A lateral flow test strip platform for detecting sugarcane smut and stalk rot in afterglow and colorimetric dual mode and a preparation method and application thereof

Abstract

The application provides a lateral chromatographic test strip platform for detecting sugarcane smut and top rot in a residual image and colorimetric dual-mode, and a preparation method and application thereof, and belongs to the technical field of detection. The lateral chromatographic test strip is composed of a combination pad, an NC membrane, a water absorption pad and a bottom plate; wherein the combination pad, the NC membrane and the water absorption pad are attached to the bottom plate, the NC membrane is provided with a capture line and a quality control line, the capture line is sprayed with a coupling agent of a capture probe and streptavidin; the quality control line is sprayed with a coupling agent of a quality control probe and streptavidin; the quality control probe is complementary to a DNA sequence in the colorimetric and residual image probes. The application utilizes the nanoparticles of CDs@dSiO2 with residual image characteristics and the Au nanoparticles which are red in color to detect sugarcane smut and top rot, realizes qualitative detection through color visualization and residual image light imaging, realizes quantitative detection through the ratio of the capture line and the quality control line, and has the advantages of rapidness, sensitivity, low cost, easy operation and the like.

Description

Technical Field

[0001] This invention relates to the field of detection technology, and in particular to a lateral chromatography test strip platform for detecting sugarcane smut and top rot in a dual-mode (afterglow and colorimetric) approach, as well as its preparation method and application. Background Technology

[0002] Sugarcane is one of the world's most important economic crops, serving as a major source of sugar and a key raw material for the emerging bioenergy industry. However, sugarcane production has long been severely threatened by various fungal diseases, among which smut and top rot are the two most widespread and economically damaging. Sugarcane smut is caused by the fungus *Ustilago maydis*. After infection, sugarcane lateral buds sprout earlier, producing a black, whip-like smut. Compared to healthy plants, the main stem is stunted, the leaves are thin and mostly light green, and there is an increase in ineffective tillers, often accompanied by the production of black whip-like structures. This disease not only reduces sugarcane stem yield but also significantly lowers sucrose content and quality. Sugarcane top rot is a severely destructive fungal disease caused by *Fusarium*. Early symptoms include yellowing and twisting of young leaves, stunted growth, and cracks appearing along the leaves, leading to a reduction in the number of effective stems. This affects the normal growth and development of sugarcane, resulting in a significant reduction in yield. Studies have shown that top rot can reduce sugarcane yield by 10-30% and sucrose content by 15-30%. Therefore, early prediction and diagnosis of sugarcane smut and top rot are of great significance and play a positive role in improving the economic benefits of the sugarcane industry.

[0003] Lateral chromatography (LFIA) has been widely used in the field of rapid pathogen detection in recent years due to its outstanding advantages such as ease of operation, no need for instruments, intuitive results, and rapid detection. However, there are currently no reports on lateral chromatography test strips that can simultaneously detect sugarcane smut and top rot. Summary of the Invention

[0004] To overcome the shortcomings of the prior art, this invention proposes a lateral chromatography test strip platform for the dual-mode detection of sugarcane smut and top rot using both afterglow and colorimetric methods, along with its preparation method and applications. This platform integrates the identification capabilities of both diseases on the same detection line. When either target is present in the sample, the detection line generates a positive signal, achieving comprehensive detection of these two major fungal diseases of sugarcane. CDs@dSiO2 nanoparticles, with their unique afterglow luminescence properties, can be used for high signal-to-noise ratio detection of sugarcane smut pathogens; Au nanoparticles, exhibiting a wine-red color due to their localized surface plasmon resonance properties, can be used for the visual detection of sugarcane top rot pathogens. By combining biocompatible afterglow and colorimetric materials with nucleic acid amplification technology, signal amplification can be achieved, providing a rapid, simple, and easy-to-operate detection and analysis method for the early prediction and diagnosis of sugarcane smut and top rot diseases.

[0005] To achieve the above objectives, the technical solution of the present invention is as follows:

[0006] The first aspect of this invention provides a lateral chromatography test strip platform for dual-mode detection of sugarcane smut and top rot using afterglow and colorimetric methods, comprising:

[0007] Base plate;

[0008] An NC membrane is attached to the top of the base plate, with capture lines and quality control lines spaced apart.

[0009] The bonding pad is attached to one side of the base plate, close to the capture line;

[0010] An absorbent pad is attached to the other side of the base plate, close to the quality control line;

[0011] The capture line is coated with a conjugate of capture probe and streptavidin; the 3' end of the capture probe is biotin-labeled.

[0012] The quality control line is coated with a conjugate of the quality control probe and streptavidin; the 3' end of the quality control probe is biotin-labeled; the quality control probe is complementary to the DNA sequences of the CDs@dSiO2-DNA1 probe and the Au-DNA2 probe, respectively.

[0013] The nucleotide sequence of the capture probe is: CGCCTACCTACTAAAAGTCAGCCCAAAAA; the nucleotide sequence of the quality control probe is: CTAGTAATAGGAGAAAAAATACAACCAGCGTAAAA;

[0014] The nucleotide sequence of DNA1 in the CDs@dSiO2-DNA1 probe is: AAAATTCTCCTATTACTAG; the nucleotide sequence of DNA2 in the Au-DNA2 probe is: ACGCTGGTTGTAAAAA.

[0015] Preferably, the preparation method of the CDs@dSiO2-DNA1 probe includes the following steps:

[0016] a1. CDs@dSiO2 nanoparticles were mixed with a MES solution containing EDC and NHS and activated to obtain activated CDs@dSiO2 nanoparticles.

[0017] a2. The activated CDs@dSiO2 nanoparticles were mixed with PBS buffer and streptavidin solution and vortexed to obtain a reaction system containing CDs@dSiO2@SA nanoparticles.

[0018] a3. Add DNA1 to the reaction system containing CDs@dSiO2@SA nanoparticles, mix with CDs@dSiO2@SA nanoparticles, and incubate at 2-4 ℃;

[0019] a4. Continue adding BSA, vortex, and perform a blocking process to finally obtain the CDs@dSiO2-DNA1 probe;

[0020] The preparation method of the Au-DNA2 probe includes the following steps:

[0021] b1. Mix the thiol-modified DNA2 with TE buffer containing TCEP to obtain activated DNA2;

[0022] b2. Mix the activated DNA2 with Au nanoparticles and incubate at 2-4 ℃;

[0023] b3. Add MCH, vortex, and seal to obtain the Au-DNA2 probe.

[0024] More preferably, in step a1, the amount of CDs@dSiO2 nanoparticles is 10-20 mg, the amount of MES solution containing EDC and NHS is 10-20 mL, the volume concentration of EDC is 10-20%, the volume concentration of NHS is 5-10%, and the activation time is 0.5-1 h.

[0025] In step a2, the volume of PBS buffer is 10-20 mL, the volume of streptavidin solution is 50-80 μL, the concentration is 4-10 mg / mL, and the vortexing time is 2-3 h.

[0026] In step a3, the amount of DNA1 used is 50-80 μL, and the incubation time is 10-12 h;

[0027] In step a4, the amount of BSA used is 20-30 μL, the concentration is 10%, and the vortexing time is 2-3 h;

[0028] In step b1, the volume of TE buffer containing TCEP is 55-65 μL, and the concentration of TCEP is 5-10 mM.

[0029] In step b2, the amount of activated DNA2 used is 10-20 μL;

[0030] In step b3, the amount of MCH used is 5-10 μL, the concentration is 5-10 mM, and the vortexing time is 1-2 h. The thiol-modified DNA2 refers to DNA2 that is itself modified with thiol groups.

[0031] Preferably, the preparation method of the CDs@dSiO2 nanoparticles includes the following steps:

[0032] c1. Dissolve triethanolamine and carbon dots in water and heat to 70-85℃ for 20-60 min with stirring. Add sodium salicylate and hexadecyltrimethylammonium bromide and react for 0.6-2 h with stirring at the same temperature. Then add TEOS dropwise and continue the reaction for another 2-3 h to obtain the mixed system after reaction.

[0033] c2. Centrifuge the mixture after the reaction to collect the precipitate, wash it, and obtain CDs@dSiO2 nanoparticles;

[0034] The preparation method of the Au nanoparticles includes the following steps:

[0035] d1. Add chloroauric acid diluted by a certain factor to the reaction vessel, heat to boiling, slowly add sodium citrate and cool down. After the color turns wine red, stop heating and stirring after reacting for a period of time and cool to room temperature to obtain the mixed system after the reaction.

[0036] d2. After the reaction, the mixture was centrifuged to collect the precipitate, washed, and Au nanoparticles were obtained.

[0037] More preferably, in step c1, the amount of triethanolamine is 60-75 mg, the amount of carbon dots is 320-360 mg, the amount of sodium salicylate is 160-180 mg, the amount of hexadecyltrimethylammonium bromide is 370-380 mg, and the amount of TEOS is 4-6 mL.

[0038] In step c2, the product is washed with ethanol and water successively until the supernatant becomes clear; the obtained CDs@dSiO2 nanoparticles are dispersed in ultrapure water for later use.

[0039] In step d1, the dilution is specifically to dilute 1-2 mL of 1% chloroauric acid to 100 mL, and the amount of sodium citrate used is 1-2 mL with a concentration of 2%; after the color turns wine red, the reaction time is 5-15 min.

[0040] In step d2, the obtained Au nanoparticles are dispersed in TE buffer for later use.

[0041] The second aspect of this invention provides a method for preparing the lateral chromatography test strip platform for the dual-mode detection of sugarcane smut and top rot using afterglow and colorimetric methods, as described above, comprising the following steps:

[0042] (1) Preparation of the capture probe and streptavidin conjugate: Mix the capture probe and streptavidin aqueous solution, incubate, and conjugate to obtain the capture probe and streptavidin conjugate;

[0043] (2) Preparation of the conjugate of the quality control probe and streptavidin; mixing the quality control probe and streptavidin aqueous solution, incubating, and conjugating to obtain the conjugate of the quality control probe and streptavidin;

[0044] (3) The NC membrane, conjugation pad, and absorbent pad are attached to the base plate. The conjugates of the capture probe and streptavidin and the conjugates of the quality control probe and streptavidin are loaded onto the gliding membrane apparatus respectively, and the capture line and quality control line are sprayed and drawn on the NC membrane respectively. After spraying, the membrane is placed in an oven at 35-38 °C to dry and cut into single test strips to obtain the lateral chromatography test strip platform for the dual-mode detection of sugarcane smut and top rot of afterglow and colorimetry.

[0045] The third aspect of this invention provides the application of the lateral chromatography test strip platform for detecting sugarcane smut and top rot using the afterglow and colorimetric dual-mode detection of sugarcane smut and top rot as described above, or the lateral chromatography test strip platform for detecting sugarcane smut and top rot prepared by the preparation method described above, in the detection of sugarcane smut and / or top rot.

[0046] The fourth aspect of this invention provides a method for detecting sugarcane smut and / or top rot using a lateral chromatography test strip platform with afterglow and colorimetric dual modes as described above. The method includes the following steps: mixing and incubating the DNA signal amplification solution after entropy-driven and catalytic hairpin cycle amplification with the CDs@dSiO2-DNA1 probe and Au-DNA2 probe; then centrifuging to separate the solids, dispersing them in PBS buffer, and adding them to the binding pad of the test strip. In colorimetric mode, a signal appearing at the capture line indicates a positive result for top rot, and no signal appearing at the capture line indicates a negative result for top rot. In afterglow mode, a signal appearing at the capture line indicates a positive result for smut, and no signal appearing at the capture line indicates a negative result for smut.

[0047] Preferably, the preparation method of the DNA signal amplification solution after entropy-driven and catalytic hairpin cycle amplification includes the following steps:

[0048] (1) Preparation of A1-A2-A3 triple chain: The A1, A2 and A3 chains were heated and annealed, and then cooled to room temperature to obtain the A1-A2-A3 triple chain;

[0049] The nucleic acid sequence structure of chain A1 is: CAACCTCAATCGACCTCTCATTCTAATCTTCACCAGCGACGCAGACCAAAAA; the nucleotide sequence of chain A2 is: AAAAAAATATACGTGGTCTGCGTCGCTGGTGAAGATT; and the nucleotide sequence of chain A3 is: AGTAGGTAGGCGCTAGTAATAGGAGAATGAGAGGTCGATTG.

[0050] (2) Preparation of A1-A2-A3-MB: After activating the carboxylated magnetic beads with EDC and NHS, the activated magnetic beads were obtained. The A1-A2-A3 triple chain was mixed with the activated magnetic beads, then magnetically separated and dispersed to obtain A1-A2-A3-MB, which was stored in a refrigerator at 2-4 ℃.

[0051] (3) Preparation of hairpin B1 chain: The B1 chain was heated and annealed, and then cooled to room temperature to obtain hairpin B1 chain;

[0052] The nucleotide sequence of B1 is: AAAATGGGATCATTACCGAGTTTACAACCAGCGTAACTCGGTAATG;

[0053] (4) Preparation of B1-MB: After activating the carboxylated magnetic beads with EDC and NHS, the activated magnetic beads were obtained. The hairpin B1 chain was mixed with the activated magnetic beads, then magnetically separated and dispersed to obtain B1-MB, which was stored in a refrigerator at 2-4 ℃.

[0054] (5) Preparation of P double strands: Mix B2 strands and B3 strands and incubate, then cool to room temperature to obtain P double strands; wherein, the nucleotide sequence of B2 strand is: CATTACCGAGTTACGCTGGTTGTAAACTCGGTAATGATCCCA; wherein, the nucleotide sequence of B3 strand is: TGGGCTGACTACAACCAGCGT.

[0055] (6) Mix the DNA, A1-A2-A3-MB, and A from the sample to be tested. 4、 After mixing and incubating the B1-MB and P double strands, the solution was magnetically separated to obtain the DNA signal amplification solution after entropy-driven and catalytic hairpin cycle amplification. The nucleotide sequence of target A is: TGAGAGGTCGATTGAGGTTG; the nucleotide sequence of target B is: GTTGTAAACTCGGTAATGATCCCT; and the nucleotide sequence of A4 chain is: TGGTCTGCGTCGCTGGTGAAGATTAGAATGAGAGGTCGATTG.

[0056] More preferably, in step (1), the heating temperature is 80-95℃ and the annealing time is 5-15 min;

[0057] In step (2), the specific activation steps include: taking a certain volume of carboxylated magnetic beads, washing them with PBS, then dispersing them in an equal volume of PBS, adding the same volume of PBS solution containing 5-10 mM EDC and 10-20 mM NHS, incubating at 37℃ for 1-2 h to activate the carboxyl groups on the carboxylated magnetic beads, and then washing them three times with PBS to obtain the activated magnetic beads; the specific steps of mixing the A1-A2-A3 triple strands with the activated magnetic beads include: mixing in a shaker at 37℃ for 12-18 h;

[0058] In step (3), the heating temperature is 80-95℃ and the annealing time is 5-15 min;

[0059] In step (4), the specific activation steps include: taking a certain volume of carboxylated magnetic beads, washing them with PBS, then dispersing them in an equal volume of PBS, adding the same volume of PBS solution containing 5-10 mM EDC and 10-20 mM NHS, incubating at 37°C for 1-2 h to activate the carboxyl groups on the carboxylated magnetic beads, and then washing them three times with PBS to obtain the activated magnetic beads; mixing the hairpin B1 chain with the activated magnetic beads specifically includes: mixing on a shaker at 37°C for 12-18 h;

[0060] In step (5), the incubation of B2 and B3 chains specifically includes mixing them in a shaker at 37 ℃ for 1.5-3 h;

[0061] In step (6), the DNA, A1-A2-A3-MB, and A of the sample to be tested are... 4、 The incubation process after mixing B1-MB and P double strands specifically involves: mixing the DNA sample to be tested, solutions of A1-A2-A3-MB and B1-MB together, adding A4 strand and P double strand, incubating on a shaker at 37°C for 1.5 h, then magnetically separating, retaining the supernatant to obtain the entropy-driven and catalytic hairpin cyclic amplification DNA signal amplification solution, which is then stored in a refrigerator at 2-4°C.

[0062] In the above technical solutions, the "%" used to indicate concentration refers to mass concentration unless otherwise specified.

[0063] The specific reagents or materials involved are described in Chinese as follows:

[0064] NC membrane: nitrocellulose membrane; PBS buffer: phosphate buffer solution; BSA: bovine serum albumin; MCH: methylcyclohexane; EDC: 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide; NHS: N-hydroxysuccinimide; MES: 2-(N-morpholino)ethanesulfonic acid; TCEP: tris(2-carboxyethyl)phosphine; TE buffer: prepared from Tris and EDTA; TEOS: tetraethoxysilane;

[0065] Compared with the prior art, the present invention has the following beneficial effects:

[0066] (1) This invention provides a lateral chromatography test strip platform for the dual-mode detection of sugarcane smut and top rot using afterglow and colorimetric methods, enabling the detection of sugarcane smut and top rot. Specifically, smut detection employs entropy-driven amplification, while top rot detection utilizes catalytic hairpin self-assembly amplification; both cyclic amplification strategies are performed simultaneously on the same detection platform without interference. This test strip significantly reduces detection costs and operation time, improves applicability and flexibility, and can meet the diverse detection needs of sugarcane growing areas.

[0067] (2) This invention uses two signal materials to label two diseases respectively: CDs@dSiO2 nanoparticles with afterglow characteristics are used for the detection of smut. Unlike traditional fluorescent test strips, afterglow detection is performed after photoexcitation is stopped, which completely eliminates the background interference caused by the self-fluorescence of sugarcane tissue and the scattering of excitation light; Au nanoparticles with their own red colorimetric signal are used for the detection of top rot. The two signals do not overlap and can be read separately according to the detection requirements: CDs@dSiO2 provides afterglow emission signal, which can be analyzed by the construction of a smart camera device in conjunction with a mobile phone App to achieve qualitative and quantitative determination; Au nanoparticles provide a red colorimetric signal that is directly visible to the naked eye to achieve rapid qualitative screening; the two signal modes complement each other, taking into account both the convenience of on-site detection and the precise quantitative requirements of laboratory detection.

[0068] (3) The test strip platform of the present invention introduces two enzyme-free cyclic amplification technologies: entropy-driven amplification and catalytic hairpin self-assembly. Entropy-driven amplification targets the smut gene, while catalytic hairpin self-assembly targets the shoot rot gene. Both amplification methods can achieve efficient cyclic amplification of trace targets. At the same time, the loading of signal material on the amplification product is significantly increased, effectively amplifying the detection signal, which is superior to traditional PCR-dependent or single-signal amplification test strips.

[0069] (4) The test strip platform of the present invention allows for visual identification of shoot rot detection results and signal reading of smut detection results via a mobile APP and intelligent camera device. Compared with traditional test strips, the present invention has significant advantages such as simple operation, rapid detection, low cost, and low instrument dependence. Attached Figure Description

[0070] Figure 1 This is a schematic diagram of the test strip assembly of the present invention.

[0071] Figure 2This is a flowchart of the test strip for detecting sugarcane smut and top rot of the present invention. Part A shows the preparation process of CDs@dSiO2-DNA1 and Au-DNA2, Part B is a schematic diagram of the DNA signal amplification structure mediated by EDC (entropy-driven) and CHA (catalytic hairpin self-assembly), and Part C is a schematic diagram of the principle of detecting sugarcane smut and top rot.

[0072] Figure 3 This is a schematic diagram of the dark box structure designed for afterglow mode in this invention.

[0073] Figure 4 The following are the results and standard curves for different detection modes corresponding to different concentrations of sugarcane smut and top rot detected by the test strips of the present invention: A. Standard curve for top rot detection, B. Result graph for top rot detection, C. Standard curve for smut detection, D. Result graph for smut detection.

[0074] In the diagram, 1 is the base plate, 2 is the absorbent pad, 3 is the NC membrane, 4 is the quality control line, 5 is the capture line, 6 is the binding pad, 7 is the outer shell of the dark box, 8 is the internal test strip placement platform, 9 is the retractable slider, 10 is the smartphone, and 11 is the control circuit board. Detailed Implementation

[0075] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0076] like Figure 1 As shown, a lateral chromatography test strip platform for dual-mode detection of sugarcane smut and top rot using afterglow and colorimetric methods comprises: a binding pad 6, an NC membrane 3, an absorbent pad 2, and a base plate 1. The base plate 1 is generally made of PVC. The binding pad 6, NC membrane 3, and absorbent pad 2 are all attached to the base plate 1. The binding pad 6 is attached to one side of the base plate 1 and is close to the capture line 5. The absorbent pad 2 is attached to the other side of the base plate 1 and is close to the control line 4. The binding pad 6 and the absorbent pad 2 are located at both ends of the NC membrane 3 and are tightly attached to it by 2 mm above it.

[0077] A method for preparing a lateral chromatography test strip platform for dual-mode detection of sugarcane smut and top rot using afterglow and colorimetric methods, comprising the following steps:

[0078] The conjugate pad 6 was soaked in a mixed solution of 1% NaCl, 0.5% Tween, 1% BSA, 2% sucrose and 1% Triton for 1 hour, then dried in an oven at 37°C for 12 hours, and stored in a sealed container at room temperature for later use.

[0079] The smooth side of the NC membrane 3 is attached to the base plate 1. The absorbent pad 2 is attached to one side of the NC membrane 3, and the prepared bonding pad 6 is attached to the other side, with each part overlapping by 2 mm. The NC membrane 3 is equipped with a capture line 5 and a quality control line 4.

[0080] The capture line 5 is coated with a conjugate of the capture probe and streptavidin; the 3' end of the capture probe is biotin-labeled; the control line 4 is coated with a conjugate of the control probe and streptavidin; the 3' end of the control probe is biotin-labeled; the control probe is complementary to the DNA sequences of the CDs@dSiO2-DNA1 and Au-DNA2 probes, respectively.

[0081] The nucleotide sequence of the capture probe is: CGCCTACCTACTAAAAGTCAGCCCAAAAA; the nucleotide sequence of the quality control probe is: CTAGTAATAGGAGAAAAAATACAACCAGCGTAAAA; the nucleotide sequence of DNA1 in the CDs@dSiO2-DNA1 probe is: AAAATTCTCCTATTACTAG; the nucleotide sequence of DNA2 in the Au-DNA2 probe is: ACGCTGGTTGTAAAAA.

[0082] To stably immobilize the probes on capture line 5 and control line 4 onto the surface of NC membrane 3, the high affinity binding property between streptavidin and biotin is utilized. The biotin-labeled capture probes and control probes are pre-incubated with streptavidin, respectively. The specific procedure is as follows:

[0083] A conjugate of the capture probe and streptavidin was prepared; a conjugate of the quality control probe and streptavidin was also prepared. Subsequently, the conjugates of the capture probe and streptavidin and the quality control probe and streptavidin were respectively loaded onto a syringe apparatus and precisely sprayed onto the NC membrane 3, with the spacing between the capture line 5 and the quality control line 4 set to 5 mm. After spraying, the membrane was dried overnight in a 37°C oven and finally cut into single test strips to obtain a lateral chromatography test strip platform for the dual-mode detection of sugarcane smut and top rot using afterglow and colorimetric methods, which was stored at 4°C. The preferred spraying speed was 80-105 μL / s.

[0084] The preparation method of the CDs@dSiO2-DNA1 probe includes the following steps:

[0085] a1. CDs@dSiO2 nanoparticles were mixed with a MES solution containing EDC and NHS and activated at room temperature to obtain activated CDs@dSiO2 nanoparticles.

[0086] a2. The activated CDs@dSiO2 nanoparticles were mixed with PBS buffer and streptavidin solution and vortexed at room temperature to obtain a reaction system containing CDs@dSiO2@SA nanoparticles.

[0087] a3. Add DNA1 to the reaction system containing CDs@dSiO2@SA nanoparticles, mix with CDs@dSiO2@SA nanoparticles, and incubate at 4 °C;

[0088] a4. Continue adding BSA, vortex at room temperature for blocking, and finally obtain the CDs@dSiO2-DNA1 probe.

[0089] The preparation method of Au-DNA2 probe includes the following steps:

[0090] b1. Mix the DNA2 modified with thiol groups with TE buffer containing TCEP to obtain activated DNA2;

[0091] b2. Mix the activated DNA2 with Au nanoparticles and incubate at 2-4 ℃;

[0092] b3. Add MCH to it, vortex at room temperature to block it, and finally obtain the Au-DNA2 probe.

[0093] The preparation method of CDs@dSiO2 nanoparticles includes the following steps:

[0094] c1. Dissolve triethanolamine and carbon dots in water in a beaker and heat to 70-80℃ for 20-60 min at 400-500 rpm. Then add sodium salicylate and hexadecyltrimethylammonium bromide and react for 0.6-2 h under the same temperature and stirring conditions. Then add TEOS dropwise and continue the reaction for another 2-3 h to obtain the mixed system after reaction.

[0095] c2. Centrifuge the mixture after the reaction to collect the precipitate, wash with ethanol and ultrapure water to obtain CDs@dSiO2 nanoparticles.

[0096] The preparation method of Au nanoparticles includes the following steps:

[0097] d1. Add chloroauric acid diluted by a certain factor to the reaction vessel, heat to boiling, slowly add sodium citrate and cool down. After the color turns wine red, stop heating and stirring after reacting for a period of time and cool to room temperature to obtain the mixed system after the reaction.

[0098] d2. After the reaction, the mixture was centrifuged to collect the precipitate, and then washed with ethanol and ultrapure water to obtain Au nanoparticles.

[0099] In this embodiment, more specific preparation methods for the above-mentioned CDs@dSiO2-DNA1 probe, Au-DNA2 probe, CDs@dSiO2 nanoparticles, and Au nanoparticles are also provided.

[0100] The specific preparation method of the CDs@dSiO2-DNA1 probe is as follows:

[0101] a1. Mix 10-20 mg of CDs@dSiO2 nanoparticles with 10-20 mL of MES solution containing EDC and NHS. The volume concentration of EDC is 10-20% and the volume concentration of NHS is 5-10%. Activate at room temperature for 0.5-1 h to obtain activated CDs@dSiO2 nanoparticles.

[0102] a2. The activated CDs@dSiO2 nanoparticles were mixed with 10-20 mL PBS and 50-80 μL of 4-10 mg / mL streptavidin solution, and vortexed at room temperature for 2-3 h to obtain a reaction system containing CDs@dSiO2@SA nanoparticles.

[0103] a3. Add 50-80 μL of DNA1 to the reaction system containing CDs@dSiO2@SA nanoparticles, mix with CDs@dSiO2@SA nanoparticles, and incubate at 2-4 ℃ for 10-12 h;

[0104] a4. Continue to add 20-30 μL of 10% BSA, vortex at room temperature for 2-3 h to block the material, and finally obtain the CDs@dSiO2-DNA2 probe.

[0105] The preparation method of Au-DNA2 probe includes the following steps:

[0106] b1. Mix the DNA2 modified with thiol groups with 55-65 μL of TE buffer containing 5-10 mM TCEP to obtain activated DNA2;

[0107] b2. Mix 10-20 μL of activated DNA2 with Au nanoparticles and incubate at 2-4 °C;

[0108] b3. Add 5-10 μL of 5-10 mM MCH, vortex, and vortex at room temperature for 1-2 h to block the sample, finally obtaining the Au-DNA2 probe.

[0109] The specific preparation method of CDs@dSiO2 nanoparticles is as follows:

[0110] c1. Dissolve 60-75 mg of triethanolamine and 320-360 mg of carbon dots in pure water and heat to 70-85℃ for 20-60 min with stirring. Add 160-180 mg of sodium salicylate and 370-380 mg of cetyltrimethylammonium bromide and react for 0.6-2 h with stirring at the same temperature. Then add 4-6 mL of TEOS dropwise and continue the reaction for another 2-3 h to obtain the mixed system after reaction.

[0111] c2. After the reaction is complete, the mixture is naturally cooled to room temperature. The product is then washed by centrifugation with ethanol and water until the supernatant becomes clear, thus obtaining CDs@dSiO2 nanoparticles. These nanoparticles are then dispersed in ultrapure water for later use.

[0112] The specific preparation method of Au nanoparticles is as follows:

[0113] d1. Dilute 1-2 mL of 1% chloroauric acid to 100 mL in a reaction vessel, heat to boiling, slowly add 1-2 mL of 2% sodium citrate and cool down. After the color turns wine red, continue to react under heating for 5-15 min, stir and cool to room temperature to obtain the mixed system after reaction.

[0114] d2. After the reaction, the mixture was centrifuged to collect the precipitate, washed, and Au nanoparticles were obtained. The precipitate was then dispersed in TE buffer for later use.

[0115] In the process of this invention, the preparation method of the DNA signal amplification solution after entropy-driven and catalytic hairpin cycle amplification includes the following steps:

[0116] (1) Preparation of A1-A2-A3 triple chain: The A1, A2 and A3 chains were heated and annealed, and then cooled to room temperature to obtain the A1-A2-A3 triple chain;

[0117] The nucleic acid sequence structure of chain A1 is: CAACCTCAATCGACCTCTCATTCTAATCTTCACCAGCGACGCAGACCAAAAA; the nucleotide sequence of chain A2 is: AAAAAAATATACGTGGTCTGCGTCGCTGGTGAAGATT; and the nucleotide sequence of chain A3 is: AGTAGGTAGGCGCTAGTAATAGGAGAATGAGAGGTCGATTG.

[0118] (2) Preparation of A1-A2-A3-MB: After activating the carboxylated magnetic beads with EDC and NHS, the activated magnetic beads (MB) are obtained. The A1-A2-A3 triple chain is mixed with the activated magnetic beads, then magnetically separated and dispersed to obtain A1-A2-A3-MB, which is stored in a refrigerator at 2-4 ℃.

[0119] (3) Preparation of hairpin B1 chain: The B1 chain was heated and annealed, and then cooled to room temperature to obtain hairpin B1 chain;

[0120] The nucleotide sequence of B1 is: AAAATGGGATCATTACCGAGTTTACAACCAGCGTAACTCGGTAATG;

[0121] (4) Preparation of B1-MB: After activating the carboxylated magnetic beads with EDC and NHS, the activated magnetic beads were obtained. The hairpin B1 chain was mixed with the activated magnetic beads, then magnetically separated and dispersed to obtain B1-MB, which was stored in a refrigerator at 2-4 ℃.

[0122] (5) Preparation of P double strands: B2 and B3 strands were mixed and incubated in a shaker at 37 °C and cooled to room temperature to obtain P double strands; wherein, the nucleotide sequence of B2 strand is: CATTACCGAGTTACGCTGGTTGTAAACTCGGTAATGATCCCA; the nucleotide sequence of B3 strand is: TGGGCTGACTACAACCAGCGT.

[0123] (6) Mix the DNA, A1-A2-A3-MB, and A from the sample to be tested. 4、 After mixing B1-MB and P double strands and incubating, the mixture was magnetically separated, and the supernatant was retained to obtain the DNA signal amplification solution after entropy-driven and catalytic hairpin cycle amplification. The nucleotide sequence of target A is: TGAGAGGTCGATTGAGGTTG; the nucleotide sequence of the A4 strand is: TGGTCTGCGTCGCTGGTGAAGATTAGAATGAGAGGTCGATTG; and the nucleotide sequence of target B is: GTTGTAAACTCGGTAATGATCCCT.

[0124] The preparation method of the conjugate of the capture probe and streptavidin includes the following steps:

[0125] The capture probe and streptavidin aqueous solution were mixed, incubated, and coupled to obtain the capture probe-streptavidin conjugate.

[0126] Specifically, a preferred method is to mix 50 μL of a 24 μM capture probe with 4 mg / mL of a 50 μL streptavidin aqueous solution and incubate at 4°C for 1 h to obtain a conjugate of the capture probe and streptavidin.

[0127] The preparation method of the conjugate of quality control probe and streptavidin includes the following steps:

[0128] The quality control probe and streptavidin aqueous solution were mixed, incubated, and then conjugated to obtain the conjugate of the quality control probe and streptavidin.

[0129] Specifically, the preferred method is to mix 50 μL of a 24 μM quality control probe with 4 mg / mL of a 50 μL streptavidin aqueous solution and incubate at 4°C for 1 h to obtain the conjugate of the quality control probe and streptavidin.

[0130] The above nucleotide sequences are shown in Table 1:

[0131] Table 1 Nucleotide Sequences

[0132]

[0133] The technical solution of the present invention will be clearly and specifically described below with reference to specific embodiments.

[0134] Example 1

[0135] I. Preparation of lateral chromatography test strips for dual-mode detection of sugarcane smut and top rot using afterglow and colorimetric methods, including the following steps:

[0136] 1.1 Sample pad pretreatment

[0137] The sample pad was soaked in a mixed solution of 1% NaCl, 0.5% Tween, 1% BSA, 2% sucrose and 1% Triton for 1 hour, then dried in an oven at 37°C for 12 hours, and stored in a sealed container at room temperature for later use.

[0138] 1.2 Preparation of test strips

[0139] The smooth side of the NC membrane 3 is attached to the base plate 1. An absorbent pad 2 is attached to one side of the NC membrane 3, and a pre-treated bonding pad 6 is attached to the other side, with a 2 mm overlap between each part. The NC membrane has a capture line 5 and a control line 4. The capture line 5 is close to the bonding pad 6, and the control line 4 is close to the absorbent pad 2. Figure 1 As shown.

[0140] Utilizing the high affinity binding between streptavidin and biotin, biotin-labeled capture probes and quality control probes were pre-incubated with streptavidin, respectively. The specific procedure was as follows:

[0141] Preparation of the capture probe-streptavidin conjugate: Mix 50 μL of 24 μM capture probe and 50 μL of 4 mg / mL streptavidin aqueous solution, and incubate at 4 °C for 1 h to obtain the capture probe-streptavidin conjugate.

[0142] Prepare a conjugate of quality control probe and streptavidin; mix 50 μL of 24 μM quality control probe and 50 μL of 4 mg / mL streptavidin aqueous solution, and incubate at 4℃ for 1 h to obtain the conjugate of quality control probe and streptavidin.

[0143] 50 μL of a 12 μM streptavidin conjugate and a control probe conjugate were loaded onto a syringe apparatus and precisely scribed onto an NC membrane at a spray rate of 100 μL / s, with a spacing of 5 mm between the capture and control lines. After spraying, the membrane was dried overnight in a 37°C oven and then cut into single test strips with a width of 3.5 mm. This yielded a lateral chromatography test strip platform for the dual-mode detection of sugarcane smut and top rot using both afterglow and colorimetric methods, which was stored at 4°C.

[0144] 1.3 Preparation of CDs@dSiO2 nanoparticles

[0145] c1. Dissolve 68 mg of triethanolamine and 350 mg of carbon dots in 25 mL of pure water, heat to 80 °C and react for 30 min with stirring at 450 rpm, add 168 mg of sodium salicylate and 380 mg of hexadecyltrimethylammonium bromide and react for 1 h under the same temperature and stirring conditions, then add 4 mL of LTEOS dropwise and continue the reaction for another 2 h.

[0146] c2. After the reaction is complete, the mixture is naturally cooled to room temperature. The product is then washed by centrifugation with ethanol and water until the supernatant becomes clear, thus obtaining CDs@dSiO2 nanoparticles. These nanoparticles are dispersed in 0.5 mL of ultrapure water and stored at 4 °C in the dark for later use.

[0147] 1.4 Preparation of Au nanoparticles

[0148] d1. Dilute 1 ml of 1% chloroauric acid to 100 ml, heat to boiling (130 ℃), slowly add 1 ml of 2% sodium citrate and cool to 110 ℃. During this process, the color will change from black to wine red. Continue heating for 10 min, then stop heating, stir and cool to room temperature to obtain the mixed system after the reaction.

[0149] d2. Centrifuge the mixture after reaction at 8000 rpm for 10 min, collect the precipitate, and wash the precipitate with ethanol and water by centrifugation until the supernatant becomes clear to obtain Au nanoparticles. Disperse them in 1 ml TE buffer and store them at 4 °C for later use.

[0150] 1.5 Preparation of CDs@dSiO2-DNA1 probe ( Figure 2 A)

[0151] a1. Mix 10 mg of CDs@dSiO2 nanoparticles with 10 mL of MES solution containing EDC and NHS (2 mL of EDC and 1 mL of NHS), and activate at room temperature for 0.5 h to obtain activated CDs@dSiO2 nanoparticles;

[0152] a2. The activated CDs@dSiO2 nanoparticles were added to 10 ml PBS and 50 μL 4 mg / mL streptavidin and vortexed at room temperature for 2 h to obtain a reaction system containing CDs@dSiO2@SA nanoparticles.

[0153] a3. Add 50 μL of DNA1 to the reaction system containing CDs@dSiO2@SA nanoparticles, mix with CDs@dSiO2@SA nanoparticles, and incubate at 4 ℃ for 12 h;

[0154] a4. Add 20 μL of 10% BSA, vortex at room temperature for 2 h to block the material, and finally obtain the CDs@dSiO2-DNA2 probe.

[0155] 1.6 Preparation method of Au-DNA2 probe ( Figure 2 A)

[0156] b1. Mix the thiol-modified DNA2 with 60.2 μL of TE buffer containing 10 mM TCEP to activate its thiol group and obtain activated DNA2.

[0157] b2. Mix 10 μL of activated DNA2 with 100 μL of Au nanoparticles and incubate at 4 °C for 12 h;

[0158] b3. Add 5 μL of 10 mM MCH to it, vortex at room temperature for 1 h to block it, and finally obtain the Au-DNA2 probe.

[0159] 1.7 Preparation of DNA signal amplification solution after entropy-driven and catalytic hairpin cycle amplification

[0160] (1) Preparation of A1-A2-A3 triple chain: A1, A2 and A3 chains were placed in a water bath and heated at 95 °C for 5 min. Then they were taken out, cooled and allowed to stand at room temperature to obtain A1-A2-A3 triple chain.

[0161] (2) Preparation of A1-A2-A3-MB: Carboxylated magnetic beads were activated with EDC and NHS at room temperature for 30 min to obtain activated magnetic beads (MB). The A1-A2-A3 triple strands were mixed with the activated magnetic beads in a shaker at 37 ℃ for 16 h. Then the supernatant was removed by magnetic separation and resuspended and dispersed in 80 μL TE buffer to obtain A1-A2-A3-MB, which was stored in a refrigerator at 4 ℃.

[0162] (3) Preparation of hairpin B1 chain: The B1 chain was placed in a water bath and heated at 95 °C for 5 min, then taken out and cooled to room temperature to obtain hairpin B1 chain;

[0163] (4) Preparation of B1-MB: After activating the carboxylated magnetic beads with EDC and NHS at room temperature for 30 min, the activated magnetic beads were obtained. The hairpin B1 chain and the activated magnetic beads were placed in a shaker at 37 °C for 16 h. Then the supernatant was removed by magnetic separation and resuspended in 40 μL TE buffer to obtain B1-MB, which was stored in a refrigerator at 4 °C.

[0164] (5) Preparation of P double-chain structure: B2 chain and B3 chain were mixed and incubated in a shaker at 37 ℃ for 2 h, and then cooled to room temperature to obtain P double chain.

[0165] (6) Sample to be tested, A1-A2-A3-MB, A 4、 After mixing B1-MB and P double strands, the mixture was incubated at 37 °C for 1.5 h, magnetically separated, and the supernatant was retained to obtain the DNA signal amplification solution after entropy-driven and catalytic hairpin cycle amplification.

[0166] 1.8 Detection Methods

[0167] (1) Mix the DNA sample to be tested with 20 μL A1-A2-A3-MB, 20 μL A4, 20 μL B1-MB and 20 μL P double strands, mix in a shaker at 37 °C for 1.5 h, separate magnetically, and retain the supernatant.

[0168] (2) Add 40 μL of CDs@dSiO2-DNA1 probe and 40 μL of Au-DNA2 probe to the obtained supernatant and incubate at 37°C for 1 h.

[0169] (3) After centrifuging the mixture obtained in step (2), the solid is dispersed in PBS buffer. The solution is then dropped onto the conjugate pad. If the target substance is present, a red line will appear on the capture line, while any unreacted target substance will be captured by the control line. After the solution is completely absorbed, the resuspension solution is added to rinse and reduce the residual background signal.

[0170] (4) Qualitative analysis:

[0171] Colorimetric pattern analysis: Under normal conditions, a signal in the capture line indicates a positive result for shoot rot, while no signal in the capture line indicates a negative result for shoot rot.

[0172] Afterglow pattern analysis: Place the test strip into the dark box of this invention, then use a mobile phone to start the customized app software, set the number of photos, and the interval between each photo is 50 ms. The software controls the turning on of the ultraviolet lamp with a wavelength of 365nm. After irradiation for 2 minutes, the software controls the turning off of the ultraviolet lamp and takes a photo. If the capture line shows a signal, it is a positive result for smut disease. If the capture line does not show a signal, it is a negative result for smut disease.

[0173] II. Using the test strip of this invention for the detection of sugarcane top rot gene.

[0174] 2.1 Construction principle of test strips for detecting sugarcane smut and top rot

[0175] like Figure 2 As shown in B, the left side represents loop 1, which is triggered by entropy-driven amplification. In loop 1, when target A is present, it binds to the active site exposed on the A1 strand in A1 / A2 / A3 through complementary base pairing, releasing the A3 strand through a strand displacement reaction. Then, the A4 strand binds to the active site exposed in the middle of the A1 strand in A1 / A2 / target A through complementary base pairing, simultaneously releasing the A2 strand and target A. The released target A continues to enter the reaction of the next loop. After multiple loops, more A3 strands can be obtained. Then, the CDs@dSiO2-DNA1 probe is added, which assembles into the CDs@dSiO2-DNA1-A3 DNA structure, thereby amplifying the signal of smut disease.

[0176] On the right is cycle 2, which is triggered by catalytic hairpin amplification. In cycle 2, when target B is present, it opens hairpin B1, exposing the active site, and reaches B according to the base pairing principle. 1— The B2 DNA structure releases target B and B3 chains. The released target B will continue to enter the next cycle of reaction. After multiple cycles, more B3 chains can be obtained. Then, the Au-DNA2 probe is added to assemble into the Au-DNA2-B3 DNA structure, thereby amplifying the signal of shoot rot disease.

[0177] like Figure 2As shown in C, the reacted solution is dropped onto the test strip. A segment of the Capture Probe fixed in the capture line pairs complementaryly with the bases on the A3 chain. The A3 chain can only be released when the target A is present. The A3 chain acts as a bridge to form a CDs@dSiO2-DNA1-A3-Capture Probe DNA structure on the capture line, thereby generating a persistent signal on the capture line. Conversely, when there is no target A, the A3 chain cannot be released, and CDs@dSiO2-DNA1 cannot be fixed on the capture line, so no persistent signal is generated. Unparticipated or excess CDs@dSiO2-DNA1 is captured by the control probe, thereby generating a persistent signal on the control line. Another base pairing of the Capture Probe, which is fixed in the capture line, is complementary to the bases on the B3 strand. The B3 strand can only be released when the target B is present, forming an Au-DNA2-B3-Capture Probe DNA structure on the capture line, thereby generating a colorimetric signal on the capture line. Conversely, when the target B is absent, the B3 strand cannot be released, and Au-DNA2 cannot be fixed on the capture line, so no colorimetric signal is generated. Unparticipated or excess Au-DNA2 is captured by the control probe, thereby generating a colorimetric signal on the control line.

[0178] 2.2 Construction of the intelligent photographing device for detecting sugarcane smut and top rot test strips

[0179] Afterglow materials require photographing in a dark environment to observe their signal characteristics. This embodiment provides a dark box structure, and uses 3D printing technology to print and assemble the dark box. Figure 3 As shown, the dark box includes a dark box shell 7, with a retractable slider 9 on one side and an internal test strip placement platform 8 inside. When the retractable slider 9 is slid out, an opening is left to allow the lateral chromatography test strip platform to be removed or placed on the internal test strip placement platform 8. When the retractable slider 9 is slid in, the opening is closed to maintain the darkness inside the dark box shell 7. A camera hole is provided on the top of the dark box shell 7, corresponding to the placement position of the camera of the smartphone 10. A control circuit board 11 is assembled inside the dark box shell 7. The control circuit board 11 integrates a 365nm ultraviolet excitation lamp bead, a Bluetooth communication module, a drive circuit, and a power supply module. Multiple ultraviolet excitation lamp beads can be set. The Bluetooth communication module is connected to the drive circuit, and the drive circuit is connected to the ultraviolet excitation lamp beads. The power supply module provides power to the Bluetooth communication module and the drive circuit. The control circuit board 11 communicates bidirectionally with the smartphone 10 through the Bluetooth communication module.

[0180] Afterglow materials exhibit significant delayed emission characteristics in dark environments. When using traditional mobile phones for photography, after controlling the ultraviolet excitation lamp bead to turn on via Bluetooth communication module, a stopwatch must be used to strictly control the time for taking the picture. However, due to the characteristics of weak intensity, short duration, and susceptibility to interference from ambient stray light, conventional mobile phone photography software may have difficulty simultaneously completing ultraviolet excitation and precise time-delay shooting, resulting in a low success rate. To solve this problem, this embodiment further designs a dedicated intelligent photography app.

[0181] The intelligent photography app includes a Bluetooth connection module, a light source control module, a time-lapse shooting control module, and a shooting execution module. The Bluetooth connection module connects to the Bluetooth communication module, enabling bidirectional communication. It also connects to the light source control module and the time-lapse shooting control module. The light source control module controls the on / off state and luminous intensity of the ultraviolet excitation LEDs via the Bluetooth connection module and sends feedback to the time-lapse shooting control module indicating that the ultraviolet excitation LEDs are on. Upon receiving feedback from the time-lapse shooting control module, the time-lapse shooting control module, based on the user's time-lapse control command, delays the process by sending a shooting command to the shooting execution module and simultaneously transmits timing signals to the control circuit board 11, precisely triggering multi-frame time-lapse photography by the camera. It is compatible with the acquisition of delayed luminous signals from different afterglow materials.

[0182] 2.3 Detection performance of the test strip

[0183] The creation of a standard curve involves the following steps:

[0184] (1) Two different concentrations of target A (smut DNA fragment), target B (twig rot DNA fragment) and 20 μL A1-A2-A3-MB, 20 μL A4, 20 μL B1-MB and 20 μL P double strand were mixed and mixed in a shaker at 37 ℃ for 1.5 h, magnetically separated, and the supernatant was retained.

[0185] (2) Add 40 μL of CDs@dSiO2-DNA1 probe and 40 μL of Au-DNA2 probe to the obtained supernatant and incubate at 37°C for 1 h.

[0186] (3) After centrifuging the mixture obtained in step (2), the solid is dispersed in PBS buffer. The above solution is dropped onto the conjugate pad. If the target substance is present, a red line will appear on the capture line, while the excess unreacted target substance will be captured by the control line. After the solution is completely absorbed, the resuspension solution is added to rinse and reduce the residual background signal.

[0187] Colorimetric mode analysis: Take a picture with a mobile phone and extract the image J intensity values ​​of the capture line and control line; Afterglow mode analysis: Place the test strip into the dark box of this invention, then start the customized app software with a mobile phone, set the number of pictures, and the interval between each picture is 50 ms. The software controls the turning on of the ultraviolet lamp with a wavelength of 365nm. After irradiation for 2 minutes, the software controls the turning off of the ultraviolet lamp and takes a picture. After the picture is taken, take the image J intensity values ​​of the capture line and control line in the first 50 ms picture.

[0188] By employing the different detection modes described above, the detection performance of the test strips was evaluated by analyzing the capture line / control line ratio. Linear regression equations were established with the logarithms of sugarcane smut and top rot gene concentrations as the x-axis and the capture line / control line ratio as the y-axis, respectively. Figure 4 The figure shown is a result graph and a standard curve graph for two detection modes corresponding to different concentrations of the test strip of the present invention for smut and top rot, respectively.

[0189] like Figure 4 As shown in A and 4B, in colorimetric mode, the concentration of the target standard is 10. -13 -10 -7 Within the range M, the linear equation y = 0.136lgC + 2.154(R) 2 =0.994); the detection limit is 18.7 fM (S / N=3); if Figure 4 As shown in C and 4D, in afterglow mode, the target concentration is at 10. -15 -10 -7 Within the range M, the linear equation y = 0.146lgC + 2.337(R) 2 =0.933); the detection limit was 128 aM (S / N=3).

[0190] When testing sugarcane samples, the lateral chromatography test strips after sample processing can be obtained by referring to the testing method in 1.8 above. The capture line / control line ratio in colorimetric mode and afterglow mode can be obtained and substituted into the corresponding linear regression equation for calculation, thereby completing the quantitative analysis of smut and top rot.

[0191] In summary, the multi-mode test strip sensing platform not only has good analytical sensitivity for detecting sugarcane smut and top rot, but also features the construction of a functional nanomaterial synthesis and intelligent imaging device, saving time and effort without the need for large instruments, making it more convenient and efficient. This demonstrates the potential application value of this platform in the detection of sugarcane smut and top rot.

[0192] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.

Claims

1. A lateral chromatography test strip platform for dual-mode detection of sugarcane smut and top rot using afterglow and colorimetric methods, characterized in that, include: Base plate; An NC membrane is attached to the top of the base plate, with capture lines and quality control lines spaced apart. The bonding pad is attached to one side of the base plate, close to the capture line; An absorbent pad is attached to the other side of the base plate, close to the quality control line; The capture line is coated with a conjugate of capture probe and streptavidin; the 3' end of the capture probe is biotin-labeled. The quality control line is coated with a conjugate of the quality control probe and streptavidin; the 3' end of the quality control probe is biotin-labeled; the quality control probe is complementary to the DNA sequences of the CDs@dSiO2-DNA1 probe and the Au-DNA2 probe, respectively. The nucleotide sequence of the capture probe is: CGCCTACCTACTAAAAGTCAGCCCAAAAA; the nucleotide sequence of the quality control probe is: CTAGTAATAGGAGAAAAAATACAACCAGCGTAAAA; The nucleotide sequence of DNA1 in the CDs@dSiO2-DNA1 probe is: AAAATTCTCCTATTACTAG; the nucleotide sequence of DNA2 in the Au-DNA2 probe is: ACGCTGGTTGTAAAAA.

2. The lateral chromatography test strip platform for dual-mode detection of sugarcane smut and top rot according to claim 1, characterized in that, The preparation method of the CDs@dSiO2-DNA1 probe includes the following steps: a1. CDs@dSiO2 nanoparticles were mixed with a MES solution containing EDC and NHS and activated to obtain activated CDs@dSiO2 nanoparticles. a2. The activated CDs@dSiO2 nanoparticles were mixed with PBS buffer and streptavidin solution and vortexed to obtain a reaction system containing CDs@dSiO2@SA nanoparticles. a3. Add DNA1 to the reaction system containing CDs@dSiO2@SA nanoparticles, mix with CDs@dSiO2@SA nanoparticles, and incubate at 2-4 ℃; a4. Continue adding BSA, vortex, and perform a blocking process to finally obtain the CDs@dSiO2-DNA1 probe; The preparation method of the Au-DNA2 probe includes the following steps: b1. Mix the thiol-modified DNA2 with TE buffer containing TCEP to obtain activated DNA2; b2. Mix the activated DNA2 with Au nanoparticles and incubate at 2-4 ℃; b3. Add MCH, vortex, and block the probe to obtain the Au-DNA2 probe.

3. The lateral chromatography test strip platform for dual-mode detection of sugarcane smut and top rot according to claim 2, characterized in that, In step a1, the amount of CDs@dSiO2 nanoparticles used is 10-20 mg, the amount of MES solution containing EDC and NHS is 10-20 mL, the volume concentration of EDC is 10-20%, the volume concentration of NHS is 5-10%, and the activation time is 0.5-1 h. In step a2, the volume of PBS buffer is 10-20 mL, the volume of streptavidin solution is 50-80 μL, the concentration is 4-10 mg / mL, and the vortexing time is 2-3 h. In step a3, the amount of DNA1 used is 50-80 μL, and the incubation time is 10-12 h; In step a4, the amount of BSA used is 20-30 μL, the concentration is 10%, and the vortexing time is 2-3 h; In step b1, the volume of TE buffer containing TCEP is 55-65 μL, and the concentration of TCEP is 5-10 mM. In step b2, the amount of activated DNA2 used is 10-20 μL; In step b3, the amount of MCH used is 5-10 μL, the concentration is 5-10 mM, and the vortexing time is 1-2 h.

4. The lateral chromatography test strip platform for dual-mode detection of sugarcane smut and top rot according to claim 2, characterized in that, The preparation method of the CDs@dSiO2 nanoparticles includes the following steps: c1. Dissolve triethanolamine and carbon dots in water and heat to 70-85℃ for 20-60 min with stirring. Add sodium salicylate and hexadecyltrimethylammonium bromide and react for 0.6-2 h with stirring at the same temperature. Then add TEOS dropwise and continue the reaction for another 2-3 h to obtain the mixed system after reaction. c2. Centrifuge the mixture after the reaction to collect the precipitate, wash it, and obtain CDs@dSiO2 nanoparticles; The preparation method of the Au nanoparticles includes the following steps: d1. Add chloroauric acid diluted by a certain factor to the reaction vessel, heat to boiling, slowly add sodium citrate and cool down. After the color turns wine red, stop heating and stirring after reacting for a period of time and cool to room temperature to obtain the mixed system after the reaction. d2. After the reaction, the mixture was centrifuged to collect the precipitate, washed, and Au nanoparticles were obtained.

5. The lateral chromatography test strip platform for dual-mode detection of sugarcane smut and top rot according to claim 4, characterized in that, In step c1, the amount of triethanolamine used is 60-75 mg, the amount of carbon dots used is 320-360 mg, the amount of sodium salicylate used is 160-180 mg, the amount of hexadecyltrimethylammonium bromide used is 370-380 mg, and the amount of TEOS used is 4-6 mL. In step c2, the product is washed with ethanol and water successively until the supernatant becomes clear; the obtained CDs@dSiO2 nanoparticles are dispersed in ultrapure water for later use. In step d1, the dilution is specifically to dilute 1-2 mL of 1% chloroauric acid to 100 mL, and the amount of sodium citrate used is 1-2 mL with a concentration of 2%; after the color turns wine red, the reaction time is 5-15 min. In step d2, the obtained Au nanoparticles are dispersed in TE buffer for later use.

6. The method for preparing the lateral chromatography test strip platform for the dual-mode detection of sugarcane smut and top rot as described in any one of claims 1-5, Its features are, Includes the following steps: (1) Preparation of the capture probe and streptavidin conjugate: Mix the capture probe and streptavidin aqueous solution, incubate, and conjugate to obtain the capture probe and streptavidin conjugate; (2) Preparation of the conjugate of the quality control probe and streptavidin; mixing the quality control probe and streptavidin aqueous solution, incubating, and conjugating to obtain the conjugate of the quality control probe and streptavidin; (3) The NC membrane, conjugation pad, and absorbent pad are attached to the base plate. The conjugates of the capture probe and streptavidin and the conjugates of the quality control probe and streptavidin are loaded onto the gliding membrane apparatus respectively, and the capture line and quality control line are sprayed and drawn on the NC membrane respectively. After spraying, the membrane is placed in an oven at 35-38 °C to dry and cut into single test strips to obtain the lateral chromatography test strip platform for the dual-mode detection of sugarcane smut and top rot of afterglow and colorimetry.

7. The application of the lateral chromatography test strip platform for detecting sugarcane smut and top rot in dual-mode detection of afterglow and colorimetric as described in any one of claims 1-5, or the lateral chromatography test strip platform for detecting sugarcane smut and top rot prepared by the preparation method described in claim 6, in the detection of sugarcane smut and / or top rot.

8. The application according to claim 7, characterized in that, A method for detecting sugarcane smut and / or top rot using the lateral chromatography test strip platform includes the following steps: A DNA signal amplification solution, after entropy-driven and catalytic hairpin cycle amplification, is mixed and incubated with the CDs@dSiO2-DNA1 probe and Au-DNA2 probe. The solid is then separated by centrifugation, dispersed in PBS buffer, and added to the binding pad of the test strip. In colorimetric mode, a signal appearing at the capture line indicates a positive result for top rot, while no signal appearing at the capture line indicates a negative result for top rot. In afterglow mode, a signal appearing at the capture line indicates a positive result for smut, while no signal appearing at the capture line indicates a negative result for smut.

9. The application according to claim 8, characterized in that, The method for preparing the DNA signal amplification solution after entropy-driven and catalytic hairpin cycle amplification includes the following steps: (1) Preparation of A1-A2-A3 triple chain: The A1, A2 and A3 chains were heated and annealed, and then cooled to room temperature to obtain the A1-A2-A3 triple chain; The nucleic acid sequence structure of chain A1 is: CAACCTCAATCGACCTCTCATTCTAATCTTCACCAGCGACGCAGACCAAAAA; the nucleotide sequence of chain A2 is: AAAAAAATATACGTGGTCTGCGTCGCTGGTGAAGATT; and the nucleotide sequence of chain A3 is: AGTAGGTAGGCGCTAGTAATAGGAGAATGAGAGGTCGATTG. (2) Preparation of A1-A2-A3-MB: After activating the carboxylated magnetic beads with EDC and NHS, the activated magnetic beads were obtained. The A1-A2-A3 triple chain was mixed with the activated magnetic beads, then magnetically separated and dispersed to obtain A1-A2-A3-MB, which was stored in a refrigerator at 2-4 ℃. (3) Preparation of hairpin B1 chain: The B1 chain was heated and annealed, and then cooled to room temperature to obtain hairpin B1 chain; The nucleotide sequence of B1 is: AAAATGGGATCATTACCGAGTTTACAACCAGCGTAACTCGGTAATG; (4) Preparation of B1-MB: After activating the carboxylated magnetic beads with EDC and NHS, the activated magnetic beads were obtained. The hairpin B1 chain was mixed with the activated magnetic beads, then magnetically separated and dispersed to obtain B1-MB, which was stored in a refrigerator at 2-4 ℃. (5) Preparation of P double strands: Mix B2 strands and B3 strands and incubate, then cool to room temperature to obtain P double strands; wherein, the nucleotide sequence of B2 strand is: CATTACCGAGTTACGCTGGTTGTAAACTCGGTAATGATCCCA; wherein, the nucleotide sequence of B3 strand is: TGGGCTGACTACAACCAGCGT. (6) Mix the DNA, A1-A2-A3-MB, and A from the sample to be tested. 4、 After mixing and incubating the B1-MB and P double strands, the solution was magnetically separated to obtain the DNA signal amplification solution after entropy-driven and catalytic hairpin cycle amplification. The nucleotide sequence of target A is: TGAGAGGTCGATTGAGGTTG; the nucleotide sequence of target B is: GTTGTAAACTCGGTAATGATCCCT; and the nucleotide sequence of the A4 strand is: TGGTCTGCGTCGCTGGTGAAGATTAGAATGAGAGGTCGATTG.

10. The application according to claim 9, characterized in that, In step (1), the heating temperature is 80-95℃ and the annealing time is 5-15 min; In step (2), the specific activation steps include: taking a certain volume of carboxylated magnetic beads, washing them with PBS, then dispersing them in an equal volume of PBS, adding the same volume of PBS solution containing 5-10 mM EDC and 10-20 mM NHS, incubating at 37℃ for 1-2 h to activate the carboxyl groups on the carboxylated magnetic beads, and then washing them three times with PBS to obtain the activated magnetic beads; the specific steps of mixing the A1-A2-A3 triple strands with the activated magnetic beads include: mixing in a shaker at 37℃ for 12-18 h; In step (3), the heating temperature is 80-95℃ and the annealing time is 5-15 min; In step (4), the specific activation steps include: taking a certain volume of carboxylated magnetic beads, washing them with PBS, then dispersing them in an equal volume of PBS, adding the same volume of PBS solution containing 5-10 mM EDC and 10-20 mM NHS, incubating at 37°C for 1-2 h to activate the carboxyl groups on the carboxylated magnetic beads, and then washing them three times with PBS to obtain the activated magnetic beads; mixing the hairpin B1 chain with the activated magnetic beads specifically includes: mixing on a shaker at 37°C for 12-18 h; In step (5), the incubation of B2 and B3 chains specifically includes mixing them in a shaker at 37 ℃ for 1.5-3 h; In step (6), the DNA, A1-A2-A3-MB, and A of the sample to be tested are... 4、 The incubation process after mixing B1-MB and P double strands specifically involves: mixing the DNA sample to be tested, solutions of A1-A2-A3-MB and B1-MB together, adding A4 strand and P double strand, incubating on a shaker at 37°C for 1.5 h, then magnetically separating, retaining the supernatant to obtain the entropy-driven and catalytic hairpin cyclic amplification DNA signal amplification solution, which is then stored in a refrigerator at 2-4°C.

Images