 min for a total of 60 min, and monitor the fluorescence value changes in real time.

[0029] Experimental Principle: DNA sequences carrying the T7 promoter are recognized by T7 RNA polymerase in the system and transcribed into single-stranded RNA. The crRNA specifically recognizes the target sequence. When the crRNA recognizes the target sequence, it activates the non-specific cleavage function of the Cas13a protein, cutting the single-stranded RNA fluorescent reporter molecule containing the FAM group added to the system. After the reporter molecule is cleaved, the FAM group is activated, and a significant change in fluorescence value can be measured, indicating the presence of the target sequence.

[0030] 3. CRISPRCas13a Electrochemical Detection Method The specific process of the CRISPR-Cas13a electrochemical detection method is as follows: Figure 1 As shown, the reaction system is as follows: NTPBuffer Mix (25mM) 4μL, T7 RNA Polymerase (10U / μL) 4μL, HEPES (1M) 1μL, MgCl2 (1M) 1μL, RNase-free ddH2O 22μL, electrochemical reporter RNA (20μM) 2μL, crRNA (100 ng / μL) 1μL, GenCRISPR™ LwaCas13a Nuclease (1μM) 3μL, RT-RAA amplification product 5μL, total 40μL.

[0031] The detection steps for the CRISPR-Cas13a electrochemical biosensor are as follows: ① Prepare the CRISPR-Cas13a electrochemical detection system according to the reaction quantity, mix thoroughly by pipetting, dispense into aliquots, add 2 μL of amplification product, and incubate in a metal bath at 37°C for 30 min; ② For each system, add 36 μL of streptavidin magnetic beads. Based on the number of reaction systems, extract the corresponding volume of streptavidin magnetic beads into a 0.2 ml transparent eight-tube array, wash three times with enzyme-free water, place on a magnetic rack and let stand for 1 min, discarding the supernatant; ③ Add the completed detection system to the transparent eight-tube array containing the magnetic beads, aspirate and mix, and let stand at room temperature for 1 min. This process separates biotin from unreacted reporter molecules and leaves methylene blue in the detection solution, reducing the influence of background signal values ​​on the detection results; ④ Place the transparent eight-tube array containing the detection solution and magnetic beads on a magnetic rack and let stand for 2 min; ⑤ Using a Chenhua CHI660E electrochemical workstation, set the square wave voltammetry detection parameters: initial potential -0.5 V, termination potential 0 V. V, potential increment is 0.006 V, amplitude is 0.05 V, frequency: 50 Hz, settling time: 2 s, detection sensitivity is set to 10E-6A; ⑥ Draw a drop of detection liquid and add it to the electrode sheet and spread it evenly to cover the working electrode, auxiliary electrode and reference electrode, start the detection program and record the detection results.

[0032] Experimental Principle: The electrochemical reporter RNA used in the experiment (custom-synthesized by Baori Biotechnology (Beijing) Co., Ltd.) consists of 7 Us, namely MB-UUUUUUU-Biotin (where MB is Methylene Blue). The electrochemical probe is labeled with MB and biotin at both ends, respectively. MB has an electrochemical signal, and biotin can be adsorbed by streptavidin. When the crRNA recognizes the target sequence, it activates the non-specific trans-cleavage activity of the Cas13a protein, cleaving the electrochemical reporter RNA probe in the system into MB and biotin residues. After the reaction, the biotin groups are adsorbed and separated using streptavidin immunomagnetic beads. The redox peak signal of methylene blue remaining in the test solution is detected using square wave voltammetry with an electrochemical workstation. The result interpretation criteria are as follows: the positive threshold is the peak value of the negative oxidation peak current plus three times the standard deviation. Samples above the positive threshold are considered positive, and samples below the positive threshold are considered negative.

[0033] Compared to traditional electrochemical detection methods, this method does not require electrode pretreatment and can use commercially available electrode sheets, reducing operational complexity and significantly lowering detection costs.

[0034] Example 2: Design, preparation and screening of RAA primers and crRNA 1. Screening of conserved region sequences of MERS-CoV and plasmid synthesis.

[0035] The Middle East Respiratory Syndrome Coronavirus (MERS-CoV) gene sequence was downloaded from the NCBI website. The sequence conservation was compared using the MAFFT program (https: / / mafft.cbrc.jp / alignment / server / ), and the sequences were aligned. The file was then opened using CAJViewer 8.1 (version 8.1.73.0), and based on a 90% conservation rate, the reference strain GenBank ID MG912600.1 was selected. The selected conserved sequence was located between 19600 and 19900, and was 300 bp in length. A plasmid containing the selected conserved sequence was designed for subsequent detection. The plasmid was synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.

[0036] 2. Design and synthesis of RAA primers Based on the conserved sequence of the selected plasmid, and following the RAA primer design principles: ① Primer length: 25-35 bp; ② Avoid repeated G and C at the 5' end, and preferably have G or C at the 3' end; ③ The G and C base content should ideally be 30-50%; ④ The product length should ideally be 100-200 bp. Primers were designed using Primer 5.0. A T7 promoter sequence was added to the 5' end of the forward primer of the designed RAA primers, allowing the amplified product to be transcribed into RNA by T7 RNA polymerase for crRNA recognition. Three upstream RT-RAA primers and three downstream RT-RAA primers were designed. The designed primer sequences are shown in Table 1, and the design diagram is shown below. Figure 2 As shown. The oligonucleotides were synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.

[0037] Table 1 (RT-)RAA primer sequences

[0038] 3. Design and preparation of crRNA crRNAs were designed within conserved sequences, avoiding the RT-RAA primer region, with a design length of 28 bp. The upstream primer used for crRNA preparation was a universal template, consisting of half of the T7 plus Cas13a protein backbone sequence, and the template itself was the reverse complementary sequence of the protein backbone and the target site. The downstream primer consisted of the first 20 bp of the selected target sequence. A total of five crRNAs were designed for subsequent experimental screening. The designed crRNAs and their upstream and downstream primer sequences are shown in Table 2. The crRNA templates and upstream and downstream primers were synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.

[0039] Table 2. crRNA and nucleic acid sequences used to prepare crRNA

[0040] Preparation of crRNA: (1) PCR amplification: using crRNA-Template (crRNA-T) as the amplification template, and using... PCR was performed using crRNA-F and crRNA-R primers to obtain a crRNA transcription template with the T7 promoter. The PCR reaction system is shown in Table 3. PCR reaction program: pre-denaturation (95℃ 5 min); denaturation, annealing, and extension (95℃ 30 s, 55℃ 30 s, 72℃ 45 s) 35 cycles; subsequent extension (72℃ 10 min).

[0041] Table 3 PCR reaction system for preparing crRNA

[0042] (2) Purification and recovery of PCR products: Tris-balanced phenol and chloroform were vortexed in equal proportions, centrifuged at 10,000 rpm for 10 min, and the supernatant was discarded and used as nucleic acid extraction reagent. 600 μL of nucleic acid extraction reagent was added to 200 μL of PCR product, vortexed, centrifuged at 10,000 rpm for 5 min, the supernatant was aspirated and mixed with anhydrous ethanol at a ratio of 3:7, centrifuged at 10,000 rpm for 10 min, the supernatant was discarded, 200 μL of 70% ethanol was added, and centrifuged at 10,000 rpm for 10 min. This operation was repeated twice. Finally, the supernatant was discarded, and the white precipitate at the bottom of the tube was left to air dry at room temperature for about 10 min. It was then dissolved in 50 μL of enzyme-free water, and the product concentration was measured using an ultra-micro spectrophotometer.

[0043] (3) In vitro transcription: 1 μg of purified PCR product (calculate the required product volume based on the measured concentration) was added to 20 μL of T7 RNA polymerase transcription system and incubated at 37℃ for 12 h to obtain crRNA. The transcription system is shown in Table 4.

[0044] Table 4. Reaction system for in vitro transcription of crRNA

[0045] (4) crRNA purification: Shake the RNA Clean XP magnetic beads well. Add 36 μL of magnetic beads to the 20 μL system after transcription is complete. Mix by pipetting and aspirating 10 times and let stand at room temperature for 3-5 min. Place on a magnetic rack for 5-10 min until the system is clear, and discard the supernatant. Add 200 μL of 70% ethanol and let stand at room temperature for 30 sec. Discard the supernatant (repeat 3 times). Do not touch the magnetic beads during the operation. Air dry at room temperature for about 10 min. Finally, add 40 μL of enzyme-free water, mix well, and aspirate the supernatant to obtain crRNA. Measure the concentration using a micro spectrophotometer. Finally, dilute to 100 ng / μL and store at -80℃ for later use.

[0046] 3. Screening of RAA primers and crRNA According to the copy number calculation formula: copies / μL = 6.02 × 10 23 ×concentration (ng / μL) ×10 9 / Plasmid length × 660, the synthesized MERS-CoV conserved fragment plasmid was diluted to 10 3 Copies / μL were used for subsequent screening experiments.

[0047] (1) Screening of crRNA: First, use 10 3 MERS-CoV plasmid copies / μL were amplified isothermally. The isothermal amplification system was the reaction system recommended in the RT-RAA nucleic acid amplification kit instructions (template volume 5μL). The reaction system consisted of: 1 tube of reaction powder, 25μL A Buffer, 2.5μL B Buffer, 2μL RT-RAA upstream primer (10μM), 2μL RT-RAA downstream primer (10μM), 13.5μL RNase-free ddH2O, and 5μL RNA sample. The RT-RAA amplification steps are as follows: ① Prepare a mixture containing ABuffer, RT-RAA upstream primer (10 μM), RT-RAA downstream primer (10 μM), and ddH2O according to the reaction system, mix well, and add it to the detection unit tube containing the reaction powder; ② Add RNA sample to the detection unit tube; ③ Add B Buffer to the cap of the detection unit tube; ④ Cap the tube, invert and shake gently to mix thoroughly 5-6 times, and centrifuge at low speed for 10 seconds; ⑤ Place the prepared detection unit tube in a 42℃ constant temperature metal bath and incubate for 30 minutes until amplification is complete.

[0048] Next, following the CRISPR-Cas13a fluorescence detection system and procedures, crRNA1, crRNA2, crRNA3, crRNA4, and crRNA5 were used to detect the amplification results. The corresponding crRNA was added to the experimental group, while the crRNA in the control group was replaced with an equal amount of ddH2O.

[0049] Test results as follows Figure 3A , 3B As shown, four crRNAs (crRNA2, crRNA3, crRNA4, and crRNA5) could detect the MERS-CoV plasmid, and their fluorescence values ​​were statistically significant compared to the control group. P < 0.0001 (P < 0.001). Figure 3A The graph shows the fluorescence curves of three replicates when screening crRNAs using the F1R1 primer combination amplification products. RFU (Relative Fluorescence Unit) represents the relative fluorescence value. As shown in the graph, the fluorescence value of crRNA group 5 is higher than that of the other crRNAs at the beginning of the reaction, and it reaches the plateau phase first. The final fluorescence value is also higher than that of the other crRNA groups. Cycles represents the number of cycles. One cycle program is 37℃ for 45s, 37℃ for 1min15s, and the experiment consists of 30 cycles, with a total duration of 1h. Figure 3B The statistical analysis of the terminal fluorescence values ​​of the five crRNA groups is shown in the bar chart. As can be seen from the figure, except for crRNA1, all other crRNAs showed statistical differences from the control group, and crRNA5 had the highest terminal fluorescence value. Therefore, crRNA5 was selected as the optimal crRNA.

[0050] (2) Screening of RAA primers: Using a previously diluted MERS-CoV plasmid at a concentration of 10³ copies / μL as the amplification substrate, nine primer combinations were used for RT-RAA amplification, consisting of three upstream primers and three downstream primers paired in Table 1. The control group did not include any RAA upstream or downstream primers. The amplification products were tested using CRISPR-Cas13a fluorescence detection (refer to the detection principle section for RT-RAA amplification and fluorescence detection methods).

[0051] Test results as follows Figure 4A , Figure 4B , Figure 4C As shown: the fluorescence values ​​of the primer combinations F1R1, F1R3, and F2R1 were statistically significant compared to the control group. : P <0.0001). Figure 4A This represents a triplet fluorescence detection curve for amplifying plasmids of the same concentration using different primer sets. Different primer sets are shown in the legend on the right. Figure 4A It can be seen that the F1R1 primer set has the highest fluorescence value and reaches the plateau phase the fastest. Figure 4B The graph shows the fluorescence values ​​of each primer group at x=30 cycles. The graph shows that except for the F1R1, F1R3, and F2R1 primer groups, which showed statistically significant differences from the control group, the fluorescence values ​​of the other primer groups did not show significant statistical differences from the negative control group. Figure 4C The heatmap showed that F1R1 had the highest final fluorescence value. Therefore, F1R1 was selected as the optimal primer pair to establish a CRISPR-Cas13a fluorescence detection method for Middle East Respiratory Syndrome Coronavirus.

[0052] Example 3: Sensitivity evaluation of the CRISPR-Cas13a electrochemical detection method for Middle East Respiratory Syndrome Coronavirus based on optimal crRNA and optimal (RT)RAA primers. The conserved fragment plasmid of MERS-CoV was serially diluted 10-fold and selected 10 3 copies / μL~10 -1 Five concentration gradients of copies / μL were used to evaluate the sensitivity of the CRISPR-Cas13a electrochemical detection method established based on the optimal crRNA and optimal (RT)RAA primers. The experimental method is the same as in Example 1.

[0053] The crRNA5 (TCTGCTTGTAAATTGTGTAGCAATTTGA) (SEQ ID No. 11) screened in Example 2 was selected. Primers selected were F1 (AATTCTAATACGACTCACTATAGGGTATGTTTGAGAATAAAACCACTTTGCCTAC) (SEQ ID No. 1) and R1 (TTCATAATCCCAAAGGACGAACTTGTAGCA) (SEQ ID No. 4) screened in Example 2. The specific steps are as follows: 1) The conserved fragment plasmid of MERS-CoV synthesized in Example 2 was serially diluted 10-fold, and 10 were selected. 3 copies / μL~10 -1 Five plasmids at concentration gradients of 5 copies / μL were used as templates, and an equal amount of RNase-free H2O was used to replace the plasmids in the negative control group. (RT)RAA amplification was performed according to the experimental method described in Example 1.

[0054] 2) Take 2µL of (RT)RAA amplification product and detect each group of (RT)RAA amplification products according to the electrochemical detection method in Example 1.

[0055] 3) Test results as follows Figure 5A , Figure 5B As shown, Figure 5A In the diagram, lines of different colors represent current data measured from conserved MERS-CoV fragment plasmids of different concentration groups. Figure 5B This is a bar chart showing the peak current measured in each concentration group and the negative control group, within the range of 10³ to 10⁻⁶. - Significant electrical signal responses were observed at all four concentration gradients of ¹copies / μL, with statistically significant differences in peak current compared to the negative control group (F=86.56). : P <0.001, : P <0.0001). Therefore, the sensitivity of this method for detecting Middle East Respiratory Syndrome Coronavirus nucleic acid based on the CRISPR-Cas13a system is 10. -1 copies / μL.

[0056] In summary, the present invention does not require complex and precise temperature control equipment; the entire process can be achieved with only a simple constant-temperature heating device and a small chip, greatly alleviating the limitations of the scenario and conditions. The present invention also has a shorter detection time, nearly halving the time compared to traditional detection methods, and a sensitivity of up to 10. - ¹ copies / μL, which has important application value in the detection and identification of Middle East Respiratory Syndrome Coronavirus infection.

[0057] Example 4: Specificity evaluation of CRISPR-Cas13a electrochemical detection of Middle East Respiratory Syndrome Coronavirus based on optimal crRNA and optimal (RT)RAA primers. The specificity of the detection method was evaluated using nucleic acids from six other common respiratory infectious disease viruses, following the method described in Example 1.

[0058] The crRNA5 (TCTGCTTGTAAATTGTGTAGCAATTTGA) (SEQ ID No. 11) screened in Example 2 was used. Primers used were F1 (AATTCTAATACGACTCACTATAGGGTATGTTTGAGAATAAAACCACTTTGCCTAC) (SEQ ID No. 1) and R1 (TTCATAATCCCAAAGGACGAACTTGTAGCA) (SEQ ID No. 4) screened in Example 2. The specific steps are as follows: 1) Using influenza A virus (IAV) RNA standards, influenza B virus (IBV) RNA standards, human parainfluenza virus type 1 RNA standards, human rhinovirus (HRV) RNA standards, human respiratory syncytial virus type A (HRSV-A) RNA standards, and novel coronavirus (SARS-CoV-2) nucleic acid standards as templates, the nucleic acids of the seven different pathogens were amplified by (RT)RAA according to the CRISPR-Cas13a electrochemical detection method in Example 1. At the same time, the amplification products with Middle East Respiratory Syndrome Coronavirus plasmid as template were set as positive controls, and the amplification products with RNase-free H2O substitution plasmid as template were set as negative controls (NC).

[0059] 2) After RT-RAA amplification, take 2µL of amplification product from each group and detect the amplification products of each group according to the CRISPR-Cas13a electrochemical detection method in Example 1.

[0060] Test results as follows Figure 6A As shown in 6B, Figure 6A , Figure 6B This is a graph used for electrochemical specificity detection results, where NC is the negative control, HRV represents human rhinovirus nucleic acid standard, HRSV-A represents human respiratory syncytial virus type A, IAV represents influenza A virus nucleic acid standard, HPIV represents human parainfluenza virus nucleic acid standard, SARS-CoV-2 represents novel coronavirus nucleic acid standard, IBV represents influenza B virus nucleic acid standard, and MERS-CoV represents Middle East respiratory syndrome coronavirus nucleic acid standard. Electrochemical MERS-CoV specificity experiments were conducted using these viral nucleic acid standards. Figure 6A It can be seen that, except for Middle East Respiratory Syndrome Coronavirus (MERS-CoV), which showed a significant current peak, the others did not show a significant current peak. Combined with... Figure 6B Statistical analysis of the electrochemical peak values ​​showed that only MERS-CoV showed a statistically significant difference from the negative control NC, while all other results showed no statistical difference. These results indicate that this detection method has good specificity.

[0061] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A kit for the electrochemical detection of Middle East Respiratory Syndrome Coronavirus nucleic acid based on the CRISPR-Cas13a system, characterized in that, Includes the following components: 1) A set of (RT)RAA primers for electrochemical detection and / or electrochemical nucleic acid detection of Middle East Respiratory Syndrome Coronavirus based on the CRISPR-Cas13a system; 2) A CRISPR-Cas13a system for electrochemical detection of Middle East Respiratory Syndrome Coronavirus nucleic acid based on a CRISPR-Cas13a system, comprising Cas13a protein and crRNA, or a complex of the two; 3) A CRISPR-Cas13a electrochemical system for electrochemical nucleic acid detection of Middle East Respiratory Syndrome Coronavirus, Cas13a protein and crRNA, or a complex of the two; 4) Electrochemical reporter RNA, with methylene blue (MB) and biotin labeled at both ends, and an oligouridine nucleotide sequence in the middle; 5) In vitro transcription system reagents, including NTPs, T7 RNA polymerase, and RNase inhibitors; The crRNA is an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting conserved regions of the Middle East Respiratory Syndrome Coronavirus Orf1ab gene; the Cas13a protein is the LwaCas13a protein.

2. The kit for electrochemical nucleic acid detection of Middle East Respiratory Syndrome Coronavirus based on the CRISPR-Cas13a system according to claim 1, characterized in that, The conserved target region sequence of the Middle East Respiratory Syndrome Coronavirus Orf1ab gene is shown in positions 19600-19900 of the gene sequence numbered MG912600.1 in the GenBank database.

3. The kit for electrochemical nucleic acid detection of Middle East Respiratory Syndrome Coronavirus based on the CRISPR-Cas13a system according to claim 1, characterized in that, The sequences of the (RT)RAA primers are shown in SEQ ID No. 1-SEQ ID No. 6, the guide sequences of crRNA are shown in SEQ ID No. 7-SEQ ID No. 11, and the nucleic acid sequences used to prepare crRNA are shown in SEQ ID No. 12-SEQ ID No.

22.

4. A method for detecting Middle East Respiratory Syndrome Coronavirus (MERS-CoV) nucleic acid using an electrochemical detection system based on CRISPR-Cas13a, characterized in that, It includes a kit for the electrochemical detection of Middle East Respiratory Syndrome Coronavirus nucleic acid using any one of claims 1-3 based on a CRISPR-Cas13a system.

5. The method for detecting Middle East Respiratory Syndrome Coronavirus nucleic acid based on the CRISPR-Cas13a system according to claim 4, characterized in that, The method also includes using a primer combination for specifically amplifying the target sequence of Middle East Respiratory Syndrome Coronavirus; the primer combination consists of SEQ ID No. 1 and SEQ ID No.

4.

6. The use of the kit according to any one of claims 1-3 in the preparation of a product having the function of detecting whether a sample to be tested contains Middle East Respiratory Syndrome Coronavirus nucleic acid.

7. Any of the following substances: A1) Guide sequences such as any of the crRNAs shown in SEQ ID No. 7-SEQ ID No. 11; A2) The Cas13a protein and crRNA as described in any one of claims 1-3, or a complex thereof; A3) The primer combination as described in claim 5.

8. Any of the following applications: B1) The use of the kit according to any one of claims 1-3 or the substance according to claim 7 in the detection or auxiliary electrochemical detection of Middle East Respiratory Syndrome Coronavirus nucleic acid based on the CRISPR-Cas13a system; B2) The use of the kit according to any one of claims 1-3 or the substance according to claim 7 in the preparation of products for the detection or auxiliary detection of Middle East Respiratory Syndrome Coronavirus nucleic acid detection; B3) The use of the kit according to any one of claims 1-5 or the substance according to claim 7 in detecting or assisting in the detection of whether a sample contains Middle East Respiratory Syndrome Coronavirus; B4) The use of the kit according to any one of claims 1-5 or the substance according to claim 7 in the preparation of products for detecting or assisting in the detection of whether a sample to be tested contains Middle East Respiratory Syndrome Coronavirus; B5) Use of the substance of claim 7 in the preparation of the kit according to any one of claims 1-3.

9. The application according to claim 8, characterized in that, The application is not for diagnostic purposes.

10. A method for electrochemical detection of Middle East Respiratory Syndrome Coronavirus nucleic acid based on a CRISPR-Cas13a system, characterized in that, The method for electrochemical detection of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) nucleic acid based on the CRISPR-Cas13a system is a non-diagnostic method, which includes using the technique described in any one of claims 1-3 to detect whether the sample to be tested is or is a candidate for MERS-CoV.

Images