A nano-enzyme / nucleic acid aptamer-based reversible fluorescent probe, a preparation method thereof and application thereof in real-time monitoring of dopamine

Abstract

The application belongs to the technical field of biological detection, and particularly relates to a kind of based on nano-enzyme / nucleic acid aptamer reversible fluorescence probe and its preparation method and its application in real-time monitoring of dopamine.The fluorescence probe comprises platinum nanoparticles and nucleic acid triplex including dopamine aptamer coupled on the surface of the platinum nanoparticles;the middle of the dopamine aptamer is modified with Cy3 dye, and the 3' end is modified with Cy5 dye;the nucleic acid triplex further comprises nucleic acid fixed chain and nucleic acid connecting chain;the nucleic acid connecting chain connects the nucleic acid fixed chain and dopamine aptamer, and is anchored by the platinum-sulfur bond formed by the 5' end modified sulfhydryl in the nucleic acid fixed chain and platinum nanoparticles.The preparation method of the fluorescence probe provided by the application is simple, has high time resolution, high sensitivity and high specificity, is suitable for dynamic monitoring of dopamine in complex cell environment, and provides an effective means for early diagnosis of depression.

Description

Technical Field

[0001] This invention relates to the field of biodetection technology, specifically to a reversible fluorescent probe based on nanozyme / nucleic acid aptamer, its preparation method, and its application in real-time monitoring of dopamine. Background Technology

[0002] Depression, a prevalent mental disorder worldwide, has long relied on clinical interviews with physicians, combined with standardized assessment tools such as the Hamilton Depression Rating Scale and the Beck Self-Rating Depression Scale, for its clinical diagnosis. However, this diagnostic model suffers from significant subjective limitations: diagnostic results are highly dependent on the physician's clinical experience and professional judgment, and also heavily reliant on the patient's subjective expression and cooperation. This not only results in a cumbersome and time-consuming process but also carries a high risk of misdiagnosis and missed diagnosis. Therefore, there is an urgent need to develop a more objective, efficient, and accurate auxiliary diagnostic technology for depression. Biomarker detection, with its advantages of ease of operation and objective, quantifiable results, has demonstrated significant clinical value in early screening, risk warning, efficacy evaluation, and prognosis. Dopamine, a crucial monoamine neurotransmitter in the human central nervous system, participates in regulating important physiological processes such as reward prediction, fine motor control, and cognitive-emotional functions. Its abnormality is one of the pathogenic mechanisms of depression. Therefore, accurate monitoring of dopamine expression levels can provide key biochemical indicators for early warning, disease progression monitoring, and pharmacological evaluation of depression. However, dopamine is released through the synaptic cleft, and its local concentration exhibits significant transient fluctuations and high spatial heterogeneity in different brain regions. Therefore, achieving high-sensitivity and high-specificity dynamic detection of dopamine remains a huge challenge.

[0003] Currently, various technologies are used for dopamine detection. High-performance liquid chromatography (HPLC) has high detection limits and specificity, but its low sampling frequency and complex pretreatment make it unable to achieve real-time dynamic monitoring of dopamine. Electrochemical detection methods have fast response speeds, but their biocompatibility is limited and they are easily interfered with by substances with similar chemical properties. In the field of optical imaging, currently developed small-molecule fluorescent probes form thermodynamically stable complexes with dopamine, which are difficult to dissociate, thus only allowing the acquisition of dopamine concentration changes at a single time point, making it difficult to achieve real-time, continuous monitoring of dopamine. In addition to small-molecule fluorescent probes, a series of novel genetically encoded fluorescent probes have been developed, which significantly improve sensitivity, specificity, and spatiotemporal resolution. However, these fluorescent probes require transgenic or virus-mediated expression, which is costly, time-consuming, and affects the function of endogenous cellular proteins. In summary, there is an urgent need to develop a novel sensing method with high sensitivity, high specificity, and the ability to continuously detect changes in dopamine in real time. Summary of the Invention

[0004] To address the above technical problems, this invention provides a reversible fluorescent probe based on nanozyme / nucleic acid aptamer, its preparation method, and its application in real-time dopamine monitoring. This fluorescent probe enables high temporal resolution, high selectivity, and high sensitivity for dynamic real-time detection of dopamine.

[0005] The first objective of this invention is to provide a reversible fluorescent probe based on nanozymes / nucleic acid aptamers, comprising platinum nanoparticles and a nucleic acid triplet containing a dopamine aptamer coupled to the surface of the platinum nanoparticles; wherein the dopamine aptamer is modified with Cy3 dye in the middle and Cy5 dye at the 3' end.

[0006] The nucleic acid triplet also includes a nucleic acid fixation strand and a nucleic acid linker strand;

[0007] The nucleic acid linker connects the nucleic acid immobilized strand and the dopamine aptamer, and is anchored by a platinum-sulfur bond formed between the thiol group modified at the 5' end of the nucleic acid immobilized strand and the platinum nanoparticles.

[0008] In some embodiments of the present invention, the sequence of the nucleic acid fixed strand is shown in SEQ ID NO:1;

[0009] The sequence of the nucleic acid linker strand is shown in SEQ ID NO:2;

[0010] The sequence of the dopamine aptamer is shown in SEQ ID NO:3;

[0011] The platinum nanoparticles have a particle size of 2-3 nm.

[0012] The second objective of this invention is to provide a method for preparing a reversible fluorescent probe based on nanozymes / nucleic acid aptamers, comprising the following steps:

[0013] Platinum source and complex were mixed and stirred, a reducing agent was added, and the reaction was continued with stirring to obtain platinum nanoparticles.

[0014] The fixed nucleic acid strand, the linker nucleic acid strand, and the dopamine aptamer were mixed in PBS buffer solution (1×(0.1 M phosphate, pH = 7.4, 25 ℃) + 2 mM MgCl2) to obtain a mixture. The mixture was heated for thermal denaturation, cooled, and incubated for a longer period. A stable triplet structure of nucleic acid was formed through self-assembly by complementary base pairing.

[0015] The obtained nucleic acid triplet structure was mixed with the obtained platinum nanoparticle solution, sonicated and incubated with shaking to promote the formation of the composite structure; PB buffer and surfactant were added to the system, and sonicated again; then sodium chloride or potassium chloride solution was added, and ultrafiltration was used to purify the obtained nanozyme / nucleic acid aptamer-based reversible fluorescent probe.

[0016] In some embodiments of the present invention, the platinum source is selected from one or more of chloroplatinate hexahydrate, potassium chloroplatinate, and sodium chloroplatinate;

[0017] The mass ratio of the platinum source, complex, and reducing agent is (19-32):(15-25):(14-24);

[0018] The complex is selected from polyvinylpyrrolidone (PVP) and / or polyethylene glycol (PEG), and more preferably PVP. This invention achieves its benefits through the suitability of the complex: controlling the particle size of platinum nanoparticles: PVP can form a weak coordination complex with Pt(IV) ions in the platinum source, reducing the reduction potential and slowing down the reduction rate of metal ions, ultimately resulting in monodisperse platinum nanoparticles with a smaller size distribution. This enhances the stability of the nanoparticles and prevents their aggregation. The pyrrolidone ring of the PVP molecule contains N and O heteroatoms, which can undergo coordination adsorption with the surface of platinum nanocrystals through lone pair electrons; the hydrophobic polyethylene carbon chain provides steric hindrance in the solvent, preventing the nanoparticles from agglomerating.

[0019] The reducing agent is selected from sodium borohydride;

[0020] The temperature for continuous stirring reaction is 20℃-30℃, and the time is 12-30 h.

[0021] In some embodiments of the present invention, the molar ratio of the nucleic acid immobilization strand, the nucleic acid linker strand and the dopamine aptamer is (1:1:1)-(1:2:2).

[0022] The temperature for heat denaturation is 85℃-100℃, and the time for heat denaturation is 3-10 min.

[0023] In some embodiments of the present invention, the ratio of the amount of nucleic acid triplet structure to the amount of the obtained platinum nanoparticles is (1:1) to (1.5:1).

[0024] Conditions for cooling and continued incubation: Cool to 20-37℃ within 15-60 min, and continue incubation at 20-37℃ for 15-60 min;

[0025] The ultrasonic treatment time is 3-30 s, and the shaking incubation time is 20-40 min;

[0026] The surfactant is selected from Tween-20 and / or Tween-80;

[0027] The final mass fraction of the surfactant is 0.02-0.1%;

[0028] The final NaCl concentration in the system reached 100-300 mM.

[0029] A third objective of this invention is to provide the application of the aforementioned nanozyme / nucleic acid aptamer-based reversible fluorescent probe in the quantitative or qualitative detection of dopamine.

[0030] In some embodiments of the present invention, the concentration of the nanozyme / nucleic acid aptamer-based reversible fluorescent probe is 100-300 nM.

[0031] In some embodiments of the present invention, the concentration of dopamine is 1-1000 μM; wherein, the linear range is 1-10 μM.

[0032] The fourth objective of this invention is to provide the application of the aforementioned nanozyme / nucleic acid aptamer-based reversible fluorescent probe in real-time dopamine monitoring.

[0033] This invention constructs a reversible fluorescent probe based on nanozymes / nucleic acid aptamers. In the absence of dopamine, the dopamine-specific aptamer is in a relatively extended conformation, with a large distance between Cy3 and Cy5 dyes, preventing effective fluorescence resonance energy transfer (FRET). Therefore, the FRET signal of the system is extremely weak, remaining at the background level. When dopamine is present in the sample, it specifically binds to the dopamine aptamer, causing a conformational change and forming a folded structure. This reduces the spatial distance between the Cy3 and Cy5 dyes, generating a significant FRET signal. Furthermore, in the presence of oxygen, platinum nanoparticles catalyze the oxidation of dopamine, converting it into an oxidation product that dissociates from the aptamer. After releasing dopamine, the aptamer reverts to its initial extended conformation and can rebind to new dopamine molecules, thereby achieving cyclic recognition and dynamic sensing of dopamine.

[0034] The beneficial effects of this invention are:

[0035] Compared with existing technologies, this invention integrates the nanoenzyme-like oxidase catalytic function of platinum nanoparticles with the specific recognition of aptamers, enabling real-time dynamic detection of changes in dopamine levels. The fluorescent probe of this invention anchors a triplet containing a dopamine aptamer to the surface of platinum nanoparticles via platinum-sulfur bonds. Upon recognizing dopamine, the aptamer undergoes a conformational change, triggering a fluorescence resonance energy transfer (FRET) signal output. Subsequently, the platinum nanoparticles catalyze dopamine oxidation, causing the dopamine oxidation product to dissociate, and the aptamer returns to its initial conformation for the next dopamine recognition. Through this cyclic process, the probe can dynamically detect changes in dopamine concentration. The fluorescent probe preparation method provided by this invention is simple, possesses high temporal resolution, high sensitivity, and high specificity, and is suitable for dynamic monitoring of dopamine in complex cellular environments, providing an effective means for the early diagnosis of depression. Attached Figure Description

[0036] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...

[0037] Figure 1 This is the invention Figure 1 This is a schematic diagram illustrating the principle of dynamic dopamine sensing based on nanozyme / nucleic acid aptamer reversible fluorescent probes as described in this invention.

[0038] Figure 2 The image shows the violet-visible spectrum of the platinum nanoparticles prepared in this invention catalyzing the oxidation of dopamine.

[0039] Figure 3 The fluorescence spectra of the dopamine aptamer used in this invention reacting with different concentrations of dopamine are shown.

[0040] Figure 4 The images show the fluorescence of the dopamine aptamer used in this invention reacting with different substrates.

[0041] Figure 5 This is a transient fluorescence kinetic diagram of the reaction between the dopamine aptamer used in this invention and dopamine.

[0042] Figure 6 This invention relates to the fluorescence dynamics of the probe for cyclic detection of dopamine.

[0043] Figure 7 The fluorescence intensity change values ​​of 0-1000 μM dopamine obtained in the embodiments of the present invention are shown.

[0044] Figure 8 The fluorescence intensity change value of 0-10 μM dopamine obtained in the embodiments of the present invention is shown.

[0045] Figure 9 This is a dynamic fluorescence imaging image of dopamine in living cells using the probe of this invention.

[0046] Figure 10 This is a dynamic fluorescence imaging image of dopamine in live cells under electrical stimulation conditions using the probe of this invention.

[0047] Figure 11 This is a dynamic fluorescence imaging image and fluorescence statistics diagram of dopamine in live cells under cyclic electrical stimulation conditions, representing the probe of this invention.

[0048] Figure 12 This is a dopamine fluorescence imaging image of the probe of this invention in a cell model of depression and normal cells. Detailed Implementation

[0049] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0050] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer. DNA oligos were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and purified by HPLC. All reagents were prepared using ultrapure water.

[0051] Example 1

[0052] This embodiment provides a method for constructing a reversible fluorescent probe based on nanozymes / nucleic acid aptamers, as detailed below:

[0053] Step 1. Synthesis of Platinum Nanoparticles

[0054] 0.05 mmol of chloroplatinic acid hexahydrate and 20 mg of polyvinylpyrrolidone (PVP) were added to 45 mL of deionized water. After stirring vigorously at room temperature for 5 min, 5 mL of 100 mM sodium borohydride solution was added as a reducing agent. The reaction was continued to be stirred at room temperature for 24 h to obtain a platinum nanoparticle solution with an average particle size of 2-3 nm.

[0055] Step 2. Synthesis of nucleic acid triplet structures

[0056] The 5'-terminal modified nucleic acid immobilized strand has the sequence: 5'-HS-AAAAAAAAATTGTCTCGTTTTGGAGTCACACA-3' (sequence shown in SEQ ID NO:1). The polyadenine sequence achieves stable immobilization of the DNA strand on the platinum nanoparticle surface through high affinity with the platinum surface and the Pt-S bond formed by the thiol group and platinum. To ensure good reactivity of the thiol group modified at the 5' end of the immobilized strand, the immobilized strand (SEQ ID NO:1) was reduced before coupling in this embodiment. Specifically, excess TCEP reducing agent was added to the nucleic acid immobilized strand solution to remove any existing disulfide bonds and expose free thiol groups. The reaction was incubated at 25°C for 1 hour. The processed nucleic acid immobilized strands require no further purification and can be directly used for subsequent three-strand assembly. The intermediate linker sequence (as shown in SEQ ID NO:2) used to connect the nucleic acid immobilized strands to the dopamine aptamer (sequence shown in SEQ ID NO:3) is 5'-AGCATTAATCACCGTGGCTGTGTGACTCCAAAA-3'. To construct a fluorescence resonance energy transfer signal pair, the 5' end of the dopamine aptamer recognition portion of this sequence is modified with the fluorescent donor Cy3; the 3' end is modified with the fluorescent acceptor Cy5. Complete sequence: 5'-GCCACCGGTGATTAATGCTTTTTTTTT-Cy3- ACGCCAGTTTGAAGGTTCGTTCGCAGGTGTGGAGTGACGT -Cy5-3'. The three strands were mixed in a 1:1:1 molar ratio in PBS buffer solution (PBS, 1 × (0.1 M phosphate, pH = 7.4 @ 25℃) + 2 mM MgCl2) to obtain a mixture. The mixture was subjected to heat denaturation at 95℃ for 5 min, followed by slow cooling to 25℃ over 35 min, and then incubated at 25℃ for another 30 min. Stable triplet nucleic acid structures were formed through self-assembly via complementary base pairing.

[0057] Step 3. Assembly of reversible fluorescent probes based on nanozymes / nucleic acid aptamers

[0058] The 50 μL 10 μM / L nucleic acid triplet structure (500 pmol) obtained in step 2 was mixed with the 200 μL 2.09 μM / L platinum nanoparticle (418 pmol) solution obtained in step 1, and the mixture was briefly sonicated (approximately 5 s) and incubated with shaking for 30 min to promote the formation of the composite structure. PB buffer (final concentration 0.01 M) and surfactant Tween-20 (0.05% by mass) were added to the system, and the mixture was again briefly sonicated (approximately 5 s) and shaken for 30 min to improve system stability. Subsequently, sodium chloride solution was added stepwise to achieve a final NaCl concentration of 150 mM to enhance the structural stability of the composite probe. Finally, the system was purified by ultrafiltration using Merck ultrafiltration centrifuge tubes with a molecular weight cutoff of 100 kDa, repeated three times to remove unbound components, yielding the final platinum nanoparticle-nucleic acid composite probe, i.e., the reversible fluorescent probe based on nanozyme / nucleic acid aptamer.

[0059] Example 2

[0060] This embodiment provides the platinum nanoparticles obtained in Example 1 for catalytic oxidation of dopamine, as detailed below:

[0061] Take 10 μL of the platinum nanoparticles synthesized in Example 1 and add it to 90 μL (1×PBS + 2 mM Mg). 2+ The solution was prepared in a buffer solution (pH=7.4). A total volume of 100 μL was added to a final concentration of 20 μM dopamine solution, and the UV-Vis spectral changes at 0.5 min, 1 min, 3 min, 5 min, 7 min, and 10 min were detected using a UV spectrophotometer. The spectral detection range was 300 nm–800 nm. Figure 2 As shown, the platinum nanoparticles synthesized in this invention have good oxidase-like activity and can effectively catalyze the oxidation of dopamine.

[0062] Example 3

[0063] The reaction of dopamine aptamers with different concentrations of dopamine.

[0064] The nucleic acid sequence (dopamine aptamer) shown in SEQ ID NO:3 was dissolved in buffer (1×PBS, containing 2 mg / mL). 2+ Prepare a 1 μM nucleic acid solution in a solution of [pH 7.4]. Transfer the solution to a PCR instrument and heat-denature the mixture at 95°C for 5 min, then slowly cool it to 25°C over 35 min and incubate at 25°C for another 30 min. Mix the test solution with dopamine solutions of 0 μM, 3 μM, 10 μM, 30 μM, 50 μM, 100 μM, 300 μM, and 1000 μM for 1 min, and immediately detect the fluorescence spectrum. Figure 3 As shown, the dopamine aptamer used in the invention can specifically bind to different concentrations of dopamine and generate a fluorescence signal that varies with concentration.

[0065] Example 4

[0066] The reaction of dopamine aptamers with different substrates.

[0067] The nucleic acid sequence (dopamine aptamer) shown in SEQ ID NO:3 was dissolved in buffer (1×PBS, containing 2 mg / mL). 2+ Prepare a 1 μM nucleic acid solution in a solution of [pH 7.4]. Transfer the solution to a PCR instrument and heat-denature the mixture at 95°C for 5 min. Then, slowly cool the solution to 25°C over 35 min and incubate it at 25°C for another 30 min to obtain the test solution. Mix the test solution with solutions of dopamine (DA), norepinephrine (NE), epinephrine (EP), histamine (HA), glutamate (Glu), acetylcholine (ACh), serotonin (5-HT), lysine (Lys), threonine (Thr), cysteine ​​(Cys), serine (Ser), and glutathione (GSH) at a final concentration of 20 μM for 1 min, and immediately detect the fluorescence spectrum. Figure 4 As shown, compared with various physiological interference small molecules, dopamine and dopamine aptamers can produce obvious fluorescence response, proving that the aptamer has excellent recognition specificity and anti-interference performance for dopamine.

[0068] Example 5

[0069] This embodiment provides a fluorescence kinetic monitoring method for dopamine aptamers and dopamine, as detailed below:

[0070] The nucleic acid sequence (dopamine aptamer) shown in SEQ ID NO:3 was dissolved in buffer (1×PBS, containing 2 mM Mg). 2 + A nucleic acid solution with a final concentration of 1 μM was prepared in a solution (pH 7.4). The solution was transferred to a PCR instrument, and the mixture was subjected to heat denaturation at 95°C for 5 min. Subsequently, it was slowly cooled to 25°C over 35 min and incubated at 25°C for another 30 min to obtain the test solution. The test solution was then reacted with a dopamine solution with a final concentration of 200 μM. The fluorescence channel parameters of the fluorescence spectrometer were set as follows: excitation wavelength 546 nm, emission wavelength 566 nm. Figure 5 As shown, the dopamine aptamer used in this invention can recognize dopamine on a millisecond timescale, indicating that the aptamer has a rapid response capability to dopamine.

[0071] Example 6

[0072] This embodiment provides a verification of a dopamine cycle detection mechanism, as detailed below:

[0073] Take 10 μL of the ultrafiltration purified platinum nanoparticle-nucleic acid composite probe solution from Example 1 and add it to 90 μL (1×PBS + 2 mM Mg). 2+ , Mix thoroughly in a buffer solution (pH = 7.4). Real-time signal acquisition is performed using a fluorescence spectrophotometer. The fluorescence scanning parameters are set as follows: Cy3 channel excitation wavelength 546 nm, FRET channel excitation wavelength 546 nm, Cy3 channel emission wavelength 566 nm, and FRET channel emission wavelength 666 nm. Add dopamine solution (to a final concentration of 20 μM) to the above system and begin detection. Plot the reaction time on the x-axis and calculate the ratio I of the FRET channel fluorescence intensity to the Cy3 channel fluorescence intensity. Cy5 / I Cy3 The dynamic response curve is plotted using the change as the ordinate. For example... Figure 6 As shown, the fluorescence ratio signal of the system rapidly increased after multiple additions of dopamine, and then automatically recovered to the baseline level over time, proving that the probe can achieve real-time and continuous dynamic monitoring of dopamine concentration. Figure 1 The mechanism by which the fluorescent probe of this invention monitors dopamine in real time is demonstrated.

[0074] Example 7

[0075] This invention utilizes a fluorescent probe to measure fluorescence kinetics. The probe was synthesized according to the preparation method in Example 1. 10 μL of ultrafiltration-purified platinum nanoparticle-nucleic acid composite probe solution was added to 90 μL of (1×PBS + 2 mM MgSO4) solution.2+ , Mix thoroughly in a buffer solution (pH = 7.4). Add different concentrations (0-1000 μM) of dopamine to the system simultaneously, measure the reaction kinetics, extract the fluorescence signal changes for each sample, and fit a detection standard curve showing the change in fluorescence signal with dopamine concentration. Figure 7 As shown, the standard curve represents the fluorescence signal intensity of dopamine from 0 to 1000 μM; Figure 8 As shown, the standard curve represents the fluorescence signal intensity of 0-10 μM dopamine. The horizontal axis represents the concentration of added dopamine, and the vertical axis represents the change in fluorescence peak value of the probe in response to dopamine relative to the baseline level after the addition of dopamine. I represents fluorescence intensity, y = 0.02586x + 1.319 * 10 -4 R 2 = 0.9999. The detection limit is 0.32 μM. The detection standard curve shows that the fluorescent probe of the present invention has excellent sensitivity (the detection index is the ratio of the fluorescence value of the fluorescence emission channel at 666 nm to that at 566 nm, where 666 nm corresponds to Cy5 and 566 nm corresponds to Cy3).

[0076] Example 8

[0077] Dynamic imaging of dopamine in living cells.

[0078] (1) The steps for culturing PC12 cells are as follows: Incubate the frozen PC12 cells in a water bath at 37°C for 1 to 2 minutes. After complete thawing, centrifuge and remove the supernatant. Resuspend the cells in fresh DMEM medium containing 10% fetal bovine serum and 1% penicillin antibiotics. Use a sterile pipette to aspirate and add the cells to 10 ml of freshly prepared DMEM medium containing 10% fetal bovine serum and 1% penicillin antibiotics. Shake clockwise to mix. Place the cells in an incubator and maintain the incubator at 37°C and 5% carbon dioxide. After one to two days of confluence, passage the cells.

[0079] (2) The passage steps of PC12 are as follows: Discard the supernatant of the cultured cells, wash the residual liquid with sterile PBS, add 1 ml of trypsin and digest at 37°C for 1 min, add an equal volume of DMEM medium containing 10% fetal bovine serum and 1% penicillin antibiotics to stop the digestion, and aspirate the cells into a centrifuge tube; centrifuge at 1000 r for 5 min and discard the supernatant; resuspend in DMEM medium containing 10% fetal bovine serum and 1% penicillin antibiotics, divide into two culture dishes containing fresh medium, gently shake and place in an incubator.

[0080] (3) Dynamic imaging of cells using probes: The cells were digested and transferred to centrifuge tubes, centrifuged at 1000 r for 5 min, and the supernatant was removed; the cells were resuspended in DMEM medium containing 10% fetal bovine serum and 1% penicillin antibody, and cultured in confocal dishes; after cell adhesion, the culture medium was pre-added with the purified and adjusted volume to 200 uL of the nanozyme / nucleic acid aptamer-based reversible fluorescent probe (2.09 μM / L, n=418 pmol) obtained in Example 1, gently shaken, and incubated in a 37℃ and 5% carbon dioxide incubator for 8 hours; 100 μM dopamine was added exogenously, and the Cy3 channel and FRET channel were imaged and analyzed using a laser confocal microscope. Figure 9 As shown, the present invention has good dopamine dynamic sensing capability in complex cellular environments.

[0081] Example 9

[0082] Dynamic fluorescence imaging of dopamine in live cells under electrical stimulation conditions using fluorescent probes.

[0083] (1) Setup of the electrostimulation device. A carbon fiber microelectrode with a tip diameter of approximately 5-10 μm was fixed using a robotic arm and connected to a Chenhua CHI 832d electrochemical workstation as the working electrode, and an Ag / AgCl electrode as the counter electrode and reference electrode. The electrochemical method used differential pulse current detection. E1 was 2.0 V, T1 was 0.01 s, E2 was 0 V, T2 was 0.04 s, and the cycle was 50. The pulse current was 20 Hz, with 50 pulses.

[0084] (2) Fluorescence Imaging. The microelectrode was brought close to the surface of a single cell by adjusting the robotic arm. Under electrical stimulation, the kinetics of PC12 cells were monitored using a fluorescence microscope in the Cy3 fluorescence channel. Figure 10 As shown, the fluorescent probe of this invention can rapidly monitor the dopamine release process in PC12 cells in real time.

[0085] Example 10

[0086] The present invention provides a dynamic fluorescence imaging diagram and fluorescence statistics diagram of live-cell dopamine under cyclic electrical stimulation conditions using the fluorescent probe of this invention.

[0087] The microelectrode was brought close to the surface of a single cell by adjusting the robotic arm. Under four cycles of electrical stimulation with a pulsed current of 20 Hz and 50 pulses, fluorescence images of PC12 cells in the Cy3 fluorescence channel were captured using a fluorescence microscope one second after each stimulation, and the fluorescence images one second after each stimulation were statistically analyzed. Figure 11 As shown, the fluorescent probe of the present invention has good continuous monitoring capability.

[0088] Example 11

[0089] Fluorescence imaging of dopamine in a cell model of depression and in normal cells.

[0090] (1) Establishment of a cell model of depression. Adherent PC12 cells that had been passaged into confocal dishes in advance were incubated with corticosterone at a final concentration of 200 μM for 12 h to obtain a cell model of depression.

[0091] (2) Fluorescence Imaging. The microelectrode was brought close to the surface of a single cell by adjusting the robotic arm. Under electrical stimulation, fluorescence microscopy was used to monitor the cell model of depression and normal cells in the Cy3 fluorescence channel. Figure 12 As shown, the fluorescent probe of this invention can highly sensitively monitor the dopamine release level in a depression cell model and normal cells in real time.

[0092] The embodiments described above are merely preferred embodiments for fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention.

Claims

1. A reversible fluorescent probe based on nanozymes / nucleic acid aptamers, characterized in that, The invention comprises platinum nanoparticles and a nucleic acid triplet containing a dopamine aptamer coupled to the surface of the platinum nanoparticles; the dopamine aptamer is modified with Cy3 dye in the middle and Cy5 dye at the 3' end; The nucleic acid triplet also includes a nucleic acid fixation strand and a nucleic acid linker strand; The nucleic acid linker connects the nucleic acid immobilized strand and the dopamine aptamer, and is anchored by a platinum-sulfur bond formed between the thiol group modified at the 5' end of the nucleic acid immobilized strand and the platinum nanoparticles.

2. The reversible fluorescent probe based on nanozyme / nucleic acid aptamer according to claim 1, characterized in that, The sequence of the fixed nucleic acid strand is shown in SEQ ID NO:1; The sequence of the nucleic acid linker strand is shown in SEQ ID NO:2; The sequence of the dopamine aptamer is shown in SEQ ID NO:3; The platinum nanoparticles have a particle size of 2-3 nm.

3. The method for preparing a reversible fluorescent probe based on nanozyme / nucleic acid aptamer as described in claim 1 or 2, characterized in that, Includes the following steps: Platinum source and complex were mixed and stirred, a reducing agent was added, and the reaction was continued with stirring to obtain platinum nanoparticles. The fixed nucleic acid strand, the linker nucleic acid strand, and the dopamine aptamer were mixed in a buffer solution to obtain a mixture, which was then heated for thermal denaturation, cooled, and incubated for a longer period. A stable triplet nucleic acid structure was formed through self-assembly via complementary base pairing. The obtained nucleic acid triplet structure was mixed with the obtained platinum nanoparticle solution, sonicated and incubated with shaking to promote the formation of the composite structure; PB buffer and surfactant were added to the system, and sonicated again; then sodium chloride or potassium chloride solution was added, and ultrafiltration was used to purify the obtained nanozyme / nucleic acid aptamer-based reversible fluorescent probe.

4. The preparation method according to claim 3, characterized in that, The platinum source is selected from one or more of chloroplatinate hexahydrate, potassium chloroplatinate, and sodium chloroplatinate. The mass ratio of the platinum source, complex, and reducing agent is (19-32):(15-25):(14-24); The reducing agent is selected from sodium borohydride; The complex is selected from polyvinylpyrrolidone and / or polyethylene glycol; The temperature for continuous stirring reaction is 20℃-30℃, and the time is 12-30 h.

5. The preparation method according to claim 3, characterized in that, The molar ratio of the nucleic acid immobilized strand, the nucleic acid linker strand and the dopamine aptamer is (1:1:1)-(1:2:2). The temperature for heat denaturation is 85℃-100℃, and the time for heat denaturation is 3-10 min.

6. The preparation method according to claim 3, characterized in that, The molar ratio of the nucleic acid triplet structure to the obtained platinum nanoparticles was (1:1) to (1.5:1). Conditions for cooling and continued incubation: Cool to 20-37℃ within 15-60 min, and continue incubation at 20-37℃ for 15-60 min; The ultrasonic treatment time is 3-30 s, and the shaking incubation time is 20-40 min; The surfactant is selected from Tween-20 and / or Tween-80; The final mass fraction of the surfactant is 0.02-0.1%; The final NaCl concentration in the system reached 100-300 mM.

7. The application of the nanozyme / nucleic acid aptamer-based reversible fluorescent probe as described in claim 1 or 2 in the quantitative or qualitative detection of dopamine.

8. The application according to claim 7, characterized in that, The concentration of the nanozyme / nucleic acid aptamer-based reversible fluorescent probe is 100-300 nM.

9. The application according to claim 7, characterized in that, The concentration of the dopamine is 1-1000 μM.

10. The application of the nanozyme / nucleic acid aptamer-based reversible fluorescent probe as described in claim 1 or 2 in real-time dopamine monitoring.

Images