proximity inducing compound

Abstract

The present invention relates to a proximity inducing compound (or proximity inducing chimera, PIC) for inducing proximity between two biological molecules, enabling said biological molecules to interact. The present invention also relates to a method of inducing such proximity, comprising the use of a PIC. The PIC comprises: a first ligand capable of binding a biological molecule having a Brd bromodomain with a cavity modification; a second ligand capable of binding a biological molecule having a FK binding protein (FKBP); and a linker capable of linking the above ligands.

Description

[0001] Field of Invention: This invention relates to proximity-inducing compounds (or proximity-inducing chimeras, PICs) for inducing proximity between two biomolecules, enabling the biomolecules to interact. The invention also relates to methods for inducing such proximity, including the use of PICs. A PIC comprises a first ligand capable of binding to a biomolecule having a hole-modified Brd bromine domain, a second ligand capable of binding to a biomolecule having an FK-binding protein (FKBP), and a linker capable of connecting the aforementioned ligands. Background of the invention: Chemically induced proximity (CIP) is a technique that promotes or enables interactions between two or more biomolecules (e.g., proteins) that may not interact naturally. Using small molecules (proximity-inducing compounds / chimeras, PICs) or engineered proteins, CIPs can artificially induce biomolecular proximity, triggering specific cellular processes or responses. The ability to achieve and control such interactions can provide insights into how biological systems function and has potential applications in drug development, synthetic biology, and disease research at the molecular level. One notable class of PICs is the proteolytically targeted chimera (PROTAC) and molecular glue, which promote proximity between intracellular E3 ubiquitin ligases and target proteins (protein-of-interest, POIs) to lead to POI degradation; some of these have entered clinical trials or are already in clinical use (Sathe and Sapkota, etc.). Trends Pharmacol . Sci ., 2023, 44, 786; Sakamoto et al., Proc . Natl . Acad . Sci . U . S . A ., 2001, 98, 8664; Zengerle et al., ACS Chem . Biol ., 2015, 10, 1770; Lai and Crews, Nat . Rev . Drug Discov ., 2017, 16, 101; Samarasinghe and Crews. Cell Chem . Biol ., 2021, 28, 934).

[0003] Recently, there has been a recognition of the need for PICs that could facilitate interactions between phosphatases and POIs; many kinases and phosphatases control multiple substrates, and established kinase inhibitors often have off-target effects (Yamazoe et al., J . Med . Chem ., 2020, 63, 2807; Chen et al., ACS Chem . Biol ., 2021, 16, 2808; Zhang et al., J . Am . Chem ., Soc ., 2023, 145, 1118; Hu et al., J . Am . Chem . Soc Therefore, achieving substrate-level phosphorylation control using kinase inhibitors or phosphatase activators is extremely challenging. Targeted dephosphorylation of phosphoproteins using PICs has emerged as an emerging concept to modulate protein function and cellular signaling through substrate-level phosphorylation control. Redirecting phosphatase activity to induce targeted dephosphorylation of POIs, thereby altering POI function, could provide a promising new therapeutic mechanism for combating diseases caused by POI phosphorylation. Furthermore, substrate-specific dephosphorylation can overcome some of the aforementioned undesirable problems encountered with kinase inhibitors, which target the dephosphorylation of all kinase substrates (Rosenzweig, 2023, 145, 4045). Adv . Cancer Res .,2018, 138, 71).

[0004] The development of the AdPhosphatase (affinity-guided phosphatase) system was previously reported. This system delivers phosphatase activity to phosphorylated POIs via peptide binders for targeted POI dephosphorylation (Simpson et al.). Cell Chem . Biol (2023, 30, 188). Other recent studies have also explored targeted dephosphorylation. It has been demonstrated that heterobifunctional molecules containing Halo-tags or peptide ligands to bind protein phosphatase PP1 and selective inhibitors to bind Akt or EGFR reduce phosphorylation of Akt and EGFR (epidermal growth factor receptor) (Yamazoe et al., 2023, 30, 188). J . Med . Chem., 2020, 63, 2807). Another study reported the development of a dTAG and Halo-tagged heterobifunctional small molecule recruiter called PhosTAC7, which recruits dTAG-PP2A A (the A scaffolding subunit of protein phosphatase 2A) to Halo-PDCD4 (programmed cell death 4) and Halo-FOXO3a (Chen et al., 2020, 63, 2807). ACS Chem . Biol ., 2021, 16, 2808) and Halo-tau (Hu et al., J . Am . Chem . Soc (2023, 145, 4045), thereby reducing Halo-POI dephosphorylation. More recently, it has been shown that in gastric cancer cells, the use of heterobifunctional molecules to recruit endogenous PP5 to ASK1 (apoptosis signal-regulated kinase 1) produces reduced ASK1 phosphorylation levels and associated antiproliferative activity (Zhang et al., 2023, 145, 4045). J . Am . Chem ., Soc ., 2023, 145, 1118).

[0005] Although these proof-of-concept studies using heterobifunctional molecules have demonstrated the potential for targeted dephosphorylation, most studies rely on overexpression model systems using suboptimal compounds (e.g., requiring high micromolar concentrations), which have limited practicality, and none of the studies have clearly established the dependence on target phosphatase activity to observe a reduction in POI phosphorylation.

[0006] WO 2024 / 030455 A2 (UNIV UTAH RES FOUND; UNIV CALIFORNIA) describes compositions comprising a ligandable tag, a linker, and a labeling enzyme, wherein the linker links the ligandable tag to the labeling enzyme. Also described are nucleic acid sequences capable of encoding one or more protein-based compositions, and: compositions comprising a ligand conjugated to a target molecule; systems comprising a labeling composition and a targeting composition, wherein the labeling composition comprises a ligandable tag, a linker, and a labeling enzyme, wherein the linker links the ligandable tag to the labeling enzyme, wherein the targeting composition comprises a ligand conjugated to a target molecule, wherein the ligand of the targeting composition is a ligand of the ligandable tag of the labeling composition; and methods of using these compositions and systems.

[0007] There is a need in the art for an effective PIC with broad applicability, that is, a PIC that can work in conjunction with previously unavailable systems or points of interest (POIs), not necessarily limited to targeting dephosphorylation or degradation, and that functions with minimal aberrant protein activity. This invention addresses this need. Summary of the Invention

[0008] The inventors have prepared a novel proximity-inducing compound (PIC) called BDPIC, which is used to induce proximity between two biomolecules, enabling them to interact. The inventors have found that BDPIC is surprisingly effective in inducing proximity between biomolecules. Furthermore, the inventors have found that BDPIC enables interactions between previously inaccessible—more extensive—biomolecules, with the unexpected advantage of minimizing aberrant biological activity.

[0009] Therefore, from the first aspect, a neighbor-induced compound equivalent to formula (Ia) is provided:

[0010] (Ia)

[0011] in: It is the first ligand capable of binding to biomolecules with hole-modified Brd bromine domains; It is a second ligand capable of binding to biomolecules with FKBP; L 1 It is a connector.

[0012] To avoid ambiguity, and This refers to the ligands that bind to the tags 'BromoTag' and 'dTAG', respectively, rather than the tags themselves.

[0013] The inventors have demonstrated that the first aspect of PIC is highly effective in methods for inducing proximity between biomolecules so that they can interact.

[0014] Therefore, from a second perspective, a method for inducing proximity between two biomolecules is provided, the method comprising: By bringing the first and second biomolecules into contact with the first aspect of the neighbor-inducing compound, a ternary complex is formed, thereby inducing proximity between the two biomolecules so that they can interact. And optional: Detection of ternary complex formation; and / or Detecting the interaction or lack thereof between two biomolecules; in: The first biomolecule contains a hole-modified Brd bromine domain; and The second biomolecule contains FKBP.

[0015] definition

[0016] In the following discussion, numerous terms are used, and unless the context otherwise indicates otherwise, these terms have the meanings provided below. This document is used to define compounds, particularly those according to the nomenclature of the invention, generally based on the rules of the IUPAC organization for chemical compounds, especially the "IUPAC Chemical Terminology Compendium (Gold Book)". For the avoidance of ambiguity, if the IUPAC rules conflict with the definitions provided herein, the definitions provided herein shall prevail. Furthermore, if the structure of a compound conflicts with the name provided for that structure, the name provided for that structure shall prevail.

[0017] The term “comprising” or variations thereof shall be understood herein to mean that which includes the said element, integer or step or group of elements, integers or steps, but does not exclude any other element, integer or step or group of elements, integers or steps.

[0018] The term “composition” or variations thereof shall be understood to mean a group that includes the said element, integer or step, but excludes any other element, integer or step.

[0019] The term "alkyl" is well known in the art and is defined as a monovalent group derived from an alkane by removing a hydrogen atom from any carbon atom, wherein the term "alkane" is intended to define a group having the general formula C n H 2n+2 (where n is an integer ≥ 1) acyclic branched or unbranched hydrocarbons. Alkyl groups can be C16-164 ... 1-6 Alkyl group. In some cases, the alkyl group is C10. 1-4 Alkyl group. C 1-4 Alkyl refers to any one selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, and tert-butyl.

[0020] The term "haloalkyl" is also well-known and is defined as a monovalent group derived from an alkyl group by replacing one or more hydrogen atoms on one or more carbon atoms with a halogen group. Haloalkyl groups can contain one or more different types of halogens. For example, one or more are independently selected from fluorine, chlorine, bromine, and iodine. In some cases, haloalkyl groups are fluoroalkyl groups.

[0021] Halogen refers to a halogen group. Typically, halogen is any one selected from fluorine, bromine, chlorine, and iodine.

[0022] The term "alkoxy group" defines a monovalent group derived from an alcohol by removing a hydrogen atom from the OH group, while the term "alcohol" is intended to define a group derived from an alkane by replacing a hydrogen atom with a hydroxyl group. Typically, an alkoxy group is a C12 group. 1-6 Alkoxy or C 1-4 Alkyl group.

[0023] The term "heteroaromatic hydrocarbon" is defined as a compound formally derived from an aromatic hydrocarbon by replacing one or more methine (-C=) and / or vinylidene (-CH=CH-) groups with trivalent or divalent heteroatoms (in such a way as to maintain the continuous π-electron system characteristic of aromatic systems). The term "heteroaryl" is defined as all monovalent groups formed by removing one hydrogen atom from a heteroaromatic ring atom, such as carbon or nitrogen, and the term "heteroaryl derivative" is defined as all divalent groups formed by removing two hydrogen atoms from a heteroaromatic ring atom, such as carbon or nitrogen. Typically, heteroaryl or heteroaryl derivatives herein contain any one or a combination of heteroatoms selected from nitrogen, oxygen, and sulfur atoms.

[0024] The term "enantiomer" defines one of a pair of molecular entities that are mirror images of each other and cannot be superimposed, meaning they cannot be superimposed by translation or rigid rotation. Enantiomers are chiral molecules, meaning they can be distinguished by their mirror images.

[0025] As used herein, the term "racemate" refers to a racemic mixture. A racemate is defined as a substantially equimolar mixture of a pair of enantiomers, typically comprising a pair of enantiomers in a ratio of about 1:1.

[0026] The term "diastereomer" (also known as a diastereomer) is defined as a stereoisomer that is not a mirror image of another.

[0027] As used herein, the term "solvate" refers to a complex comprising a solute (e.g., a compound or a salt of a compound) and a solvent. If the solvent is water, the solvate may be called a hydrate, such as a monohydrate, dihydrate, trihydrate, etc., depending on the number of water molecules present in each substrate molecule.

[0028] As used in this article, the term "isotope" defines a variant of a particular chemical element in which the atomic nuclei necessarily have the same atomic number, but have different mass numbers due to their different numbers of neutrons.

[0029] The term "biomolecule" is well-known in the art and refers to any molecule present in an organism that participates in one or more typical biological processes. Biomolecules can include, but are not limited to, proteins, peptides, carbohydrates, lipids, nucleic acids, polynucleotides, vitamins, amino acids, and hormones. Biomolecules can be extracted from their natural sources. They can be produced synthetically or biotechnically. Biomolecules may have non-natural origins, not have a known biological purpose, or be known not to participate in any biological processes. They can be modified or produced in ways different from their natural counterparts.

[0030] As used herein, the term "ligand" is well-known in the field of biochemistry and refers to any molecule that can reversibly bind to a biomolecule to form a complex. Ligand molecules can be small or large molecules, such as proteins. Ligands can be natural or non-natural ligands of biomolecules. A ligand can also be part of a molecule. That is, a ligand molecule can contain both bound and unbound portions, or portions bound to specific biomolecules and other portions bound to other biomolecules. A ligand can bind to only one or a few biomolecules, or it can be promiscuous. Binding can be attributed to any one or more non-covalent intermolecular forces, including, but not limited to, ionic bonds, hydrogen bonds, van der Waals forces, London dispersion forces, dipole-dipole interactions, ion-dipole interactions, salt bridges, π-π interactions, ion-π interactions, hydrophobic effects, hydrophilic effects, and halogen bonds. As a result of ligand binding to a biomolecule, the biomolecule can undergo conformational changes, recruit another biomolecule, be prevented from binding to another ligand or substrate, or be affected in one or more other ways.

[0031] The term "complex," as used herein, is well-known in the field of biochemistry and refers to the stable binding of two or more molecules to form a single unit. Complexes can form as a result of the binding of ligands to biomolecules. When one molecule binds to another molecule, it is usually called a binary complex. When one molecule binds to two other molecules, it is usually called a ternary complex. As a result of complex formation, the complex may gain or lose a specific function relative to the functions of the constituent molecules. For example, a ligand binding to a biomolecule to form a complex can cause that biomolecule to lose its normal function when it is part of the complex. On the other hand, a ligand binding to a biomolecule to form a complex can cause that biomolecule to acquire new or unnatural functions when it is part of the complex.

[0032] The term "proximity" is well-known in the field of biochemistry and refers to a state or condition in which two or more entities are spatially close to or near each other, and this proximity enables or promotes interactions, influences, or functional correlations between them. This proximity is not necessarily defined by a specific distance but can be determined based on the nature of the entities and the type of interaction or effect that the proximity aims to achieve or enhance, depending on the context. These entities can be biomolecules, small molecules, and / or ligands. Therefore, the terms "proximity-inducing compound," "proximity-inducing chimera," or "PIC" should be understood as referring to compounds capable of inducing, achieving, or promoting proximity between two or more entities. A PIC can be a bifunctional small molecule containing one or more ligands and linkers.

[0033] As used herein, the term “contact” means any one or more of the following actions performed in any order and for any length of time: merging, reacting, mixing, stirring, pulping, blending, dissolving, treating, incubating, joining, supplying, passing through, flowing through, or otherwise contacting.

[0034] Aspects of the present invention

[0035] The inventors have developed a novel PIC called BDPIC, which is surprisingly effective in inducing proximity between two biomolecules.

[0036] As described above, in the first aspect, a proximity-inducing compound equivalent to formula (Ia) is provided:

[0037] (Ia)

[0038] in: It is the first ligand capable of binding to biomolecules with hole-modified Brd bromine domains; It is a second ligand capable of binding to biomolecules with FKBP; L 1 It is a connector; As mentioned above, and These refer to the ligands that bind to the tags 'BromoTag' and 'dTAG', respectively, rather than the tags themselves.

[0039] Biomolecules with hole-modified Brd bromine domains or FKBP can be described as “tagged” biomolecules. That is, biomolecules (e.g., proteins) contain grafted functional peptide sequences or “tags.” Tags can be grafted to the C-terminus or N-terminus of a protein, or they can be integrated into the protein's sequence: “internal tags.” Tags can be grafted onto biomolecules to confer functionality. For example, tags can facilitate or enable the purification, identification, visualization, quantification, dissolution, and / or binding of biomolecules.

[0040] BromoTag is a tag that incorporates a hole-modified Brd bromine domain into a protein, wherein a ligand can bind to the tag. In some embodiments of the invention, the hole-modified Brd bromine domain is selected from Brd4BD2. L387A Brd4BD2 L387V Brd4BD1 L94A Brd4BD1 L94V ,Brd2BD2 L383A ,Brd2BD2 L383V ,Brd2BD1 L110A ,Brd2BD1 L110V Brd3BD2 L344A Brd3BD2 L344V Brd3BD1 L70A Brd3BD1 L70V ,BrdTBD2 L306A ,BrdTBD2 L306V ,BrdTBD1 L63A or BrdTBD1 L63V Preferably, the hole-modified Brd bromine domain is Brd4BD2. L387A In some implementations, the bromine domain can be grafted to the C-terminus or N-terminus of the protein, which can be achieved through homologous recombination technologies such as CRISPR / Cas9.

[0041] Bromodomains are protein domains found in a variety of proteins, particularly in the bromo-terminal and extra-terminal (BET) domain families. The BET family includes Brd2, Brd3, Brd4, and BrdT – each protein containing two bromodomains, referred to as BD1 and BD2. Hole-modified Brd bromodomains should be understood as containing a mutated bromodomain such that a 'hole' exists at the substrate binding site. That is, one or more amino acid residues have been replaced by a substitute residue that can accommodate a substrate containing a 'bump' compared to the wild-type domain (hence the term "bump-hole" technique, described in WO 2023 / 047121 A1, which is incorporated herein by reference). In other words, hole-modified Brd bromodomains have a hole at the binding site, enabling highly specific and potent binding of complementary 'bump' ligands. Therefore, in some embodiments, the first ligand is a bulge-type ligand. The protrusion can be a chemical group, such as C. 1-4 Alkyl or C 1-4 Halogenated alkyl groups (e.g., methyl, ethyl, propyl, butyl, trifluoromethyl, or perfluoroethyl, preferably ethyl) can cause steric clashes when combined with wild-type domains, but can be accommodated in 'holes' in modified domains.

[0042] Therefore, in some implementation schemes... It is a first ligand designed to selectively bind, or designed to selectively bind, biomolecules with hole-modified Brd bromine domains. In other words, in some embodiments, It is the first ligand complementary to the hole-modified Brd bromine domain. As mentioned above, in some embodiments, the first ligand is a ligand with a protrusion. That is, in some embodiments, It is the first ligand, wherein the ligand is a protruding ligand for BromoTag, or a protruding ligand for a complementary hole-modified Brd bromine domain. In some embodiments, The first ligand contains a sterically hindered protrusion. Unbound by theory, 'non-complementary' or 'protrusionless' ligands cannot bind, only weakly bind, or are not designed to bind hole-modified Brd bromide domains. Therefore, in some embodiments, It is the first ligand, unable to bind, weakly binds, or is not designed to bind the wild-type bromine domain. Unbound by theory, the hole-modified Brd bromine domain is not a wild-type bromine domain; it is a modified bromine domain. Therefore, in some embodiments, the biomolecule is not a wild-type biomolecule, or the biomolecule is a modified biomolecule. In some embodiments, the biomolecule contains a modified bromine domain.

[0043] dTAG is a tag that incorporates an FK-binding protein (FKBP) into a protein, to which a ligand can bind. In some embodiments of the invention, the FKBP is FKBP12. F36V FKBP12 can also be referred to as FKBP1A. In some implementations, FKBP can be grafted to the C-terminus or N-terminus of a protein, which can be achieved through homologous recombination technologies such as CRISPR / Cas9.

[0044] In some implementations, the hole-modified Brd bromine domain is Brd4BD2. L387A And FKBP is FKBP12 F36V .

[0045] The connector is able to connect to... The covalent bond and the other end of the connector with The covalent bond of the ligand With ligands Any chemical entity that is connected. Those skilled in the art are aware of many possible linkers of different lengths and chemical functional groups, therefore the ligands at both ends of a PIC constitute the most important feature of the PIC.

[0046] In some embodiments, the linker may be a chain of one or more monomer units such that they form a homo- or co-oligomer, or a homo- or co-polymer. When more than one monomer unit is present, these monomer units may be the same monomer (homogeneous oligomer or homopolymer), or they may be two or more different monomers (co-oligomer or copolymer).

[0047] In some implementations, L 1 Having formula (IIIa): –(L 2 ) w –

[0048] (IIIa)

[0049] Where w is an integer from 1 to 10; each L 2Independently selected from C(O)NH, C(O)O, CH2CH2O, CH2, vinylidene, ethynylidene, triazolylene, piperazine, and piperidine; and wherein This indicates the connection location. That is, each L... 2 Independently, it is one of equations (IIId) to (IIIk) and (IIIq):

[0050] The wavy line indicates the connection point. Each L 2 They can be independently connected together from any of the connection points described above or in any of the above formulas. Furthermore, and It can be connected to the connector from any connection point. In some implementations, L 1 Having equations (IIIm) to (IIIp):

[0051] In some implementation schemes, the general formula and This can involve the essential core structures of ligands that can bind only to biomolecules with a Brd-bromine domain modified with a hole, and ligands that can bind to biomolecules with an FKBP domain. In some embodiments, the general formula... and This may include the essential core structure of the aforementioned ligands, as well as the functional groups and / or chemical moieties essential for covalent bonding to the linker. Those skilled in the art will understand whether the above general formula covers, and which specific functional groups and / or chemical moieties it covers, based on the terminal monomer unit of the linker.

[0052] In some implementations, L 1 It is a polyethylene glycol chain. That is, the linker has formula (IIIc):

[0053] Where t is an integer from 1 to 10. Preferably, t is from 2 to 8. More preferably, t is 3.

[0054] In some implementations, the hole-modified Brd bromine domain is Brd4BD2. L387A FKBP is FKBP12 F36V And L 1 It has formula (IIIc), where t is an integer from 1 to 10. Preferably, t is from 2 to 8. More preferably, t is 3.

[0055] In some embodiments, the proximity-inducing compound has the formula (Ib):

[0056] (Ib)

[0057] in: X is a halogen; Each R 1 R 4 and R 6 Independently selected from C1-6 alkyl, C1-6 haloalkyl, C 1-6 Alkyl groups, halogens, and hydroxyl groups; G 1 It is a 5-membered heteroaromatic hydrocarbon, optionally substituted with one or two substituents selected from C14. 1-3 Alkyl, C1-3 haloalkyl, C1-3 alkoxy, halogen, hydroxyl and amino, or G 1 It is a 6-membered aromatic hydrocarbon or heteroaromatic hydrocarbon, which is optionally substituted with one or two substituents selected from methyl, halogen, hydroxyl and mercapto groups; G 2 It's 5 yuan. N - A heteroaromatic hydrocarbon selected from pyrrolidine, pyrrole, imidazoline, pyrazole, imidazoline, triazole, and tetraazole, optionally substituted with one or more substituents selected from C1-3 alkyl, C1-3 haloalkyl, C1-3 ... 1-3 Alkyl, halogen, hydroxyl, and amino; R 2 It is H, C 1-3 Alkyl, C 1-3 Halogenated alkyl groups or halogens; R 3 It is C 1-4 Alkyl or C 1-4 Halogenated alkyl groups; B 1 and B 2 Independently possessing formula (IIa): –(A 2 ) a –(CH2) b –(A 3 ) c –(C(O)) d –(CH2) e –(A 4 ) f –(CH2) g –

[0058] (IIa)

[0059] Where A 2 A 3 and A 4 Independently selected from NH and NC 1-4Alkyl, O, and S; a, c, d, and f are integers independently selected from 0 and 1; b, e, and g are integers independently selected from 0 to 4; and wherein Indicates the connection position; L 3 It is a connector; A 1 Selected from O, NH and NC 1-4 alkyl; H is an integer selected from 0 or 1; R 5 It is C 1-4 Alkyl or C 1-4 Halogenated alkyl groups; and ni, n-ii, and -iii are integers independently selected from 0 to 3.

[0060] As described above, X is a halogen, such as fluorine, chlorine, bromine, or iodine. In some embodiments, X is chlorine.

[0061] In some implementation schemes, R 1 R 4 and R 6 Independently selected from C1-4 alkyl, C1-4 haloalkyl, C 1-3 Alkyl, halogen, and hydroxyl; and ni, nii, and niii are independently selected from integers from 0 to 3. In some embodiments, Ri 1 R 4 and R 6 Independently selected from C1-4 alkyl, C1-4 haloalkyl, and C1-3 alkoxy; and n1, n2, and n3 are independently selected from integers from 0 to 3. Preferably, R 1 R 4 and R 6 Independently selected from C1-4 alkyl, C 1-2 Alkyl group; ni is 0; nii is 2; and niii is 3. More preferably, Ri 1 R 4 and R 6 It is a methoxy group; ni is 0; n-ii is 2; and n-iii is 3.

[0062] In some implementations, X is chlorine; R 1 R 4 and R 6 Independently selected from C1-4 alkyl, C1-4 haloalkyl, and C1-3 alkoxy; and n1, n2, and n3 are independently selected from integers from 0 to 3. Preferably, X is chlorine; R 1 R 4 and R 6 Independently selected from C1-4 alkyl, C 1-2Alkyl group; n-i is 0; n-ii is 2; and n-iii is 3. More preferably, X is chlorine; R 1 R 4 and R 6 It is a methoxy group; ni is 0; n-ii is 2; and n-iii is 3.

[0063] As mentioned above, G 1 It is a 5-membered heteroaromatic hydrocarbon, optionally substituted with one or two substituents selected from C14. 1-3 Alkyl, C1-3 haloalkyl, C1-3 alkoxy, halogen, hydroxyl and amino, or G 1 It is a 6-membered aromatic hydrocarbon or heteroaromatic hydrocarbon, which is optionally substituted with one or two substituents selected from methyl, halogen, hydroxyl, and mercapto groups. That is, when G 1 When it is a 5-membered heteroaromatic hydrocarbon, it reacts with the 2 of formula (Ib). H The C5 and C6 fusion of -1,4-diaza-oxide is as follows:

[0064] In some implementations, G 1 Selected from thiophene, pyrrole, and furan. In some embodiments, G... 1 Selected from thiophene, pyrrole, and furan, heteroaromatic hydrocarbons and formula (Ib) 2 H The C5 and C6 fusion of -1,4-diaza-oxide is as follows:

[0065] The heteroatom in the 5-membered heteroaromatic hydrocarbon is represented by "Het".

[0066] In some implementations, G 1 It is a 5-membered heteroaromatic hydrocarbon, which is substituted by one or two substituents selected from C14. 1-3 Alkyl, C1-3 haloalkyl, C1-3 alkoxy, halogen, hydroxyl, and amino groups. In some embodiments, the 5-membered heteroaromatic hydrocarbon is thiophene, pyrrole, or furan, which is substituted with one or two substituents selected from C1-3 alkyl, halogen, hydroxyl, and amino groups. 1-3 Alkyl, C1-3 haloalkyl, and hydroxyl groups. Preferably, the 5-membered heteroaromatic hydrocarbon is thiophene, pyrrole, or furan, which is substituted with two substituents selected from C1-3 haloalkyl. 1-3 Alkyl, C1-3 haloalkyl, and hydroxyl groups. More preferably, the 5-membered heteroaromatic hydrocarbon is thiophene, pyrrole, or furan, which is substituted with two methyl groups. Even more preferably, the 5-membered heteroaromatic hydrocarbon is thiophene, which is substituted with two methyl groups.

[0067] In some embodiments, the 5-membered heteroaromatic hydrocarbon is thiophene, pyrrole, or furan, which is substituted with two substituents selected from C14. 1-3Alkyl, C1-3 haloalkyl and hydroxyl, 5-membered heteroaromatics and 2 of formula (Ib) H The C5 and C6 fusion of -1,4-diaza-oxide is as follows:

[0068] Where R 7 Equivalent to two substituents, which are selected from C 1-3 Alkyl, C1-3 haloalkyl and hydroxyl.

[0069] In some implementations, G 1 It is a 6-membered aromatic hydrocarbon or heteroaromatic hydrocarbon, optionally substituted with one or two substituents selected from methyl, halogen, hydroxyl, and mercapto groups. In some embodiments, the 6-membered aromatic hydrocarbon or heteroaromatic hydrocarbon is selected from benzene, pyridine, pyridazine, pyrimidine, pyrazine, and triazine, each optionally substituted.

[0070] As mentioned above, G 2 It's 5 yuan. N - A heteroaromatic hydrocarbon selected from pyrrolidine, pyrrole, imidazoline, pyrazole, imidazoline, triazole, and tetraazole, optionally substituted with one or more substituents selected from C1-3 alkyl, C1-3 haloalkyl, C1-3 ... 1-3 Alkoxy, halogen, hydroxyl, and amino.

[0071] In some implementations, G 2 It is a 5-membered compound selected from imidazole, triazole, and tetraazole. N - heteroaromatic hydrocarbons, optionally substituted with one or more substituents selected from C1-3 alkyl, C1-3 haloalkyl, C1-3 ... 1-3 Alkyl, halogen, hydroxyl, and amino. In other words, G 2 With equation (Ib) 2 H The C3 and N4 fusion of -1,4-diaza-carbamate is as follows:

[0072] Where R 8 Equivalent to being independently selected from C1-3 alkyl, C1-3 haloalkyl, C 1-3 Optional substituents of alkoxy, halogen, hydroxyl and amino groups.

[0073] In some implementations, where G 2 It is a 5-membered compound selected from imidazole, triazole, and tetraazole. N -Heteroaromatics, 5-membered N - The heteroaromatic hydrocarbon is optionally substituted with one or more substituents selected from C1-3 alkyl, C1-3 haloalkyl, C1-3 ... 1-2 Alkyl groups and halogens. In some embodiments, 5-membered... N- The heteroaromatic hydrocarbon is a triazole, which is optionally substituted with a substituent selected from C1-3 alkyl, C1-3 haloalkyl, C1-3 ... 1-2 Alkyl and halogen. Preferably, the triazole is substituted with a C1-3 alkyl group. More preferably, the triazole is substituted with a methyl group.

[0074] In some implementation schemes, R 2 It is H, C 1-3 Alkyl or C 1-3 Haloalkyl. Preferably, R 2 It is an H or C1-3 alkyl group. More preferably, R 2 It is H.

[0075] In some implementation schemes, R 3 It is C 1-4 Alkyl groups, such as methyl, ethyl, propyl, or butyl; R 3 It is a C1-4 haloalkyl group. Preferably, R 3 It is C 1-4 Alkyl group. Wherein R... 3 It is propyl, R 3 It can be 1-propyl or 2-propyl. Where R... 3 It is butyl, R 3 It can be 1-butyl, 2-butyl or tert-butyl More preferably, R 3 Selected from methyl, ethyl, 2-propyl and tert-butyl Even more preferably, R 3 It is methyl or ethyl. Even more preferably, R 3 It is an ethyl group.

[0076] In some implementations, X is chlorine; R 1 Selected from C1-4 alkyl, C1-4 haloalkyl, and C1-3 alkoxy; ni is an integer from 0 to 3; G 1 It is a 5-membered heteroaromatic hydrocarbon selected from thiophene, pyrrole, or furan, which is substituted with one or two substituents selected from C. 1-3 Alkyl, C1-3 haloalkyl and hydroxyl; G 2 It is a 5-membered compound selected from imidazole, triazole, and tetraazole. N - heteroaromatic hydrocarbons, optionally substituted with one or more substituents selected from C1-3 alkyl, C1-3 haloalkyl, C1-3 ... 1-2 Alkoxy and halogen; R 2 Selected from H, C 1-3 Alkyl or C 1-3 Halogenated alkyl; and R 3 It is C 1-4 Alkyl or C1-4 haloalkyl.

[0077] Preferably, X is chlorine; R1 It is a C1-4 alkyl or C1-3 alkoxy; ni is 0 or 1; G 1 It is a 5-membered heteroaromatic hydrocarbon selected from thiophene, pyrrole, or furan, which is substituted by two C1-3 alkyl groups; G 2 It is a triazole, which is optionally substituted with a substituent selected from C1-3 alkyl, C1-3 haloalkyl, C1-3 ... 1-2 Alkoxy and halogen; R 2 Is it H or C? 1-3 Alkyl; and R 3 It is C 1-4 alkyl.

[0078] More preferably, X is chlorine; R 1 It is a C1-3 alkyl or C1-2 alkoxy; ni is 0 or 1; G 1 It is thiophene, which is substituted with two C1-2 alkyl groups; G 2 It is a triazole, which is substituted with one of the C1-3 alkyl or halogen substituents; R 2 It is H; and R 3 It is C 1-2 alkyl.

[0079] As mentioned above, B 1 and B 2 Independently possessing formula (IIa): –(A 2 ) a –(CH2) b –(A 3 ) c –(C(O)) d –(CH2) e –(A 4 ) f –(CH2) g –

[0080] (IIa)

[0081] Where A 2 A 3 and A 4 Independently selected from NH and NC 1-4 Alkyl, O, and S; a, c, d, and f are integers independently selected from 0 and 1; b, e, and g are integers independently selected from 0 to 4; and wherein Indicates the connection location.

[0082] When selecting variable A above 2 A 3 A 4When creating implementation schemes for A, B, C, D, E, F, and G, conventional chemical rules must be applied. That is, the implementation scheme for the first aspect must contain chemically feasible compounds. For example, where A... 2 A 3 and A 4 The hypothetical implementation where a, c, and f are 1; and b, d, e, and g are 0 would provide a chemically infeasible compound. Those skilled in the art will understand what constitutes and does not constitute a chemically feasible compound, and thereby understand which implementations are feasiblely described by formula (IIa).

[0083] In some implementation schemes, B 1 It has equation (IIa), where a, b, c, e, and g are 0; d and f are 1; and A 4 Selected from NH, NC 1-4 Alkyl, O and S; and B 2 It has equation (IIa), where a and g are 0; b is 0 to 3; c, d, e, and f are 1; and A 3 and A 4 Independently selected from NH and NC 1-4 Alkyl groups, O, and S. Preferably, B 1 It has equation (IIa), where a, b, c, e, and g are 0; d and f are 1; and A 4 It is NH or O; and B 2 It has equation (IIa), where a and g are 0; b is 2; c, d, e, and f are 1; and A 3 and A 4 Independently selected from NH, O, and S. More preferably, B 1 It has equation (IIa), where a, b, c, e, and g are 0; d and f are 1; and A 4 It is O; and B 2 It has equation (IIa), where a and g are 0; b is 2; c, d, e, and f are 1; A 3 and A 4 It is NH; and A 4 It is O.

[0084] In some implementation schemes, B 1 and B 2 Independently selected from formulas (IIa1) to (IIa2): –(C(O)) d –(CH2) e –(A 4 ) f –(CH2) g –

[0085] (IIa1) –(CH2) b –(A 3 ) c –(C(O)) d –(CH2) e –(A 4 ) f –

[0086] (IIa2)

[0087] Where A 3 A 4 b to g are as defined above.

[0088] In some implementation schemes: B 1 It has the formula (IIa1), where d is 1; e is 0 to 2; A 4 Selected from NH, NC 1-4 Alkyl, O, and S; f is 1; and g is 0 to 2; and B 2 It has the formula (IIa2), where b is 0 to 4; A 3 Selected from NH, NC 1-4 Alkyl, O, and S; c is 1; d is 1; e is 0 to 4; A 4 Selected from NH, NC 1-4 Alkyl, O, and S; and f is 1.

[0089] Preferably; B 1 It has the formula (IIa1), where d is 1; e is 0 to 1; A 4 It is NH or O; f is 1; and g is 0 to 1; and B 2 It has the formula (IIa2), where b is 1 to 3; A 3 It is NH or O; c is 1; d is 1; e is 0 to 2; A 4 Selected from NH, O and S; and f is 1.

[0090] More preferably: B 1 It has the formula (IIa1), where d is 1; e is 0; A 4 It is NH; f is 1; and g is 0; and B 2 It has the formula (IIa2), where b is 2; A 3 It is NH; c is 1; d is 1; e is; A 4 It is O; and f is 1.

[0091] As mentioned above, L3 It is able to make B 1 Connect to B 2 Linkers. In some embodiments, linkers can be chains of one or more monomer units such that they form homo- or co-oligomers or homo- or copolymers. When more than one elastic monomer unit is present, the monomer units can be the same monomer (homogeneous oligomer or homopolymer) or they can be two or more different monomers (co-oligomers or copolymers).

[0092] In some implementations, L 3 Having formula (IIIa): –(L 2 ) w –

[0093] (IIIa)

[0094] Where w is an integer from 1 to 10; each L 2 Independently selected from C(O)NH, C(O)O, CH2CH2O, CH2, vinylidene, ethynylidene, triazole, piperazine, and piperidinin; and wherein This indicates the connection location. That is, each L... 2 Independently, it is one of equations (IIId) to (IIIk) and (IIIq):

[0095] The wavy line indicates the connection point. Each L 2 They can be connected independently from any of the connection points described above or in any of the above formulas. Furthermore, B 1 and B 2 It can be connected to the connector from any connection point. In some implementations, L 3 Having equations (IIIm) to (IIIp):

[0096] In some implementation schemes, wherein: B 1 It has equation (IIa), where a, b, c, e, and g are 0; d and f are 1; and A 4 Selected from NH, NC 1-4 Alkyl, O and S; and B 2 It has equation (IIa), where a and g are 0; b is 0 to 3; c, d, e, and f are 1; and A 3 and A 4 Independently selected from NH and NC 1-4 Alkyl, O, and S; L 3It has equation (IIIa), where L 2 It is CH2CH2O; and w is 1 to 10.

[0097] Preferably, wherein: B 1 It has equation (IIa), where a, b, c, e, and g are 0; d and f are 1; and A 4 It is NH or O; and B 2 It has equation (IIa), where a and g are 0; b is 2; c, d, e, and f are 1; and A 3 and A 4 Independently selected from NH, O, and S; L 3 It has equation (IIIa), where L 2 It is CH2CH2O; and w is 2 to 7.

[0098] More preferably, wherein: B 1 It has equation (IIa), where a, b, c, e, and g are 0; d and f are 1; and A 4 It is O; and B 2 It has equation (IIa), where a and g are 0; b is 2; c, d, e, and f are 1; A 3 and A 4 It is NH; and A 4 It is O; L 3 It has equation (IIIa), where L 2 It is CH2CH2O; and w is 3.

[0099] In some implementation schemes, B 1 Choose any one of equations (IIb) to (IIe):

[0100] Where p is an integer from 0 to 4; and the wavy line indicates the connection position. Preferably, where B 1 Having formula (IIb) or (IIc), p is 0 or 1. More preferably, where B 1 Having equation (IIb) or (IIc), p is 0.

[0101] In some implementation schemes, B 2 Having the formula (IIf) or (IIg):

[0102] Where A 5 It is O or NH; A 6 It is O, NH, or S; m and q are independent integers selected from 0 to 4; and the wavy line indicates the connection position. Preferably, B2 Having the formula (IIf), A 5 It is NH, and A 6 It is O. More preferably, where B 2 Having the formula (IIf), A 5 It is NH, and A 6 It is O; m is 2; and q is 1.

[0103] In some implementations, L 3 Having formula (IIIc):

[0104] Where t is an integer selected from 1 to 10; and the wavy line indicates the connection position. Preferably, t is selected from 1, 2, 3, 4, 5, 6, 7, and 8. More preferably, t is selected from 2, 3, 4, and 5. Even more preferably, t is 3.

[0105] In some implementation schemes, wherein: B 1 Choose from any one of equations (IIb) to (IIe), where p is as described above; and B 2 It has the formula (IIf) or (IIg), where A 5 A 6 m and q are as described above; L 3 It has equation (IIIc), where t is as described above.

[0106] Preferably, wherein: B 1 It has equation (IIb) or (IIc), where p is 0 or 1; and B 2 It has the formula (IIf), where A 5 It is NH; A 6 It is O; and m and q are independently selected from 0, 1, and 2; L 3 It has equation (IIIc), where t is selected from 1, 2, 3, 4, 5, 6, 7 and 8.

[0107] More preferably, wherein: B 1 It has equation (IIb), where p is 0; and B 2 It has the formula (IIf), where A 5 It is NH; A 6 It is O; m is 2; and q is 1; L 3 It has the formula (IIIc), where t is 3.

[0108] In some implementation schemes, A 1 It is O or NH. Preferably, A 1It is O.

[0109] In some implementations, h is 0 or 1. Preferably, h is 1.

[0110] In some implementation schemes, R 5 It is C 1-4 Alkyl groups, such as methyl, ethyl, propyl, or butyl; R 5 It is a C1-4 haloalkyl group. Preferably, R 5 It is C 1-4 Alkyl group. Wherein R... 5 It is propyl, R 5 It can be 1-propyl or 2-propyl. Where R... 5 It is butyl, R 5 It can be 1-butyl, 2-butyl or tert-butyl More preferably, R 5 Selected from methyl, ethyl, 2-propyl and tert-butyl Even more preferably, R 5 It is methyl or ethyl. More preferably, R 5 It is an ethyl group.

[0111] In some implementations, h is 0 or 1; A 1 It is O or NH; and R 5 Selected from methyl, ethyl, 2-propyl and tert-butyl Preferably, h is 1; A 1 It is O; and R 5 It is an ethyl group.

[0112] In some embodiments, the proximity-inducing compound has formula (IVa):

[0113] (IVa)

[0114] Among them B 1 L 3 and B 2 Independently as defined in any of the foregoing implementation schemes.

[0115] In some embodiments, the proximity-inducing compound has the formula (IVb):

[0116] (IVb)

[0117] The object of this invention is to provide a PIC (Biological Proximity Concentration) in a method for inducing proximity between biomolecules, enabling them to interact. Therefore, in a second aspect, a method for inducing proximity between two biomolecules is provided, the method comprising: The first and second biomolecules are brought into contact with a proximity-inducing compound of the first aspect to form a ternary complex, thereby inducing proximity between the two biomolecules so that they can interact. And optional: Detection of ternary complex formation; and / or Detecting the interaction or lack thereof between two biomolecules; in: The first biomolecule contains a hole-modified Brd bromine domain; and The second biomolecule contains FKBP.

[0118] To avoid ambiguity, any implementation of the PIC associated with the first aspect can be applied to the method of the second aspect. That is, in some implementations of the second aspect, the PIC is as described in any implementation of the first aspect.

[0119] In some implementations of the second aspect, PIC has formula (IVa), where B 1 L 3 and B 2 Independently as defined in any of the foregoing embodiments of the first aspect. In some embodiments of the second aspect, the PIC has formula (IVb).

[0120] The term "contact" is as defined above. In some embodiments, contact involves adding a PIC to a biomolecule. In alternative embodiments, the biomolecule is added to the PIC. The PIC and the biomolecule may each be independently in a solution, suspension, or slurry upon contact. In some embodiments, they are each in a solution, such as a buffer solution, upon contact. Alternatively, one may be in a solution (e.g., a buffer solution), while the other may be added as a pure or concentrated sample.

[0121] In some embodiments, one biomolecule is a protein. In some embodiments, both biomolecules are proteins. In some embodiments, one biomolecule is a tagged protein. In some embodiments, both biomolecules are tagged proteins.

[0122] As described above, BromoTag is a tag that incorporates a hole-modified Brd bromine domain into a protein, to which a ligand can bind. In some embodiments of the second aspect, a biomolecule is a protein tagged with BromoTag. That is, the biomolecule contains a hole-modified Brd bromine domain.

[0123] One type of biomolecule is a protein tagged with BromoTag or containing a Brd bromine domain with a hole modification, wherein the hole-modified Brd domain is selected from Brd4BD2. L387A Brd4BD2 L387V Brd4BD1 L94A Brd4BD1 L94V ,Brd2BD2 L383A ,Brd2BD2 L383V , Brd2BD1 L110A , Brd2BD1 L110V Brd3BD2 L344A Brd3BD2 L344V Brd3BD1 L70A Brd3BD1 L70V ,BrdTBD2 L306A ,BrdTBD2 L306V ,BrdTBD1 L63A Or BrdTBD1 L63V Preferably, the hole-modified Brd domain is Brd4BD2. L387A In some implementations, this domain can be grafted to the C-terminus or N-terminus of a protein, which can be achieved through homologous recombination technologies such as CRISPR / Cas9.

[0124] As described above, dTAG is a tag that incorporates an FK-binding protein (FKBP) into a protein, to which a ligand can bind. In some embodiments of the second aspect, a biomolecule is a protein tagged with dTAG. That is, the biomolecule contains FKBP.

[0125] One of the biomolecules is a protein with a dTAG tag or contains FKBP, specifically FKBP12. Preferably, the FKBP is FKBP12. F36V FKBP12 can also be referred to as FKBP1A. In some implementations, FKBP can be grafted to the C-terminus or N-terminus of a protein, which can be achieved through homologous recombination technologies such as CRISPR / Cas9.

[0126] In some implementations, one biomolecule is a protein tagged with BromoTag, and the other is a protein tagged with dTAG, with the hole-modified Brd bromine domain selected from Brd4BD2. L387A Brd4BD2 L387V Brd4BD1 L94A Brd4BD1 L94V ,Brd2BD2 L383A ,Brd2BD2 L383V, Brd2BD1 L110A , Brd2BD1 L110V Brd3BD2 L344A Brd3BD2 L344V Brd3BD1 L70A Brd3BD1 L70V ,BrdTBD2 L306A ,BrdTBD2 L306V ,BrdTBD1 L63A Or BrdTBD1 L63V Furthermore, FKBP is FKBP12. Preferably, the hole-modified Brd bromine domain is Brd4BD2. L387A And FKBP is FKBP12 F36V .

[0127] As defined above, a binary complex is formed when one molecule binds to another molecule. Furthermore, a ternary complex is formed when one molecule binds to two other molecules. In some embodiments of the invention, the ternary complex is formed when the binary complex binds to another molecule. In some embodiments, the binary complex is a complex between a biomolecule and a PIC. In some embodiments, the binary complex is a complex between a protein and a PIC. In some embodiments, the protein may be a tagged protein, such as a protein tagged with BromoTag or dTAG. Where the protein is tagged with BromoTag, one of the ligands or a terminal of the PIC may bind to the hole-modified Brd bromine domain of the tagged protein. Where the protein is tagged with dTAG, one of the ligands or a terminal of the PIC may bind to the FKBP of the tagged protein. In some embodiments, the ligands of the PIC... It can bind to the hole-modified Brd bromine domain of the tagged protein to form a binary complex. In some embodiments, the ligand of PIC... It can bind to the FKBP of the tagged protein to form a binary complex.

[0128] In some embodiments, the ternary complex is a complex of PIC with both the first and second biomolecules. That is, both biomolecules bind independently to PIC. In some embodiments, the ternary complex is the result of a complex formed between any of the above-mentioned binary complexes and another biomolecule. In some embodiments, the ternary complex is the result of a complex formed between any of the above-mentioned biomolecules and a binary complex. In some embodiments, the biomolecule is a protein. In some embodiments, the biomolecule is independently a tagged protein. In some embodiments, one tagged protein is tagged with BromoTag, and the other tagged protein is tagged with dTAG. One of the proteins is a BromoTag-tagged protein, and the other protein is a dTAG-tagged protein: one of the ligands of PIC, the ligand... The terminal end can bind to the Brd bromine domain modified by a tagged protein; and one of the PIC ligands, ligands The terminal end may bind to another tagged protein's FKBP.

[0129] In some embodiments, the detection of ternary complex formation is performed by any one or more methods selected from immunoprecipitation (IP), protein complex immunoprecipitation (Co-IP), protein labeling, mass spectrometry (MS), X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, surface plasmon resonance (SPR), yeast two-hybrid (Y2H) screening, fluorescence resonance energy transfer (FRET), cryo-electron microscopy (cryo-EM), bimolecular fluorescence complementarity (BiFC), affinity chromatography, SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), Blue Native (BN)-PAGE, pull-down assay, and isothermal titration calorimetry (ITC).

[0130] In some embodiments, the detection of ternary complex formation is performed by one or more methods selected from immunoprecipitation, Western blotting, and mass spectrometry.

[0131] As described above, the method comprises contacting a first biomolecule and a second biomolecule with a proximity-inducing compound of the first aspect to form a ternary complex, thereby inducing proximity between the two biomolecules so that they can interact. The term proximity is as defined above and refers to a state or condition in which two or more entities are spatially close or near each other, such proximity enabling or promoting interactions, influences, or functional correlations between them. Therefore, PIC should be understood as a compound capable of inducing, enabling, or promoting proximity between two or more entities. These entities can be biomolecules, such as proteins or tagged proteins. Interactions that can arise from the induced proximity between the two biomolecules include, but are not limited to, proteasome-targeted degradation, lysosome-targeted degradation, protein inhibition, protein stabilization, enzyme-substrate interactions, signal transduction, cytoskeletal protein interactions, protein complexation in DNA replication and repair, transcription factor binding, protein transport, regulatory protein interactions, immune response interactions, allosteric interactions, post-translational modifications, phosphorylation, and dephosphorylation. Phosphorylation and dephosphorylation can be considered as types or subsets of post-translational modifications, such as ubiquitination, acetylation, methylation, glycosylation, sulfation, lipidation, and SUMOylation (SUMO – small ubiquitin-like modifications).

[0132] In some embodiments, the interaction to be detected or the lack thereof is selected from proteasome-targeted degradation, lysosomal-targeted degradation, protein inhibition, protein stabilization, enzyme-substrate interaction, signal transduction, cytoskeletal protein interaction, protein complexation in DNA replication and repair, transcription factor binding, protein transport, regulatory protein interaction, immune response interaction, allosteric interaction, post-translational modification, phosphorylation, and dephosphorylation. Preferably, the interaction to be detected or the lack thereof is selected from post-translational modification, phosphorylation, and dephosphorylation. More preferably, the interaction to be detected or the lack thereof is dephosphorylation.

[0133] In some embodiments, the interaction is an enzyme-substrate interaction or post-translational modification, and this interaction can be a dephosphorylation reaction. In some embodiments, the interaction is a dephosphorylation reaction, and one or both biomolecules can be tagged proteins. In some embodiments, the tagged protein can be tagged with BromoTag or dTAG. In some embodiments, the tagged protein can be a phosphatase. In some embodiments, the tagged protein is a phosphatase, and the phosphatase can be tagged with BromoTag or dTAG. In some embodiments, the phosphatase is tagged with BromoTag. That is, in some embodiments, the phosphatase contains a hole-modified Brd bromine domain. In some embodiments, the hole-modified Brd bromine domain is selected from Brd4BD2. L387A Brd4BD2 L387V Brd4BD1 L94A Brd4BD1 L94V ,Brd2BD2 L383A ,Brd2BD2 L383V , Brd2BD1 L110A , Brd2BD1 L110V Brd3BD2 L344A Brd3BD2 L344V Brd3BD1 L70A Brd3BD1 L70V ,BrdTBD2 L306A ,BrdTBD2 L306V ,BrdTBD1 L63A Or BrdTBD1 L63V Preferably, the hole-modified Brd bromine domain is Brd4BD2. L387A In some embodiments, the interaction is a dephosphorylation reaction, and one of the biomolecules may be a phosphorylated protein. In some embodiments, the phosphorylated protein may be tagged. In some embodiments, the tag is BromoTag or dTAG. In some embodiments, the phosphorylated protein is a protein tagged with dTAG. That is, the phosphorylated protein contains FKBP. In some embodiments, the FKBP is FKBP12. In some embodiments, the FKBP is FKBP12. F36VIn some embodiments, the phosphatase is PPM1H, PPP2CA, PPP1CA, or PPM1A. Preferably, the phosphatase is PPM1H or PPP2CA. In some embodiments, the phosphatase is tagged with a BromoTag, and the phosphatase is BromoTag-PPM1H or BromoTag-PPP2CA. In some embodiments, the phosphorylated protein is SMAD3 or TFEB. In some embodiments, the phosphorylated protein is a protein tagged with a dTAG. This protein is dTAG-SMAD3 or dTAG-TFEB.

[0134] In some embodiments, the phosphatase is tagged with a dTAG tag; for example, in some embodiments, the phosphatase is dTAG-PPP2CA. Similarly, in some embodiments, the phosphorylated protein is tagged with a BromoTag; for example, in some embodiments, the phosphorylated protein is Tau-BromoTag.

[0135] In some implementations, the detection of interaction or lack of interaction between two biomolecules is performed by one or more methods selected from immunoprecipitation (IP), protein complex immunoprecipitation (Co-IP), protein labeling, mass spectrometry (MS), X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, surface plasmon resonance (SPR), yeast two-hybrid (Y2H) screening, fluorescence resonance energy transfer (FRET), cryo-electron microscopy (cryo-EM), bimolecular fluorescence complementarity (BiFC), affinity chromatography, SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), Blue Native (BN)-PAGE, pull-down assay, and isothermal titration calorimetry (ITC).

[0136] In some embodiments, the detection of interaction or lack of interaction is performed by one or more methods selected from immunoprecipitation, Western blotting, and mass spectrometry. In some embodiments, the detection of interaction or lack of interaction is performed by Western blotting or mass spectrometry.

[0137] In some implementations, the detection of the formation and / or the detection of the absence of interaction is performed by one or more methods selected from immunoprecipitation, Western blotting, and mass spectrometry.

[0138] In some embodiments of the second aspect, the biomolecule is a protein; the interaction or lack thereof to be detected is selected from degradation targeting the proteasome, degradation targeting the lysosome, protein inhibition, protein stabilization, post-translational modification, phosphorylation, and dephosphorylation; and the detection of the formation and / or detection of the interaction or lack thereof is performed by one or more methods selected from immunoprecipitation, Western blotting, and mass spectrometry.

[0139] The compounds of the present invention may exist in more than one stereoisomer form. For the avoidance of doubt, all stereoisomer forms of any compound of any of the foregoing embodiments of the first or second aspect are included within the scope of the present invention. Stereoisomer forms include, but are not limited to, racemic mixtures, scalemic or non-equimolar mixtures of enantiomers, single enantiomers, diastereomer mixtures, single diastereomers, and mixtures of stereoisomers in any proportion. Although some formulas of the above embodiments can be described by specific stereochemistry, such as racemates, specific enantiomers, or specific diastereomers, this does not exclude alternative stereoisomers or stereoisomer forms from the scope of the present invention.

[0140] This also includes solvates and isotope-labeled compounds of the present invention. The isotope-labeled compounds are the same as those described herein, but in practice, one or more atoms are replaced by atoms with atomic masses or mass numbers different from those predominantly found in nature. Examples of isotopes that can be incorporated into the compounds of the present invention include isotopes of hydrogen, carbon, nitrogen, oxygen, sulfur, fluorine, and chlorine, for example… 2 H (i.e., deuterium) 3 H, 13 C 14 C 15 N、 18 O、 17 O、 35 S, 18 F and 36 Cl.

[0141] A protium atom (H) is a hydrogen atom with zero neutrons. A deuterium atom (D or 2 H) is a hydrogen atom with one neutron. Naturally occurring hydrogen contains approximately 0.02 mol% deuterium and 99.98% protium. The physicochemical properties between protium and deuterium are small but measurable. Deuterium is slightly less lipophilic than protium, has a smaller molar volume, and the carbon-deuterium bond is shorter than the carbon-protium bond. Compared to H, deuterium retains the 3D surface, shape, and spatial flexibility of the molecule. A deuterium:protium ratio greater than 1:99 in a compound is considered greater than the ratio found in naturally occurring hydrogen. In a particular embodiment, the portion is designated as "H" at a position where the deuterium:protium ratio is greater than the natural isotopic abundance of deuterium, i.e., the percentage of deuterium found in the compound of the present invention at that position is greater than its natural isotopic abundance in hydrogen, approximately 0.02 mol%.

[0142] This includes all amorphous and crystalline forms of the compounds of this invention.

[0143] Brief description of the attached diagram: Figure 1 (A) Schematic diagram of BDPIC-mediated proximity induction between TFEB-dTAG and HA-BromoTag-PPP2CA. (BE) Stable co-expression of TFEB-dTAG and HA-BromoTag-empty vector, HA-BromoTag-PPP2CA, or HA-BromoTag-PPP2CA. H118Q U2OS cells. (B) Cells were lysed after treatment with the indicated concentration of BDPIC for 24 h, and the extracts were analyzed by immunoblotting. (CD) Cells were lysed after treatment with 100 nM BDPIC for a specified time. The abundance of TFEB and PPP2CA proteins was analyzed by immunoblotting using the indicated antibodies. (E) Cells were treated with 100 nM BDPIC for 2 h. The BDPIC was washed away with PBS, and fresh medium without BDPIC was added to the cells. The cells were then cultured for a specified time, lysed, and analyzed by immunoblotting as instructed.

[0144] Figure 2

[0145] (A) Schematic diagram of BDPIC-mediated proximity induction between TFEB-BromoTag and dTAG-PPP2CA. (B) Stable co-expression of TFEB-BromoTag and dTAG-empty vector, dTAG-PPP2CA, or dTAG-PPP2CA. H118Q U2OS cells were lysed after treatment with BDPIC for 24 h. The extract (10 μg protein) was analyzed by immunoblotting using the specified antibody.

[0146] Figure 3

[0147] (A) Schematic diagram of HDPIC-mediated proximity induction between TFEB-Halo and dTAG-PPP2CA. (B) Generation of stably expressed TFEB-Halo or co-expression of TFEB-Halo with or without dTAG-PPP2CA. H118Q U2OS cells were used. Cells were lysed after treatment with a specified concentration of HDPIC (B) or PhosTAC7 (C) for 24 h. The extracts (10 μg protein) were analyzed by immunoblotting using a specified antibody.

[0148] Figure 4

[0149] (A) Generated using a two-step CRISPR / Cas9 genome editing method TFEB GFP / GFP / TFE3 - / - C2C12 myoblasts. First, in TFEBHomozygous knock-in of GFP at the C-terminus of the locus was performed, and single clones (clones 2-28) were selected. Within these clones, TFE3 was knocked out via CRISPR / Cas9 genome editing, and single clones (clones 1-3) were isolated. Immunoblotting verification was included. For immunoblotting, after cell lysis, the extract (20 μg protein) was resolved by SDS-PAGE, transferred to a nitrocellulose membrane, and immunoblotted with the specified antibody. (B) U2OS TFEB compared to wild-type (WT) U2OS cells. dTAG / dTAG / BromoTag / + Immunoblot verification of PPP2CA (clone 2) double knock-in clone isolates. (C) TFEB was confirmed by PCR amplification of the target PPP2CA genomic region using two different sets of primers. dTAG / dTAG / BromoTag / + PPP2CA knock-in (clone 2). DNA from WT U2OS cells was included as a negative control. (D) Same as (C), TFEB was confirmed by PCR amplification of the target TFEB genomic region using specified primers. dTAG / dTAG / BromoTag / + PPP2CA knock-in. Samples were run on the same gel, but irrelevant samples (from other clone isolates) were omitted from the images.

[0150] Figure 5

[0151] (AD) Stable expression vectors HA-BromoTag-empty, HA-BromoTag-PPP2CA, or HA-BromoTag-PPP2CA were generated. H118Q of TFEB dTAG / dTAG U2OS cells. (A) Cells were lysed after treatment with DMSO (D), MK-8722 (M) (10 μM), Torin 1 (T) (100 nM), or BDPIC (B) (100 nM) for 2 h. The extract (10 μg protein) was analyzed by immunoblotting as instructed. (B) Cells were lysed after treatment with 100 nM BDPIC for 2 h. The extract (10 μg protein) was analyzed by immunoblotting as instructed. (C) Cells were treated with 100 nM BDPIC for 2 h. DSP crosslinking was performed before lysis. Cell extracts were subjected to anti-HA pull-down treatment. TFEB-dTAG and BromoTag-PPP2CA proteins were analyzed by immunoblotting. (D) Cells were treated with an excess of (10 μM) dTAG. V1 - After treating cells with an inactive PROTAC compound for 30 min, the cells were then treated with 100 nM BDPIC. After 2 h, the cells were lysed and immunoblotted with the specified antibody.

[0152] Figure 6

[0153] (A) Stable expression of HA-BromoTag-empty vector, HA-BromoTag-PPP2CA, or HA-BromoTag-PPP2CA H118Q of TFEB dTAG / dTAG Knocked into U2OS cells, treated with DMSO, Torin 1 (100 nM), or BDPIC (100 nM) for 2 h, then fixed and stained with TFEB immunostaining. Cell nuclei were stained with DAPI. Scale bar, 10 μm. (B) Stable expression of HA-BromoTag-empty vector, HA-BromoTag-PPP2CA, or HA-BromoTag-PPP2CA. H118Q of TFEB dTAG / dTAG Knock-in U2OS cells were lysed after treatment with DMSO or 100 nM BDPIC for 2 hours. The cytoplasm and nuclear fractions were separated and analyzed by immunoblotting using designated antibodies. (C) TFEB dTAG / dTAG U2OS cells knocked into were treated with DMSO or 100 nM BDPIC for 8 h and then lysed. Detection was performed by qRT-PCR. Hexa , Fnip1 , Flcn and Gpnmb Transcript expression. All quantitative data are mean ± SEM from three independent experiments. P < 0.05, compared to DMSO treatment.

[0154] Figure 7

[0155] (AE) TFEB generated by CRISPR / Cas9 technology dTAG / dTAG / BromoTag / +PPP2CA U2OS cells. (A) Cells were lysed after treatment with DMSO, MK-8722 (10 μm), Torin 1 (100 nM), or BDPIC (100 nM) for 2 h. The extract (20 μg protein) was analyzed by immunoblotting. (B) Cells were lysed after treatment with DMSO or 100 nM BDPIC for 2 h. The extract (20 μg protein) was analyzed by immunoblotting as instructed. (C) Cytoplasmic and nuclear fractions were extracted from cells treated with DMSO or 100 nM BDPIC for 2 h and immunoblotted with the specified antibody. (D) Cells were fixed and immunostained with TFEB after treatment with DMSO, MK-8722 (10 μm), or BDPIC (100 nM) for 2 h. The nuclei were stained with DAPI. Scale bar, 10 μm. (E) Cells were lysed after treatment with DMSO, Torin 1 (100 nM), MK-8722 (10 μm), or BDPIC (100 nM) for 4 h. Detection was performed by qRT-PCR. Hexa , Flcn , Gpnmb and Fnip1 Transcriptional expression. All quantitative data are mean ± SD from three independent experiments. Statistical analysis involved paired t-tests for comparison with DMSO treatment. P < 0.05 and P < 0.01, compared to DMSO treatment.

[0156] Figure 8

[0157] (A) U2OS TFEB dTAG / dTAG / BromoTag / + PPP2CA (clone 2) cells were lysed after treatment with BDPIC (100 nM) or DMSO for 2 h. Extracts (20 μg protein) were separated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted with the specified antibody. (BC) HEK293 cells were transiently transfected with plasmids encoding wild-type (WT), Ser109Ala (B), or Ser138Ala (C) mutants of TFEB-FLAG. Protein lysates were collected 48 h after transfection, and immunoblot analysis was performed on TFEB-FLAG and phosphorylated TFEB-FLAG (Ser109 (B) or Ser138 (C)) using the specified antibody. Neoprotein was used as a loading control. (D) Cells from (A) were treated with DMSO or the specified concentration of BDPIC for 48 h. Values ​​were normalized to the DMSO group. All quantitative data are mean ± SEM from 5 independent experiments. MG132 (20 μm) treatment was used as a cytotoxicity positive control. P < 0.05.

[0158] Figure 9

[0159] (A) Schematic diagram of BDPIC-mediated proximity induction between BromoTag-phosphatase and dTAG-SMAD3 to induce dTAG-SMAD3-targeted dephosphorylation. (B) Screening for different BromoTag-phosphatases recruited to target dTAG-SMAD3 for dephosphorylation mediated by BDPIC. U2OS cells were transduced with retroviruses to co-express dTAG-SMAD3 and the specified BromoTag-phosphatase. Cells were serum starved (16 h) and then stimulated with TGFβ (1 h, 5 µg / L). Lysis was performed at the 0 h time point. For the 2 h time point, TGFβ stimulation was removed by washout, and cells were added to fresh serum-free medium without TGFβ while being treated with DMSO or the specified concentration of BDPIC for 2 h. Cells were then lysed, and extracts were separated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted with the specified antibody. (C) Same as (B), except for U2OS cells expressing dTAG-SMAD3 alone or in combination with BromoTag-PPM1H or catalytically inactivated BromoTag-PPM1HH153D. (D) Same as (B), except for U2OS cells expressing dTAG-SMAD3 alone or in combination with BromoTag-PPP2CA or catalytically inactivated BromoTag-PPP2CAH118Q. (E) Same as (B), except for U2OS cells expressing dTAG-SMAD3 alone or in combination with BromoTag-PPM1A or catalytically inactivated BromoTag-PPM1AD239A.

[0160] Figure 10

[0161] (A) Phosphorylation of dTAG-SMAD3 was stimulated by lysing U2OS dTAG-SMAD3 cells after treatment with recombinant TGFβ (5 µg / L) for a specified duration. The extract was separated by SDS-PAGE, transferred to a nitrocellulose membrane, and immunoblotted with the specified antibody. (B) Quantification of relative phosphorylated-dTAG-SMAD3 / total dTAG-SMAD3 from (A). (C) dTAG-SMAD3 dephosphorylation was monitored in U2OS dTAG-SMAD3 cells after stimulation with TGFβ (5 µg / L) for 1 h, followed by either lysis (0 h after elution) or replacement with fresh serum-free medium and lysis after a specified time. Unstimulated cells (treated with TGFβ resuspension) were included as a control. Cells were lysed and the extract was treated as in (A). (D) Quantification of relative phosphorylated-dTAG-SMAD3 / total dTAG-SMAD3 from (C). Numerical values ​​are shown relative to cells treated with TGFβ 0 h after elution and are expressed as mean ± SD.

[0162] Figure 11

[0163] (A) U2OS cells co-expressing dTAG-SMAD3 and BromoTag-PPM1H were serum-starved, then co-treated with TGFβ (5 µg / L) and a specified compound or an equal volume of DMSO for 2 h. The extract was separated by SDS-PAGE, transferred to a nitrocellulose membrane, and immunoblotted with a specified antibody. (B) U2OS FLAG-dTAG-SMAD3 3HA-BromoTag-PPM1H cells were serum-starved overnight, then treated with control or a combination of TGFβ (5 µg / L) plus DMSO, SB-505125 (1 µM), BDPIC (250 nM), or BDPIC (250 nM) and cis-AGB1 (2500 nM) for 2 h. Cells were then lysed, and the extract or anti-HA immunoprecipitate (IP) was immunoblotted as in (A).

[0164] Figure 12

[0165] (A) Schematic diagram of dTAG-SMAD3 phosphorylation-dependent function after TGFβ stimulation and BDPIC-mediated dephosphorylation. (B) Detection of dTAG-SMAD3 nuclear translocation by cell fractionation. U2OS cells were transduced with retroviruses to express dTAG-SMAD3 alone or in combination with BromoTag-PPM1H or BromoTag-PPM1HH153D. Cells were serum starved (16 h) and then co-treated with control or TGFβ (5 µg / L), SB-505124 (1 µM), and BDPIC (100 nM) for 2 h as directed. Cytoplasmic and nuclear fractions were then separated, extracts were separated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted with specified antibodies. (C) U2OS cells expressing dTAG-SMAD3 alone or in combination with BromoTag-PPM1H or BromoTag-PPM1HH153D were treated with serum starvation, followed by treatment with TGFβ (5 µg / L) and DMSO, SB-505124 (1 µM), or BDPIC (100 nM) for 6 h to investigate the effect of dTAG-SMAD3 dephosphorylation on PAI-1 levels. Cells were lysed and the extract was treated as in (B).

[0166] Figure 13

[0167] (A) A549 wild type (WT) and A549 BromoTag / BromoTag PPM1H / dTAG / dTAG SMAD3 Western blot analysis of clone 51 cells. Cells were lysed, extracts were separated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted with the specified antibody. (B) Knock-in was confirmed by polymerase chain reaction amplification of the target SMAD3 genomic region; clone 51 is highlighted in red. Includes cells from parent A549. BromoTag / BromoTag PPM1H Cellular DNA served as a negative control, while DNA from knock-in A549 was included. dTAG / dTAG SMAD3 DNA from clone 5 cells was used as a positive control. Samples were run on the same gel, and irrelevant samples were omitted between the target samples. (C) Validation A549 BromoTag / BromoTag PPM1H / dTAG / dTAG SMAD3 Endogenous dTAG-SMAD3 in clone 51 cells retained its endogenous function, responded to TGFβ stimulation, and subsequently increased PAI-1 protein levels. Cells were stimulated with TGFβ (5 µg / L) for 6 h and then treated as in (A). (D) In ​​A549 BromoTag / BromoTag PPM1H / dTAG / dTAG SMAD3 Preliminary dose-response to BDPIC-mediated dTAG-SMAD3-targeted dephosphorylation in cells. After serum starvation (16 h), cells were stimulated with TGFβ (5 µg / L) for 1 h. Lysis was performed at the 0 h time point. For the 2 h time point, TGFβ stimulation was removed by elution, and cells were added to fresh serum-free medium without TGFβ, while simultaneously treated with DMSO or a specified concentration of BDPIC for 2 h. SB-505124 was used as a control. Cells were then lysed and treated as in (A).

[0168] Figure 14

[0169] (A) In A549 BromoTag / BromoTag PPM1H / dTAG / dTAG SMAD3 Knock-in cells (clone 51) were used to mediate targeted dephosphorylation of dTAG-SMAD3 using BDPIC. After serum starvation (16 h), cells were stimulated for 1 h with either control or TGFβ (5 µg / L). For TGFβ-treated samples, lysis was performed at the 0 h time point. For the 2 h time point, TGFβ stimulation was removed by elution, and cells were added to fresh serum-free medium without TGFβ, while simultaneously treating with DMSO or BDPIC (250 nM or 1000 nM) for 2 h. Cells were then lysed, and extracts were separated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted with the specified antibody. (B) Investigating the ability of BDPIC to influence PAI-1-induction of dTAG-SMAD3 at the endogenous level. A549 BromoTag / BromoTag PPM1H / dTAG / dTAG SMAD3 (Clon 51) cells were serum starved (16 h) and then co-treated with control or TGFβ (5 µg / L) and DMSO, SB-505124 (1 µM) or BDPIC (250 nM or 500 nM) as directed (6 h). Cells were then lysed and extracts were treated as (A). (CD) RT-qPCR was performed to confirm the effect of BDPIC on the transcription of TGFβ target genes, including PAI-1 (C) and SMAD7 (D). Data shows that the target gene transcripts are... GAPDH Normalized mean ± SD, relative to TGFβ control cells (column 1), from n=3 independent experiments. Each experiment consisted of three technical replicates. Statistical analysis involved one-way ANOVA and Tukey post-hoc tests for multiple comparisons.

[0170] Figure 15

[0171] (A) Schematic diagram of recruiting Halo-POI to dTAG-phosphatase to mediate Halo-POI dephosphorylation via HDPIC. (B) Structure of HDPIC. (C) Cytotoxicity of HDPIC was measured using the CellTox Green Assay (Promega) by treating wild-type (WT) U2OS or A549 cells with a specified concentration of HDPIC for 24 h, with DMSO as a negative control and MG132 (20 μM, 24 h) or lysis buffer as a positive control. Fluorescence (excitation: 480 nm, emission: 530 nM) was measured using a PHERAstar plate reader. Values ​​are shown as mean fluorescence readings normalized to DMSO control ± SD. (D) Engagement of Halo-POI by HDPIC is shown by band shift of a small (~35 kDa) artificial FLAG-NLS (nuclear localization signal)-Halo-HiBiT protein after HDPIC treatment. U2OS cells stably expressing FLAG-NLS-Halo-HiBiT were treated with a specified concentration of HDPIC or an equal volume of DMSO for 2 h. Cells were lysed, extracts were separated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted with a specified antibody. (E) Conjugation of HDPIC to dTAG-POI was demonstrated by a competitive assay. HEK293 WT or HEK293 dTAG / dTAG PPP2CA Cells were treated with DMSO, dTAG-13 PROTAC (100 nM), HDPIC (1 µM), or a combination of dTAG-13 and HDPIC for 24 h. Cells were lysed and treated as (D). (F) U2OS cells stably expressing Halo-SMAD3 alone or in combination with Halo-SMAD3 and dTAG-PPM1H were serum starved (16 h) and then stimulated with TGFβ (5 µg / L) for 1 h. 0 h samples were lysed at this point. For other samples, TGFβ stimulation was removed, and cells were placed in fresh serum-free medium without TGFβ, with DMSO, HDPIC (1 µM), or no treatment added. Samples were then lysed and treated as (D). (G) Multiple A549 Halo SMAD3 Western blot screening of knock-in clones; the target clone (clone 19) is highlighted in red. Cells are lysed and processed according to (D). (H) Target amplification is performed via polymerase chain reaction. SMAD3Genomic regions confirmed the knock-in of multiple clones, with clone 19 highlighted in red. DNA from parental WT A549 cells was included as a negative control. (I) To demonstrate the effect of covalent Halo ligand binding on Halo-SMAD3 phosphorylation, A549... Halo / WT SMAD3 Knock-in cells were serum starved (16 h) and then co-treated with TGFβ (5 µg / L) and SB-505124 (1 µM) / DMSO for 1 h. Lysis was performed at the 0 h time point. For the 4 h time point, TGFβ stimulation was removed by elution, and cells were added to fresh serum-free medium without TGFβ, while simultaneously treated with DMSO, HDPIC (200 nM), or PhosTAC7 (200 nM) for 4 h. Samples were then lysed and processed according to (D). (J) Structure of PhosTAC7.

[0172] Figure 16

[0173] (A) The structure of HDPIC-Neg. (B) Same as ( Figure 15 C) Cytotoxicity of HDPIC-Neg in wild-type (WT) U2OS and A549 cells was measured using the CellTox Green Assay (Promega). Values ​​are shown as mean fluorescence readings normalized to DMSO control ± SD. (C) In U2OS FLAG-NLS-Halo-HiBiT cells, HDPIC-Neg binding to Halo-POI was detected by band migration assays after treatment with a specified concentration of HDPIC-Neg or an equal volume of DMSO for 2 h. Samples were lysed, extracts were separated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted with a specified antibody.

[0174] Figure 17

[0175] (A) Stable expression of HA-bromoTAG-empty vector, HA-bromoTAG-PPP2CA, or HA-bromoTAG-PPP2CA H118Q of TAU dTAG / dTAG SK-N-MC cells were treated with 0, 100, and 250 nm BDPIC and then lysed. Lysates were separated on 4–12% SDS-PAGE and Western blotted with the specified antibody. (B) Stable expression of FLAG-dTAG-PPP2CA or FLAG-dTAG-PPP2CA H118Q of TAU BromoTAG / BromoTAGSK-N-MC cells were treated with 0, 100, 250, and 500 nm BDPIC and then lysed. Lysates were separated on 4–12% SDS-PAGE and Western blotted with specified antibodies. (C) Stable expression of FLAG-dTAG-PPP2CA or FLAG-dTAG-PPP2CA H118Q of TAU BromoTAG / BromoTAG SK-N-MC cells were treated with DMSO and 250 nm BDPIC, then lysed and immunoprecipitated using anti-FLAG beads. The immunoprecipitates were separated on 4–12% SDS-PAGE and blotted with specified antibodies.

[0176] Figure 18

[0177] (A) TAU generated by CRISPR / Cas9 technology BromoTAG / BromoTAG / dTAG / dTAG PPP2CA SK-N-MC cells. Cells were lysed after treatment with BDPIC (0-1000 nM) for 24 h, and the extract (20 μg protein) was analyzed by Western blotting. (B)TAU BromoTAG / BromoTAG / dTAG / dTAG PPP2CA SK-N-MC cells were lysed after treatment with BDPIC (100 nM) for 0–24 h, and the extract (20 μg protein) was analyzed by immunoblotting. (C) WT SK-N-MC cells were lysed after treatment with BDPIC (0–1000 nM) for 24 h, and the extract (20 μg protein) was analyzed by immunoblotting.

[0178] Figure 19

[0179] (A, B) The principle of the NanoBRET assay (Promega) used to assess the formation of a BDPIC-induced ternary complex between transfected BromoTAG and dTAG in cells. An increased ratio of receptor signal to donor signal indicates proximity between BromoTAG and dTAG. (C) U2OS cells were transfected with different combinations of constructs expressing BromoTAG or dTAG with N- or C-terminal modifications of Halo-tagged or Nanoluciferase. Cells were then treated in 96-well plates with 250 nM BDPIC or DMSO controls for 24 h, and the BRET ratio (receptor signal / donor signal) was analyzed using the Promega NanBRET kit according to the manufacturer's instructions.

[0180] Figure 20

[0181] (A) Tau-bromoTAG knock-in SKNMC cells were transduced with dTAG-KLHL6 retrovirus and lysed after treatment with DMSO control (0) or a specified concentration of BDPIC for 24 h. (B) TFEB-BromoTAG knock-in U2OS osteosarcoma cells were transduced with dTAG-RNF125 and lysed after treatment with DMSO control (0) or a specified concentration of BDPIC for 24 h.

[0182] Figure 21

[0183] FAM83D-KO U2OS cells express FAM83D-dTAG-Flag and HA-BromoTAG-CK1. After treatment with DMSO control (0) or a specified concentration of BDPIC for 24 h, the protein was lysed. 20 μg of the lysed protein was subjected to SDS-PAGE and analyzed by Western blotting using the specified antibody. Detailed description of the invention: The inventors describe a novel heterobifunctional small molecule or proximity-inducible compound (PIC), termed BDPIC (BromoTag-dTAG proximity-inducible chimera). The inventors have used nanomolar concentrations of BDPIC to screen different phosphatases tagged with BromoTag, successfully achieving targeted dephosphorylation of dTAG-tagged phosphate-SMAD3 (mothers against decapentaplegic homolog 3) and phosphate-TFEB (transcription factor EB).

[0185] Targeted dephosphorylation of TFEB

[0186] introduction

[0187] Transcription factor EB (TFEB) belongs to the basic helical-cyclic-helical leucine zipper (bHLH-Zip) transcription factor family of microphthalmia / transcription factor E (MiT / TFE), which also includes TFE3, MITF, and TFEC (Steingrimsson et al.). Annu . Rev . Genet ., 2004, 38, 365; Sardiello et al., Science , 2009, 325, 473; Settembre et al., Science(2011, 332, 1429). Upon translocation to the nucleus, TFEB binds directly to a well-defined DNA-binding element called the CLEAR motif, which is conserved in numerous lysosomal components and proximal promoters of autophagy-related genes (Settembre et al., 2011, 332, 1429). Science (Malik et al., 2011, 332, 1429). Emerging evidence suggests that TFEB also plays a crucial role in the control of metabolic processes in response to nutritional and energy stress (Malik et al., 2011, 332, 1429). Science , 2023, 380, eabj5559; Mansueto et al., Cell Metab .,2017, 25, 182; Markby and Sakamoto, Am . J . Physiol . Endocrinol . Metab ., 2020, 319, E763; Settembre et al., Nat . Cell . Biol ., 2013, 15, 647). Given the breadth of biological processes controlled by TFEB, its dysregulation is associated with many human diseases, including cardiovascular disease, metabolic syndrome, cancer, and neurodegenerative diseases (Fraldi et al., 2013, 15, 647). Annu . Rev . Neurosci ., 2016, 39, 277; Wen et al., Metabolism ,2023, 147, 155662; Zoncu and Perera, Trends Cancer , 2023, 9, 817). The transcriptional activity of TFEB is tightly regulated and modulated through post-translational modifications, primarily through reversible phosphorylation (Puertollano et al., 2023, 9, 817). EMBO J ., 2018, 37, e98804; Zhu et al., Front . Cell Dev . Biol ., 2021, 9, 667750; Raben and Puertollano, Annu . Rev . Cell Dev . Biol ., 2016, 32, 255; Franco-Juárez et al., Cells , 2022, 11, 3153; Takla et al., EMBO Rep ., 2023, 24, e57574). The phosphorylation state of TFEB at multiple different residues is regulated by different kinases and phosphatases in synergy according to specific environmental and signaling cues. These cues are known to regulate nucleocytoplasmic shuttling, interactions with other partners, and ultimately, transcriptional activity (Puertollano et al., 2023, 24, e57574). EMBO J ., 2018, 37, e98804; Zhu et al., Front . Cell Dev . Biol ., 2021, 9, 667750; Raben and Puertollano, Annu . Rev . Cell Dev . Biol ., 2016, 32, 255; Franco-Juárez et al., Cells (2022, 11, 3153). Under nutrient-rich and stress-free conditions, the serine / threonine kinase mTORC1 participates in the phosphorylation of TFEB at S122, S142, and S211, and promotes its retention in the cytoplasm (Pena-Llopis et al., 2022, 11, 3153). EMBO J ., 2011, 30, 3242; Martina et al., Autophagy , 2012, 8, 903; Settembre et al., EMBO J ., 2012, 31, 1095; Vega-Rubin-de-Celis et al., Autophagy , 2017, 13, 464; Roczniak-Ferguson et al., Sci . Signal Phosphorylation of TFEB at S211 is known to promote 14-3-3 binding, leading to TFEB retention in the cytoplasm (Roczniak-Ferguson et al., 2012, 5, ra42). Sci . Signal ., 2012, 5, ra42). Upon inactivation of mTORC1 under amino acid and growth factor starvation or pharmacological inhibition, TFEB phosphorylation is blocked, leading to its dissociation from 14-3-3 and translocation from the cytoplasm to the nucleus, where its transcriptional activity is initiated (Roczniak-Ferguson et al., 2012, 5, ra42). Sci . Signal., 2012, 5, ra42). Activation of AMP-activated protein kinase (AMPK) also promotes TFEB dephosphorylation and nuclear translocation (Collodet et al., 2012, 5, ra42). FASEB J ., 2019, 33, 12374; Paquette et al., Autophagy , 2021, 17, 3957; Young et al., Genes Dev ., 2016, 30, 535), recently proposed that it mediates by directly phosphorylating follicle-interacting protein 1 (FNIP1) and subsequently inhibiting the function of the follicle-interacting protein (FLCN)-FNIP1 complex (Malik et al., 2016, 30, 535). Science ,2023, 380, eabj5559). It has been reported that protein phosphatase PP2A and calcineurin (also known as PPP3 or PP2B) dephosphorylate and activate TFEB under oxidative stress and enhanced calcium signaling, respectively (Medina et al., 2023, 380, eabj5559). Nat . Cell Biol ., 2015, 17, 288; Martina and Puertollano, J . Biol . Chem (2018, 293, 12525). In summary, altering TFEB phosphorylation is central to its subcellular distribution and transcriptional activity.

[0188] Since TFEB activity stimulates functions such as autophagy and lysosomal activity, targeted dephosphorylation of TFEB leading to its activation could provide a promising new strategy for therapeutic targeting of lysosomal-related diseases such as neurodegenerative diseases, cystinosis, acute kidney injury, and diabetic nephropathy. Furthermore, this approach would allow for the investigation of the function of TFEB phosphorylation at different residues. Using a novel PIC, the inventors set out to investigate the feasibility of targeted dephosphorylation of TFEB and its consequences on TFEB localization and transcriptional activity. Using a novel heterobifunctional small molecule, BromoTag-dTAG proximity-inducible chimera (BDPIC), the inventors demonstrated that redirecting BromoTag-PPP2CA (protein phosphatase 2 catalytic subunit A) to TFEB-dTAG resulted in inducible dephosphorylation of TFEB-dTAG, its nuclear translocation, and transcription of TFEB target genes.

[0189] Results and Discussion

[0190] The inventors have developed a heterobifunctional small molecule whose ligand at one end binds to dTAG (Nabet et al.). Nat. Chem . Biol ., 2018, 14, 431), the ligand at the other end binds to BromoTag (Bond et al., 2018, 14, 431), J . Med . Chem (., 2021, 64, 15477), linked via a 3-polyethylene glycol (PEG) linker, termed BDPIC (BromoTag-dTAG proximity-induced chimera). It is speculated that in cells expressing BromoTag-PPP2CA and TFEB-dTAG, this molecule will induce proximity between them, potentially allowing PPP2CA to dephosphorylate TFEB (., 2021, 64, 15477). Figure 1 A). This ingenious strategy was discovered through a novel combination of ligands binding to BromoTag and ligands binding to dTAG. The inventors employed TFEB's robust downward electrophoretic mobility shift as a reporter indicator of dephosphorylation. Stable expression of TFEB-dTAG-FLAG and HA-BromoTag-PPP2CA or -PPP2CA was generated via retroviral transduction. H118Q U2OS cells. When cells were treated with increasing concentrations of BDPIC for 24 h, a strong downward electrophoretic migration shift of TFEB-dTAG-FLAG was evident in cells co-expressing HA-BromoTag-PPP2CA compared to the DMSO-treated control at all doses (100–10000 nM) of BDPIC. Figure 1 B). Notably, in the co-expression of HA-BromoTag-PPP2CA H118Q No significant migration rate shift was detected in the cells. Figure 1 B) indicates that PPP2CA phosphatase activity is crucial for BDPIC-induced migration shift of TFEB-dTAG-FLAG. Cell treatment with 100 nM BDPIC for 2–8 h was used to assess dephosphorylation kinetics, and results showed that in cells co-expressing HA-BromoTag-PPP2CA, TFEB-dTAG-FLAG was completely dephosphorylated at 2 h and persisted until 8 h. Figure 1 C). Co-expression of HA-BromoTag alone or co-expression of HA-BromoTag-PPP2CA H118Q In cells treated with BDPIC at any time point, no migration shift of TFEB-dTAG-FLAG was observed. Figure 1C). Shorter time-course experiments revealed that in cells co-expressing HA-BromoTag-PPP2CA, BDPIC-mediated TFEB-dTAG-FLAG dephosphorylation began as early as 5 min and peaked at approximately 15-30 min. Figure 1 D). Next, the inventors investigated the reversibility of BDPIC-mediated TFEB-dTAG dephosphorylation through elution experiments. Cells co-expressing TFEB-dTAG-FLAG and HA-BromoTag-PPP2CA were treated with 100 nM BDPIC for 2 h, washed twice with PBS, and replaced with fresh medium without BDPIC. The phosphorylation-dependent electrophoretic mobility shift of TFEB-dTAG-FLAG almost completely recovered to the DMSO treatment condition within 1 h after BDPIC elution, and completely recovered within 4 h after BDPIC elution. Figure 1 E). To demonstrate that the nature of the tags on PPP2CA or TFEB does not affect the efficacy of BDPIC-mediated dephosphorylation, BromoTag was introduced into TFEB and dTAG was introduced into PPP2CA or PPP2CA. H118Q To exchange tags ( Figure 2 A). Indeed, BDPIC induced dephosphorylation of TFEB-BromoTag in cells expressing dTAG-PPP2CA, but not in cells expressing dTAG or dTAG-PPP2CA. H118Q The control cells did not have ( Figure 2 B). In summary, these data validate the cell permeability of BDPIC, its ability to bind to dTAG and BromoTag and induce their proximity, and the reversibility of BDPIC-induced proximity.

[0191] The inventors have also developed another divalent small molecule, with a ligand at one end binding to a dTAG and a ligand at the other end binding to a Halo tag, linked by a 4-PEG linker, termed HDPIC (Halo-tag-dTAG proximity-induced chimera). Figure 3 A). In U2OS cells co-expressing dTAG-PPP2CA, escalating doses of HDPIC treatment failed to cause an electrophoretic mobility shift in TFEB-Halo (compared to the DMSO control), in control cells or cells co-expressing dTAG-PPP2CA. H118Q It did not cause any shift in the cells either. Figure 3 B). Interestingly, HDPIC exhibited a destabilizing effect on TFEB-Halo under all conditions, with TFEB-Halo levels decreasing as HDPIC concentration increased. Figure 3B). Recently, PhosTAC7 (a compound similar to but structurally different from HDPIC) has been reported to recruit the dTAG-PP2A-A subunit to various Halo-tagged proteins, including PDCD4 and FOXO3a, to achieve proximity-induced dephosphorylation (Chen et al., ACS Chem . Biol (., 2021, 16, 2808). When the inventors co-express TFEB-Halo and dTAG-PPP2CA or dTAG-PPP2CA H118Q When incremental doses of PhosTAC7 were used in U2OS cells, no electrophoretic migration shift of TFEB-Halo was observed under any conditions. Similar to HDPIC, incremental concentrations of PhosTAC7 also led to a decrease in TFEB-Halo levels. Essentially, neither HDPIC nor PhosTAC7 appears to induce dephosphorylation of TFEB-Halo by dTAG-PPP2CA, but rather seems to cause instability. This establishes the higher efficacy and wider applicability of BDPIC compared to other PICs.

[0192] To investigate the consequences of TFEB-targeted dephosphorylation, the inventors generated [a specific genome] using CRISPR / Cas9 genome editing. TFEB dTAG / dTAG homozygous knock-in U2OS cells ( Figure 4 B). Treatment of HA-BromoTag, HA-BromoTag-PPP2CA, or HA-BromoTag-PPP2CA stably expressed alone with DMSO. H118Q of TFEB dTAG / dTAG U2OS cells did not show an effect on TFEB-dTAG migration. In contrast, treatment with MK-8722 (activates AMPK) or Torin 1 (inhibits mTORC1) significantly reduced TFEB-dTAG migration. TFEB dTAG / dTAG U2OS cells cause a shift in the expected TFEB-dTAG downward migration rate. Figure 5 A). This indicates the integration of dTAG or overexpression of HA-BromoTag, HA-BromoTag-PPP2CA, or HA-BromoTag-PPP2CA on endogenous TFEB. H118Q It appears to have no effect on the steady-state level of TFEB phosphorylation. Figure 5 A). Treatment of stably expressed HA-BromoTag-PPP2CA with BDPIC TFEB dTAG / dTAG U2OS cells (rather than cells expressing HA-BromoTag and HA-BromoTag-PPP2CA) H118QThe cells) caused TFEB-dTAG dephosphorylation to a greater extent than that induced by MK-8722 or Torin 1 treatment. Figure 5 A). With expression of HA-BromoTag and HA-BromoTag-PPP2CA H118Q Compared to cells that stably express HA-BromoTag-PPP2CA after BDPIC treatment, TFEB phosphorylation at Ser122, Ser142, and Ser211 was significantly reduced. Figure 5 B). The fact that BDPIC mediates the targeted dephosphorylation of TFEB-dTAG via HA-BromoTag-PPP2CA implies that a ternary complex is formed between TFEB-dTAG and HA-BromoTag-PPP2CA in the presence of BDPIC. To verify this, HA-BromoTag, HA-BromoTag-PPP2CA, or HA-BromoTag-PPP2CA were individually and stably expressed, treated with DMSO or BDPIC. H118Q of TFEB dTAG / dTAG U2OS cells underwent anti-HA immunoprecipitation (IP) ( Figure 5 C). When cells were treated with BDPIC instead of DMSO, in HA-BromoTag, HA-BromoTag-PPP2CA, and HA-BromoTag-PPP2CA... H118Q TFEB-dTAG was jointly deposited in the IP. Figure 5 C). Furthermore, the faster-migrating form of TFEB-dTAG was detected only in anti-HA IP from cells expressing HA-BromoTag-PPP2CA treated with BDPIC. Figure 5 C). The inventors also used inactive dTAG-directed PROTAC, dTAG V -1-NEG (Nabet et al., Nat . Commun A competitive experiment was conducted on the inactive dTAG-directed PROTAC (2020, 11, 4687). V -1-NEG shares the same dTAG binding agent as BDPIC, but cannot degrade dTAG proteins. Excessive dTAG... V Pretreatment of cells with -1-NEG compounds prevented BDPIC from stably expressing HA-BromoTag-PPP2CA. TFEB dTAG / dTAG TFEB-dTAG dephosphorylation induced in U2OS cells ( Figure 5D). This data confirms that BDPIC-mediated TFEB-dTAG targeted dephosphorylation depends on the binding of BDPIC to TFEB-dTAG.

[0193] Next, the study was conducted in TFEB dTAG / dTAG Can BDPIC-mediated TFEB-dTAG dephosphorylation trigger nuclear translocation and transcriptional activity in knock-in U2OS cells? This was investigated in cells stably expressing HA-BromoTag-PPP2CA. TFEB dTAG / dTAG U2OS cells (rather than those expressing HA-BromoTag or HA-BromoTag-PPP2CA) H118Q In cells, BDPIC treatment resulted in strong nuclear TFEB-dTAG immunostaining signal, overlapping with DAPI staining, while DMSO treatment showed predominantly cytoplasmic TFEB-dTAG staining in all cell lines. Figure 6 A). As a positive control, Torin 1 induced TFEB-dTAG nuclear staining in all cell lines ( Figure 6 A). The inventors also observed that in BDPIC-treated cells stably expressing HA-BromoTag-PPP2CA, the amount of TFEB-dTAG signaling that migrated faster in the nuclear fraction was greater than that in the cytoplasmic fraction, while DMSO treatment did not increase the nuclear accumulation of TFEB-dTAG, nor did it induce TFEB-dTAG dephosphorylation. Figure 6 B). In expressing HA-BromoTag or HA-BromoTag-PPP2CA H118Q Comparison TFEB dTAG / dTAG In U2OS cells, neither DMSO nor BDPIC induced dephosphorylation or nuclear translocation of TFEB-dTAG. Figure 4 B). The inventors analyzed the stable expression of HA-BromoTag, HA-BromoTag-PPP2CA, or HA-BromoTag-PPP2CA after 8 hours of BDPIC treatment using RT-PCR. H118Q of TFEB dTAG / dTAG They observed mRNA expression of several known TFEB target genes in U2OS cells. They also observed that, compared to the DMSO control, BDPIC treatment induced expression only in cells expressing HA-BromoTag-PPP2CA. Fnip , Flcn and Gpnmb Transcript expression was slightly but significantly increased, but not when expressing HA-BromoTag or HA-BromoTag-PPP2CA. H118Q There are none in the cells ( Figure 6 C) suggests that TFEB-dTAG-targeted dephosphorylation via BDPIC may be sufficient to induce transcriptional activation of TFEB.

[0194] The inventors have demonstrated that the induced proximity between endogenously knocked-in TFEB-dTAG and overexpressed BromoTag-PPP2CA leads to TFEB dephosphorylation and potential transcriptional activation. However, to avoid the possibility of any unintended artifacts (e.g., dephosphorylation of the natural PPP2CA substrate and its physiological consequences) caused by PPP2CA overexpression, the inventors generated [a specific gene editing technology] using CRISPR / Cas9 gene editing technology. TFEB dTAG / dTAG / BromoTag+ PPP2CA Double knock-in of U2OS cells ( Figure 4 Treatment of these cells with 100 nM BDPIC resulted in a downward electrophoretic migration shift of TFEB-dTAG, to a degree similar to that induced by treatment with MK-8722 or Torin 1 (compared to DMSO treatment). Figure 7 A) indicates that BDPIC can redirect endogenous BromoTag-PPP2CA activity to dephosphorylate TFEB-dTAG. However, at the endogenous level, the BDPIC-induced TFEB-dTAG migration shift is smaller than that observed with BromoTag-PPP2CA overexpression. Figure 5 ). BDPIC processing TFEB dTAG / dTAG / BromoTag / + PPP2CA Cells did not cause a shift in the migration rate of the related transcription factor TFE3 at endogenous levels. Figure 8 A). Similarly, redirecting endogenous BromoTag-PPP2CA to dephosphorylate TFEB-dTAG using BDPIC did not appear to significantly alter the phosphorylation of GSK3 α / β at Ser21 / 9, the endogenous target of PPP2CA. Figure 8 (A)(Brewer et al., 10.1101 / 2023.09.19.558429). By immunoblotting, after BDPIC treatment, the inventors observed a slight decrease in phosphorylation of TFEB-dTAG at Ser122, Ser138, Ser142, and Ser211, while phosphorylation at Ser109 showed no significant change. Figure 7B). It was also observed that after BDPIC treatment, all faster-migrating (dephosphorylated) TFEB-dTAG pools were detected in the nuclear region, while slower-migrating (i.e., phosphorylated) pools (similar to TFEB-dTAG in DMSO-treated control cells or BDPIC-treated cells) remained in the cytoplasm. Figure 7 B). Through immunostaining, the inventors were able to demonstrate that both Torin 1 and BDPIC induced similar, strong nuclear localization of TFEB-dTAG, while DMSO-treated cells showed that TFEB-dTAG staining was primarily in the cytoplasm. Figure 7 C). The inventors tested the effects of processing with Torin 1, MK-8722, or BDPIC. TFEB dTAG / dTAG / BromoTag / +g PPP2CA TFEB target genes in cells Hexa , Flcn , Gpnmb and Fnip Transcription ( Figure 7 E). Torin 1 and MK-8722 both induced a 1.5-2 fold increase in the expression of all four genes compared to the DMSO-treated control. Figure 7 E). Under these conditions, BDPIC induces Gpnmb Transcription increased 1.2-fold compared to the DMSO-treated control, but did not significantly alter the transcription of other genes. Figure 7 E).

[0195] As a novel compound, BDPIC was tested to determine whether it induced any cytotoxicity, particularly at doses used to induce TFEB-dTAG-targeted dephosphorylation. Treatment with BDPIC at concentrations ranging from 10 nM to 10 μM was performed. TFEB dTAG / dTAG / BromoTag / + PPP2CA U2OS cells showed no effect on cell viability after 48 hours, even at the highest concentration of 10 μM. Figure 8 D). As a positive control, treatment of cells with MG132 for 48 h resulted in significant inhibition of cell proliferation and cell death. Figure 8 D).

[0196] Using BDPIC, the inventors have demonstrated that BromoTag-PPP2CA knocked into the natural PPP2CA locus can be redirected to dephosphorylate TFEB. This dephosphorylation is sufficient to trigger nuclear translocation of TFEB and GpnmbThe transcription of BDPIC is mediated without modulating the specific signaling pathways controlling TFEB. Notably, the action of BDPIC is transient and reversible, and can be performed with extremely high efficiency in the nanomolar range. In comparisons, BDPIC significantly outperforms other neighbor-induced bivalent molecules such as HDPIC and the previously reported PhosTAC7 (Chen et al.). ACS Chem . Biol (2021, 16, 2808). The inventors' findings demonstrate that targeted dephosphorylation of TFEB is an effective method for targeting TFEB nuclear translocation and can be considered a novel therapeutic approach for pathological conditions such as metabolic disorders. Enhanced TFEB-dependent transcription leading to increased lysosomal and mitochondrial biogenesis in metabolic tissues (such as muscle and liver) may be beneficial. It also demonstrates a proof-of-concept for proximity induction via BDPIC. The findings of this invention imply that, in principle, targeted dephosphorylation can be used by developing a phosphatase recruitment chimeric (PhosTAC) molecule, with one end linked to a POI and the other end linked to a target phosphatase.

[0197] Targeted dephosphorylation of SMAD3

[0198] introduction

[0199] TGFβ (transforming growth factor-β) is a cytokine involved in various cellular processes, such as proliferation, regeneration, differentiation, adhesion, cell migration, and apoptosis (Flanders, Int . J . Exp . Pathol ., 2004, 85, 47; Massague, Annu . Rev . Biochem ., 1998, 67, 753). Classical TGFβ signaling involves the binding of TGFβ ligands to the constitutively active transmembrane Ser / Thr kinase receptor TGFβR2 (type II receptor), which is subsequently recruited, phosphorylated, and activated TGFβR1 (type I receptor). Transcription factors SMAD2 and SMAD3 (mothers against decapentaplegic homolog 2 / 3) are recruited to the active receptor complex. SMAD2 and SMAD3 contain a linker region separating two conserved domains: MH1 (Mad homolog 1), which, in the case of SMAD3, is capable of interacting with DNA; and MH2 (Mad homolog 2), which mediates protein-protein interactions, such as interactions with TGFβR1 and transcriptional coactivators / repressors (Tsukazaki et al., 1998, 67, 753). Cell, 1998, 95, 779; Wu et al., Science ,2000, 287, 92; Macias et al., Trends Biochem . Sci ., 2015, 40, 296). Once reached, SMAD2 and SMAD3 are phosphorylated by TGFβR1 at the C-terminal Ser-X-Ser motifs (Ser465 / Ser467 on SMAD2 and Ser423 / Ser425 on SMAD3). Therefore, several small molecule inhibitors of TGFβR1, including SB-505124, result in a complete attenuation of the TGFβ-induced transcriptional response (DaCosta Byfield et al., 2015, 40, 296). Mol . Pharmacol ., 2004, 65, 744; Vogt et al., Cell Signal Phosphorylated SMAD2 and SMAD3 are released from the receptor complex and bind to co-SMAD (SMAD4), then translocate to the nucleus, where they control the transcription of hundreds of target genes that determine cell fate (Massague et al., 2011, 23, 1831). Genes Dev ., 2005, 19, 2783). Despite sharing 83.9% of their amino acid sequence, SMAD2 and SMAD3 are believed to have different cellular functions. It is believed that most TGFβ-induced transcriptional responses in adult tissues and cells (which can activate cell growth inhibition and apoptosis responses) are mediated by SMAD3, while SMAD2 is crucial during development, when TGFβ signaling promotes growth and differentiation (Nomura and Li, 2005, 19, 2783). Nature , 1998, 393, 786; Aragon et al., Genes Dev ., 2019, 33, 1506; Waldrip et al., Cell , 1998, 92, 797; Weinstein et al., Proc . Natl . Acad . Sci . U . S . A ., 1998, 95,9387; Massague and Gomis, FEBS Lett ., 2006, 580, 2811).

[0200] TGFβ signaling is involved in a variety of pathological conditions. Previous studies have identified SMAD3 as a key factor in the progression of TGFβ-related diseases (Dzwonek et al., Mol . Cancer Res ., 2009, 7, 1342; Kohn et al., Breast Cancer Res ., 2010, 12, R83). SMAD3 gain-of-function mutations leading to increased TGFβ signaling are associated with endoostotic osteoproliferative disease (a rare, sporadic disease involving excessive bone formation on the bone surface) (Kang et al., 10.1084 / jem.20191499; Velchev et al., 10.1084 / jem.20200185). Furthermore, increased TGFβ pathway activation and subsequent SMAD3 phosphorylation are also associated with fibrotic diseases, which are facilitated by promoting the influx of inflammatory cells and fibroblasts into the injury site, subsequently leading to the production of cytokines and ECM (extracellular matrix) (Border and Noble, 2010, 12, R83). N . Engl . J . Med .,1994, 331, 1286). TGFβ further promotes ECM accumulation by simultaneously increasing the secretion of protease inhibitors (such as SMAD3-dependent PAI-1) and decreasing the secretion of proteases (such as MMP-1 (matrix metalloproteinase-1)) (Dennler et al., 1994, 331, 1286). EMBO J ., 1998, 17, 3091; Yuan and Varga, J . Biol . Chem ., 2001, 276, 38502; Phanish et al., Biochem . J ., 2006, 393, 601). Fibrotic diseases are thought to occur after incomplete tissue repair regression. Dysregulation of TGFβ signaling is also thought to trigger a shift from normal function (believed to act as a tumor suppressor) to oncogenic function, especially in the later stages of tumor growth (Massague and Gomis, 2006, 393, 601). FEBS Lett (Alarcon et al., 2006, 580, 2811), which may be driven by SMAD3. SMAD3 transcriptional activity is also regulated by phosphorylation in connector regions, which can be mediated by the MAPK (mitogen-activated protein kinase) family, the CDK (cyclin-dependent kinase) family, and GSK3β (glycogen synthase kinase-3β) at multiple sites (including Thr179, Ser204, Ser208, and Ser213) (Alarcon et al., 2006, 580, 2811). Cell , 2009, 139, 757; Ooshima et al., Cancer Sci., 2019, 110, 481). Phosphorylation of the SMAD3 connector region is thought to promote tumor progression by facilitating cellular EMT (epithelial-mesenchymal transition) (Ooshima et al., 2019, 110, 481). Cancer Sci (2019, 110, 481). Given that SMAD3 function is controlled by phosphorylation, targeted dephosphorylation of SMAD3 could potentially provide inhibition of the TGFβ signaling response, which could have therapeutic benefits.

[0201] Results and Discussion

[0202] The inventors discovered that, in addition to targeted dephosphorylation of TFEB, BromoTag-PPM1H phosphatase activity can also be redirected to dTAG-SMAD3 to achieve targeted dephosphorylation of TGFβ-induced phosphorylation-dTAG-SMAD3, and investigated the subsequent inhibition of TGFβ transcriptional responses.

[0203] The inventors sought to evaluate the ability of BDPIC to induce dTAG-SMAD3 dephosphorylation in cells co-expressing BromoTag-phosphatase. Figure 9 A). To explore multiple phosphatase patterns with mixed or more selective substrate specificity, the inventors tested four BromoTag-phosphatases, including PPP1CA, PPP2CA, PPM1A, and PPM1H. Previously, PPM1A was reported as a physiological phosphatase of SMAD3 (Lin et al., Cell , 2006, 125, 915). PP2A has also been reported to dephosphorylate SMAD3 under hypoxic conditions (Heikkinen et al., 2006, 125, 915). J . Biol . Chem ., 2010, 285, 3740). As a first step, phosphorylation of dTAG-SMAD3 was characterized in U2OS cells stably expressing dTAG-SMAD3 under serum starvation, after stimulation with recombinant TGFβ ligand for a period of time (6 h). Figure 10 A&B). Maximum tail phosphorylation of dTAG-SMAD3 and endogenous SMAD3 was observed 1 hour after stimulation, with phosphorylation decreasing during the remainder of treatment, possibly due to receptor turnover (Huang and Chen). Cell Biosci (., 2012, 2, 9), but still higher than unstimulated cells ( Figure 10 (A&B). Importantly, this demonstrates that conjugating dTAG to SMAD3 did not inhibit TGFβR1 phosphorylation of SMAD3. Increased levels of the SMAD3 target gene PAI-1 protein were detected as early as 2 hours after the onset of TGFβ stimulation. Figure 10A&B). Next, the rate of endogenous dephosphorylation of dTAG-SMAD3 in serum-starved cells was monitored. U2OS cells expressing dTAG-SMAD3 were either lysed (referred to as post-elution 0h) or washed and placed in fresh serum-free medium without TGFβ and lysed at specified time intervals (A&B). Figure 10 C&D). Compared with unstimulated control cells, TGFβ-treated cells showed a significant increase in dTAG-SMAD3 and endogenous SMAD3 tail phosphorylation. This peak dTAG-SMAD3 phosphorylation was detected as a decrease 10 min after TGFβ withdrawal, with a ~60% reduction at 2 h and a ~80% reduction at 6 h. Figure 10 C&D).

[0204] For the targeted dephosphorylation method, the inventors first attempted to design an elution assay, namely, first establishing maximum dTAG-SMAD3 phosphorylation through TGFβ stimulation, and then monitoring the dephosphorylation rate of dTAG-SMAD3 2 h after TGFβ elution as described above. Compared with the DMSO-treated control, the successful targeted dephosphorylation of dTAG-SMAD3 by BDPIC in the presence of BromoTag-phosphatase was expected to accelerate the dephosphorylation rate of dTAG-SMAD3. Indeed, compared with DMSO treatment, 100 nM and 500 nM concentrations of BDPIC induced a strong further reduction in phosphorylated dTAG-SMAD3 levels in cells co-expressing BromoTag-PPM1A or BromoTag-PPM1H. Figure 9 B). Cells co-expressing BromoTag-PPP2CA showed a more subtle decrease in phosphorylated dTAG-SMAD3 levels after BDPIC treatment, while no strong, substantial decrease was observed in cells expressing BromoTag-PPP1CA. Figure 9 B). No effect on endogenous SMAD3 (dTAG-deficient) phosphorylation was observed in any cells treated with BDPIC, suggesting that BDPIC treatment either reduces SMAD3 phosphorylation by targeting dTAG-SMAD3 specifically or accelerates its dephosphorylation.

[0205] To confirm that the accelerated dTAG-SMAD3 dephosphorylation is due to the recruitment of BromoTag-phosphatase phosphatase activity, a phosphatase-free control and a previously reported phosphatase-dead point mutant, PPM1H, were used. H153D PPP2CA H118Q and PPM1A D239A (Ogris et al., J . Virol ., 1999, 73, 7390; Jackson et al., Biochemistry , 2003, 42, 8513; Ofek et al., J . Biol . Chem ., 2003, 278, 14299; Lee-Hoeflich et al., Cancer Discov ., 2011, 1, 326; Tanoue et al., Biochemistry , 2013, 52, 5830; Berndsen et al., 10.7554 / eLife.50416)( Figure 9 C, D&E). In the absence of any BromoTag-phosphatase, BDPIC produced a further reduction in dTAG-SMAD3 phosphorylation levels in U2OS cells expressing only dTAG-SMAD3 compared to DMSO treatment. Figure 9 C, D & E) indicate that BDPIC itself does not affect the phosphorylation level of dTAG-SMAD3. For BromoTag-PPM1H and BromoTag-PPP2CA, the respective phosphatase inactivation site mutants BromoTag-PPM1H... H153D and BromoTag-PPP2CA H118Q BDPIC treatment failed to elicit the same accelerated dTAG-SMAD3 dephosphorylation as DMSO treatment. Confirmation of BDPIC-induced dephosphorylation requires the recruitment of phosphatase catalytic activity from BromoTag-PPM1H or BromoTag-PPP2CA. Figure 9 (C&D). However, the phosphatase inactivation of BromoTag-PPM1A reported in BDPIC treatment with co-expression was observed. D239A Even after the mutant cells were exposed, a partial acceleration in the rate of dTAG-SMAD3 dephosphorylation was still observed. Figure 9 E). The inventors' elution assays for monitoring dephosphorylation rates were designed to minimize any confounding blockage (e.g., due to impeded kinase access) of BDPIC-recruited BromoTag-phosphatases on dTAG-SMAD3 phosphorylation. With this in mind, observations may suggest that, under these conditions, PPM1A… D239A The mutant also recruited phosphatase activity, for example, through dimerization with endogenous PPM1A, or possibly PPM1A D293ASome phosphatase activity was still retained. Interestingly, at 0 h and 2 h after TGFβ elution, U2OSdTAG-SMAD3 BromoTag-PPM1A / -PPM1A treated with DMSO retained some phosphatase activity. D239A A significant decrease in dTAG-SMAD3 phosphorylation was observed in cells, suggesting that overexpression of these conjugates may affect dTAG-SMAD3 phosphorylation. Importantly, in DMSO-treated samples expressing dTAG-SMAD3 alone or in combination with active BromoTag phosphatases, phosphorylated-dTAG-SMAD3 and phosphorylated-endogenous SMAD3 levels remained similar. This indicates that phosphorylation of dTAG-SMAD3 and endogenous SMAD3 is not solely affected by overexpression of any of the BromoTag phosphatases employed, although some of these phosphatases have been reported as physiological SMAD3 phosphatases. Since the observations clearly demonstrate that PPM1H catalytic activity can be redirected to target SMAD3 dephosphorylation, the inventors sought to further characterize this.

[0206] To confirm that BDPIC-mediated dTAG-SMAD3 targeted dephosphorylation depends on BromoTag-PPM1H recruitment, a competition experiment was conducted using cis-AGB1, an inactive enantiomer of the AGB1 BromoTag degrader (Bond et al.). J . Med . Chem U2OSdTAG-SMAD3 BromoTag-PPM1H cells were serum starved, then stimulated with TGFβ and treated for 2 h with DMSO, the TGFβR1 inhibitor SB-505124, BDPIC (100 nM), or a combination of BDPIC and an overdose of cis-AGB1 (1000 nM). Figure 11 A). As expected, SB-505124 treatment resulted in a complete reduction in dTAG-SMAD3 and endogenous SMAD3 tail phosphorylation compared to the DMSO-treated control. BDPIC treatment resulted in a strong reduction in dTAG-SMAD3 phosphorylation compared to the DMSO-treated control, with no effect on endogenous SMAD3 phosphorylation, as expected. Co-treatment with BDPIC and excess cis-AGB1 almost completely prevented BDPIC-induced dTAG-SMAD3 dephosphorylation. The level of phosphorylated dTAG-SMAD3 was comparable to that observed in DMSO-treated cells. Figure 11A). This confirms that BDPIC-mediated dTAG-SMAD3 targeted dephosphorylation depends on BDPIC binding to dTAG-SMAD3 and recruitment of BromoTag-PPM1H.

[0207] To verify that BDPIC can mediate the formation of an active ternary complex between BromoTag-PPM1H and dTAG-SMAD3 to achieve targeted dephosphorylation, the inventors tested whether FLAG-dTAG-SMAD3 could be co-immunoprecipitated with 3HA-BromoTag-PPM1H in the presence of BDPIC. Extracts from U2OS cells stably co-expressing FLAG-dTAG-SMAD3 and 3HA-BromoTag-PPM1H were treated with DMSO, SB-505124, BDPIC, or a combination of BDPIC and cis-AGB1, followed by HA immunoprecipitation (IP). FLAG-dTAG-SMAD3 was detected in the anti-HA IP samples from BDPIC-treated cells, but not in cells treated with DMSO, SB-505124, or the BDPIC+cis-AGB1 control group. Figure 11 B) confirmed that BDPIC induced the interaction between dTAG-SMAD3 and BromoTag-PPM1H.

[0208] The inventors sought to explore the effects of dTAG-SMAD3 targeted dephosphorylation on downstream biology. Figure 12 A). Tail phosphorylation of SMAD3 by the TGFβ type I receptor triggers its nuclear translocation, enabling SMAD3 to regulate the transcription of TGFβ target genes (Tsukazaki et al., Cell , 1998, 95, 779; Zhang et al., Nature , 1998, 394, 909; Hayes et al., Cancer Res ., 2001, 61, 2112). U2OS cells expressing dTAG-SMAD3 alone or in combination with BromoTag-PPM1H or BromoTag-PPM1HH153D mutants were treated with control solution or TGFβ (5 µg / L) and DMSO, SB-505124 (1 µM) or BDPIC (100 nM) for 2 h, and then nuclear and cytoplasmic components were collected. Figure 12 B). As expected, phosphorylated dTAG-SMAD3 was not detected in the cytoplasm under any treatment. Figure 12B). TGFβ stimulation leads to a large accumulation of phosphorylated-dTAG-SMAD3 and phosphorylated-endogenous SMAD3 in the nuclear region, while SB-505124 treatment strongly inhibits this accumulation (DaCosta Byfield et al., Mol . Pharmacol ., 2004, 65,744; Vogt et al., Cell Signal ., 2011, 23, 1831). Co-treatment of U2OS cells expressing only dTAG-SMAD3 with TGFβ and BDPIC did not result in significant changes in the abundance of phosphorylated-dTAG-SMAD3 or phosphorylated-endogenous SMAD3 in the nucleus compared to cells treated with TGFβ and DMSO, supporting that BDPIC alone does not interfere with dTAG-SMAD3 or endogenous SMAD3 phosphorylation or subsequent nuclear translocation. Figure 12 B). U2OS dTAG-SMAD3 cells co-expressing BromoTag-PPM1H showed similar phosphorylated dTAG-SMAD3 nuclear abundance to U2OS dTAG-SMAD3 cells after treatment with TGFβ and DMSO, indicating that BromoTag-PPM1H overexpression does not inhibit dTAG- or endogenous SMAD3 phosphorylation or nuclear translocation. Figure 12 B). Excitingly, in BDPIC-treated U2OS dTAG-SMAD3 cells co-expressing BromoTag-PPM1H, a significant reduction in nuclear phosphorylated dTAG-SMAD3 (rather than phosphorylated endogenous SMAD3) was observed, indicating that BDPIC-mediated BromoTag-PPM1H recruitment and subsequent dTAG-SMAD3 dephosphorylation reduce the accumulation of phosphorylated dTAG-SMAD3 in the nucleus. Figure 12 B). Since BDPIC treatment did not alter the nuclear abundance of endogenous phosphorylated dTAG-SMAD3 in these cells, this further reinforces the specific targeting of BromoTag-PPM1H to dephosphorylated dTAG-SMAD3 by BDPIC. Furthermore, U2OS dTAG-SMAD3 cells co-expressing the phosphatase-inactivated BromoTag-PPM1HH153D mutant did not show a significant reduction in nuclear phosphorylated dTAG-SMAD3 abundance after BDPIC treatment compared to cells expressing only dTAG-SMAD3. Figure 12 B) indicates the reduced PPM1H phosphatase activity observed in BDPIC-treated U2OS dTAG-SMAD3 BromoTag-PPM1H cells.

[0209] To further explore the extent of the effect of dTAG-SMAD3-targeted dephosphorylation, the inventors focused on the transcription of a well-defined TGFβ-induced and SMAD3-dependent gene, PAI-1 (plasminogen activator inhibitor-1) (Dennler et al.). EMBO J ., 1998, 17, 3091). For this purpose, U2OS cells expressing dTAG-SMAD3 alone or in combination with BromoTag-PPM1H or BromoTag-PPM1HH153D were co-treated with TGFβ and DMSO, SB-505124, or BDPIC (100 nM) for 6 h. Figure 12 C). TGFβ stimulation of U2OS dTAG-SMAD3 cells produced strong dTAG-SMAD3 and endogenous SMAD3 phosphorylation and increased PAI-1 protein levels, all of which were completely attenuated by co-treatment with SB-505124. As expected, BDPIC treatment of U2OS cells expressing dTAG-SMAD3 alone did not result in a significant reduction in PAI-1 levels or dTAG-SMAD3 phosphorylation compared to DMSO-treated cells. Figure 12 C) indicates that BDPIC treatment alone does not affect TGFβ-induced PAI-1 transcription. In TGFβ-stimulated U2OS dTAG-SMAD3 cells co-expressing BromoTag-PPM1H, BDPIC treatment induced a significant decrease in dTAG-SMAD3 dephosphorylation and PAI-1 levels compared to the TGFβ and DMSO-treated controls. Figure 12 C). This indicates that BDPIC-mediated dTAG-SMAD3 dephosphorylation (via recruitment of BromoTag-PPM1H) inhibits the ability of dTAG-SMAD3 to activate the transcription of its target gene PAI-1, which may be due to... Figure 12 The nuclear phosphorylation-dTAG-SMAD3 abundance observed in B was simultaneously reduced. Given that the same reduction was not observed in U2OS dTAG-SMAD3 cells co-expressing the BromoTag-PPM1HH153D mutant treated with BDPIC, it can be concluded that the BDPIC-dependent reduction in PAI-1 levels is due to the phosphatase activity of BromoTag-PPM1H and subsequent BDPIC-induced proximity-based dephosphorylation of dTAG-SMAD3. The data from this invention suggest that the induced proximity between phosphatases and POIs can be used to mediate target protein dephosphorylation, and that this alteration in phosphorylation status can affect downstream signaling.

[0210] The inventors next aimed to explore whether BDPIC could mediate targeted dephosphorylation by inducing proximity between dTAG-SMAD3 and BromoTag-PPM1H at the endogenous level. To this end, the inventors used CRISPR / Cas9 genome editing to generate A549. BromoTag / BromoTag PPM1H / dTAG / dTAG SMAD3 Knock-in cells (Cong et al., Science , 2013, 339, 819; Ran et al., Nat . Protoc ., 2013, 8, 2281). By Western blotting ( Figure 13 A) PCR (Polymerase Chain Reaction) Figure 13 B) and DNA sequencing validated the knock-in cells. Compared to wild-type controls, in knock-in cells, the molecular weight shifts of native SMAD3 and PPM1H corresponding to the added dTAG and BromoTag were significant. Figure 13 A&B). Notably, a very weak signal was also detected in the knock-in cells for higher molecular weight species that cross-react with anti-SMAD3 protein blots, although the inventors did not detect any aberrant dTAG-SMAD3 species by DNA sequencing. More importantly, it was demonstrated that the knock-in dTAG-SMAD3 responded to TGFβ stimulation in a manner similar to that expected of endogenous SMAD3, producing the anticipated increase in PAI-1 levels (…). Figure 13 C).

[0211] In A549 BromoTag / BromoTag PPM1H / dTAG / dTAG SMAD3 Similar targeted dephosphorylation experiments were performed after knocking the cells into them. Figure 9 B)( Figure 14 A). Compared to unstimulated cells, TGFβ-treated cells showed strong dTAG-SMAD3 phosphorylation, indicating that dTAG integration did not inhibit SMAD3 phosphorylation. Similarly, co-treatment with the inhibitor SB-505124 completely attenuated phosphorylation. When dTAG-SMAD3 phosphorylation was monitored 2 h after TGFβ withdrawal, the decrease in dTAG-SMAD3 phosphorylation observed in the DMSO control treatment was considered to be the natural rate of dTAG-SMAD3 dephosphorylation. In contrast, cells treated with 250 nM or 1000 nM BDPIC showed a greater reduction in phosphorylated dTAG-SMAD3. Figure 14A) indicates that BDPIC can accelerate the dephosphorylation of endogenous dTAG-SMAD3 by endogenously recruiting BromoTag-PPM1H. In initial optimization, it was observed that a concentration of 250 nM induced slightly more pronounced endogenous dTAG-SMAD3 dephosphorylation than 100 nM (used in a stable expression model), after which 250 nM was chosen for BDPIC treatment. Figure 13 D). There was almost no difference between the 250 nM and 1000 nM treated samples, indicating that both concentrations were equally effective. Figure 14 A). To explore whether BDPIC can influence SMAD3-dependent PAI-1 stimulation by targeting the dephosphorylation of dTAG-SMAD3 at the endogenous level, in A549 BromoTag / BromoTag PPM1H / dTAG / dTAG SMAD3 A similar 6-hour co-treatment experiment was performed after knocking the cells in, as described above. Figure 12 C)( Figure 14 B). Compared with unstimulated cells, TGFβ-treated cells showed a significant increase in PAI-1 levels, further confirming that knocking in dTAG to SMAD3 did not prevent SMAD3-dependent PAI-1 production. In TGFβ-stimulated cells, co-treatment with 250 nM or 500 nM BDPIC resulted in a significant decrease in PAI-1 production and phosphorylated dTAG-SMAD3 levels, reinforcing the idea that BDPIC-mediated targeted dephosphorylation can inhibit the phosphorylation-dependent function of dTAG-SMAD3 at the endogenous level. Similarly, there was almost no significant difference between different BDPIC treatment concentrations; therefore, the lower concentration of 250 nM was used for subsequent experiments. PAI-1 levels were analyzed by RT-qPCR (reverse transcription-quantitative PCR) in A549 cells. BromoTag / BromoTag PPM1H / dTAG / dTAG SMAD3 In cells, compared with DMSO treatment, BDPIC (250 nM) treatment significantly reduced TGFβ-induced PAI-1 transcription ( Figure 14 C). The inventors also monitored the transcriptional level of another SMAD3-responsive gene, SMAD7. Figure 14 D), SMAD7 is an inhibitory SMAD protein that acts as a negative regulator of classical TGFβ signaling (Nakao et al., Nature , 1997, 389, 631; von Gersdorff et al., J . Biol . Chem ., 2000, 275, 11320), under BDPIC (250 nM) treatment, compared with the DMSO treatment control, also showed a similar significant reduction ( Figure 14 D).

[0212] As described above, in order to compare the BDPIC with other PICs in the prior art, the inventors tested the use of a BDPIC incorporating Halo tags (Los et al.). ACS Chem . Biol ., 2008, 3, 373) and dTAG (Clackson et al., Proc . Natl . Acad . Sci . U . S . A ., 1998, 95, 10437; Nabet et al., Nat . Chem . Biol Can a divalent molecule separated by a small PEG linker and an established ligand (., 2018, 14, 431) achieve proximity induction between a phosphatase and a phosphorylated POI to produce targeted POI dephosphorylation? Figure 15 A), this molecule is called HDPIC (Halo-tag-dTAG proximity-induced chimera). First, the inventors observed that treatment of U2OS and A549 cells with a range of concentrations (0-16 µM) of HDPIC did not exhibit significant cytotoxicity, in contrast to the cell-death-inducing positive control MG132 treatment. Figure 15 C). Next, the previously established Halo ligand conjugation method was used, in which FLAG-NLS-Halo-HiBiT, stably expressed in U2OS cells, undergoes a molecular weight shift upon Halo ligand conjugation (Simpson et al., Cell Chem . Biol (., 2022, 29, 1482), the inventors showed that 1 μM HDPIC induced a strong mobility shift in FLAG-NLS-Halo-HiBiT (., 2022, 29, 1482). Figure 15 D), indicating that the compound possesses cell permeability and can bind to the Halo tag. To evaluate dTAG binding, the inventors have shown above that HDPIC can partially rescue dTAG-13 (Nabet et al., Nat . Chem . Biol (., 2018, 14, 431) in HEK293 dTAG / dTAG PPP2CA Knock-in cell-mediated dTAG-PPP2CA degradation indicates that HDPIC binds to dTAG in cells ( Figure 15E). Given that HDPIC exhibits interactions with Halo tags and dTAG in cells, the inventors sought to explore whether HDPIC could be used to mediate Halo-SMAD3 dephosphorylation by inducing proximity to dTAG-phosphatase. To this end, they tested the effect of HDPIC compound conjugation on the rate of Halo-SMAD3 dephosphorylation in U2OS cells stably expressing Halo-SMAD3 alone or in combination with stably expressing Halo-SMAD3 and dTAG-PPM1H. Figure 15 F). Using a similar elution experiment as previously described ( Figure 9 Cells (B and 4A) were stimulated with TGFβ, then washed and treated with DMSO or HDPIC (or untreated) for 2 h or 4 h. Surprisingly, in U2OS cells expressing Halo-SMAD3 alone, HDPIC treatment accelerated Halo-SMAD3 dephosphorylation 4 h after TGFβ withdrawal compared to untreated or DMSO-treated cells. No difference was observed between untreated and DMSO-treated cells, confirming that the DMSO solvent (in which HDPIC is dissolved) was not the cause of the increased dephosphorylation observed in HDPIC-treated cells. Furthermore, no additional increase in the rate of Halo-SMAD3 dephosphorylation was observed when dTAG-PPM1H was co-expressed. Figure 15 F) indicates that the observed accelerated dephosphorylation is due to the binding of HDPIC to Halo-SMAD3. The inventors in A549 Halo / WT SMAD3 Similar effects were observed when knocked into cells (verified by Western blotting, PCR, and genome sequencing). Figure 15 Similarly, the inventors found that even in these cells that do not express dTAG-phosphatase, HDPIC treatment accelerated the dephosphorylation of Halo-SMAD3 compared to DMSO-treated cells 4 h after TGFβ withdrawal. Figure 15 I). Furthermore, PhosTAC7 (a molecule closely associated with HDPIC) has been reported to induce the adjacency of the dTAG-PP2A-A subunit with Halo-PDCD4 and Halo-FOXO3a to achieve targeted dephosphorylation (Chen et al., ACS Chem . Biol (., 2021, 16, 2808). Similar to HDPIC, PhosTAC7 treatment led to an accelerated rate of Halo-SMAD3 dephosphorylation compared to DMSO treatment, even in the absence of dTAG-phosphatase. Figure 15In summary, these data indicate that the increased dephosphorylation observed in HDPIC or PhosTAC7 treatment compared to DMSO treatment is due to the binding of chloroalkanes to Halo-SMAD3. Notably, the negative control compound HDPIC-Neg synthesized by the inventors (in which the chloroalkanes bound to the Halo tag are replaced by fluoroalkanes) did not produce significant cytotoxicity in U2OS or A549 cells. Figure 16 B), but still shows evidence of binding with Halo-POI at micromolar concentrations ( Figure 16 C). Similar to HDPIC, treatment of U2OS FLAG-NLS-Halo-HiBiT cells with HDPIC-Neg resulted in a higher molecular weight migration shift in FLAG-NLS-Halo-HiBiT cells, which was observed during the covalent binding of the Halo tag to the chloroalkane (Simpson et al., Cell Chem . Biol ., 2022, 29, 1482)( Figure 16 C). In cells treated with HDPIC-Neg, the upper band intensity of FLAG-NLS-Halo-HiBiT was weaker than that of HDPIC, indicating that HDPIC-Neg can still engage FLAG-NLS-Halo-HiBiT, albeit weaker and at higher concentrations. These data highlight potential issues with using Halo-tagged systems for targeted dephosphorylation studies and thus further validate the broader applicability of BDPIC.

[0213] The inventors identified BromoTag-PPM1H as a promising phosphatase that can be redirected to dephosphorylate dTAG-SMAD3, which is not a known natural substrate of PPM1H. Importantly, in cell lines stably expressing dTAG-SMAD3, phosphorylation of endogenous SMAD3 was unaffected, indicating that BDPIC can selectively dephosphorylate dTAG-SMAD3. Compared to BDPIC, the inventors noted that for HDPIC and PhosTAC7 compounds containing covalently bound Halo-tagged chloroalkane ligands, the molecular conjugation alone had a strong effect on Halo-SMAD3 phosphorylation. Co-expression of dTAG-PPM1H phosphatase failed to further increase Halo-SMAD3 dephosphorylation under HDPIC / PhosTAC7 treatment, indicating that the observed effect is entirely attributable to compound conjugation. Excitingly, BDPIC-induced targeted dephosphorylation of dTAG-SMAD3 via BromoTag-PPM1H recruitment inhibited dTAG-SMAD3 nuclear translocation and transcription of the SMAD3 target gene PAI-1. The inventors subsequently generated A549 using CRISPR / Cas9 technology. BromoTag / BromoTag PPM1H / dTAG / dTAG SMAD3 Cellular studies validated their findings at the endogenous level, demonstrating that BDPIC can recruit endogenous BromoTag-PPM1H to target the dephosphorylation of endogenous dTAG-SMAD3 and influence downstream TGFβ pathway outcomes. This phosphatase redirection approach provides the ability to achieve phosphorylation control at the POI substrate level. Indeed, as mentioned above, the inventors have demonstrated that BDPIC can target the dephosphorylation of another transcription factor, TFEB (transcription factor EB), by recruiting PPP2CA, thereby influencing TFEB transcriptional activity. Regarding SMAD3, as a downstream mediator of TGFβ signaling, the phosphatase redirection approach can provide more refined regulation of biological outcomes compared to inhibitory compounds that inhibit upstream TGFβ receptor kinases, thereby affecting all subsequent TGFβ pathways.

[0214] Targeted dephosphorylation of Tau

[0215] introduction

[0216] Furthermore, the inventors have demonstrated the utility of BDPIC in targeted dephosphorylation of Tau through the induced proximity between dTAG-PP2CA and BromoTag-Tau. Tau hyperphosphorylation is a contributing factor to so-called "Tauopathies," a group of neurodegenerative diseases, including Alzheimer's disease (AD). Tauopathies are characterized by the aggregation of abnormally folded Tau proteins in the brain, ultimately leading to cognitive and motor deficits. Studies targeting the inhibition of multiple Tau kinases or activating Tau phosphatase PP2A to reverse Tau hyperphosphorylation have shown limited therapeutic potential, primarily due to the lack of Tau selectivity. An innovative strategy that could potentially circumvent these limitations and treat Tauopathies is to selectively target the dephosphorylation of hyperphosphorylated Tau. Here, the inventors have demonstrated targeted dephosphorylation of phosphorylated Tau at the endogenous level. By using compounds disclosed herein (such as BDPIC), the inventors demonstrated highly selective targeted dephosphorylation of Tau in cells carrying bromoTAG and dTAG knock-in on Tau and PPP2CA, respectively, and further showed that targeted dephosphorylation of Tau leads to its stabilization on microtubules.

[0217] Results and Discussion

[0218] In this study, the inventors used CRISPR / Cas9 genome editing to achieve... MAPT Allele integration FKBP12 F36V Homozygous Tau-dTAG knock-in SK-N-MC cells were generated and validated by Western blotting. In HA-bromoTAG-PPP2CA-expressing Tau-dTAG SK-N-MC cells, 100 nM and 250 nM BDPIC treatment for 24 h resulted in strong Tau-dTAG dephosphorylation at S396, S202 / T205, S181, and S404, compared to the DMSO-treated control. Figure 17 A). In contrast, in expressing empty vectors, HA-bromoTAG, or HA-bromoTAG-PPP2CA... H118Q In cells, compared with the DMSO-treated control, BDPIC treatment did not alter Tau-dTAG dephosphorylation at S396, S202 / T205, S181, and S404. Figure 17 A). Subsequently, the inventors used CRISPR / Cas9 genome editing to... MAPT Allele integration bromoTAGHomozygous Tau-bromoTAG KI SK-N-MC cells were generated and validated by Western blotting. In Tau-bromoTAG KI SK-N-MC cells expressing FLAG-dTAG-PPP2CA, treatment with 100 nM, 250 nM, or 500 nM BDPIC for 2 h resulted in strong Tau-bromoTAG dephosphorylation at S396 and S202 / T205, compared to the DMSO-treated control. Figure 17 B). However, compared to DMSO treatment, BDPIC treatment showed better results in expressing empty vectors or FLAG-dTAG-PPP2CA. H118Q No Tau-bromoTAG dephosphorylation was induced in the cells. Figure 17 B). These data indicate that the induced proximity between the catalytically active PPP2CA (rather than the inactive mutant) and Tau induces targeted dephosphorylation of Tau. The observation that BDPIC promotes targeted dephosphorylation of Tau-dTAG by HA-bromoTAG-PPP2CA and Tau-bromoTAG by FLAG-dTAG-PPP2CA suggests the formation of a ternary complex. Indeed, the expression of FLAG-dTAG-PPP2CA or FLAG-dTAG-PPP2CA... H118Q The anti-FLAG IP of Tau-bromoTAG KI SK-N-MC cells co-precipitated only when the cells were treated with BDPIC instead of DMSO. Figure 17 C).

[0219] To assess whether endogenous PPP2CA levels could be redirected to dephosphorylate Tau, the inventors used CRISPR / Cas9 genome editing technology on Tau-bromoTAGKI SK-N-MC cells. PPP2CA Alleles enter homozygous knock-in dTAG The knock-in was confirmed by Western blotting. Treatment of two different clones of TAU-bromoTAG / dTAG-PPP2CA double-KI SK-N-MC cells with increasing concentrations of BDPIC for 24 h induced a dose-dependent decrease in TAU-bromoTAG phosphorylation at S396 and S202 / T205, compared with the DMSO control, with maximum dephosphorylation observed at 100 nM. Figure 18A) indicates that the proximity between endogenous dTAG-PPP2CA and Tau-bromoTAG induced by BDPIC can cause targeted dephosphorylation of Tau. When TAU-bromoTAG / dTAG-PPP2CA double-KI SK-N-MC cells were treated with 100 nM BDPIC for 24 h, strong Tau-bromoTAG dephosphorylation was observed at S396 after 2 h, while maximum dephosphorylation was first observed after 4 h and persisted for 24 h after BDPIC treatment. Figure 18 B). Simultaneously, WT SK-N-MC cells were treated with increasing concentrations of BDPIC ( Figure 18 C) or Tau-bromoTAG KI control cells, compared with DMSO treatment, did not induce any Tau dephosphorylation (C) Figure 18 D) indicates that an induced proximity between dTAG-PPP2CA and Tau-bromoTAG is required to achieve targeted dephosphorylation of Tau.

[0220] Formation using BDPIC ternary complex

[0221] The inventors have demonstrated that BDPIC can induce ternary complexes between two biomolecules in cells. Figure 19 The inventors used the NanoBRET assay (Promega) to evaluate the formation of a ternary complex between transfected BromoTag and dTAF in cells. Figure 19 A, Figure 19 B). An increased ratio of receptor signal to donor signal indicates proximity between BromoTAG and dTAG. U2OS cells were transfected with different combinations of constructs expressing BromoTAG or dTAG with a Halo tag or Nanoluciferase modified at the N- or C-terminus, as instructed. Cells were then treated in 96-well plates with 250 nM BDPIC or DMSO control for 24 h, and the BRET ratio (receptor signal / donor signal) was analyzed using the Promega NanBRET kit according to the manufacturer's instructions. Figure 19 C). Data indicate that BDPIC induces ternary complexes between NLuc-dTAG and BromoTAG-Halo, dTAG-NLuc and BromoTAG-Halo, and BromoTAG-NLuc and dTAG-Halo orientations.

[0222] Targeted protein degradation (TPD) using BDPIC

[0223] The inventors have discovered that BDPIC can induce the degradation of different BromoTAG-POIs (target proteins) by recruiting different dTAG-E3 ligases. Figure 20Tau-bromoTAG knock-in SKNMC cells were transduced with dTAG-KLHL6 retrovirus and lysed after 24 h of treatment with DMSO control (0) or a specified concentration of BDPIC. Figure 20 A). TFEB-BromoTAG knock-in U2OS osteosarcoma cells were transduced with dTAG-RNF125 and lysed after treatment with DMSO control (0) or a specified concentration of BDPIC for 24 h. Figure 20 B). 20 μg of lysed protein was subjected to SDS-PAGE, and immunoblotting analysis was performed using the specified antibody. These data demonstrate the use of BDPIC in screening different combinations of bromoTAG-POI and dTAG-E3 (or vice versa regarding tags) for proximity-induced POI degradation.

[0224] Targeted phosphorylation using BDPIC

[0225] The inventors have discovered that BDPIC can induce phosphorylation of dTAG-POI by recruiting BromoTag-kinase. Figure 21 FAM83D-KO U2OS cells express FAM83D-dTAG-Flag and HA-BromoTAG-CK1. After treatment with DMSO control (0) or a specified concentration of BDPIC for 24 h, the protein was lysed. 20 μg of the lysed protein was subjected to SDS-PAGE, and immunoblotting analysis was performed using the specified antibody. The data showed that BDPIC caused a significant upward migration shift in FAM83D-dTAG at all concentrations, indicating phosphorylation.

[0226] in conclusion

[0227] In summary, this disclosure demonstrates that BDPIC is a highly efficient proximity inducer between dTAG and BromoTag, with broader applicability and higher efficacy than similar PICs. The inventors have demonstrated its use in targeted dephosphorylation by inducing proximity between BromoTag-PPP2CA and TFEB-dTAG, between dTAG-SMAD3 and BromoTag-PPM1H, and ultimately between dTAG-PPP2CA and Tau-BromoTag. Furthermore, the inventors describe the use of BDPIC in targeted protein degradation and targeted phosphorylation. Additionally, the inventors have demonstrated the formation of ternary complexes in cells. These exemplary use cases serve as proof-of-concept studies demonstrating that BDPIC can be applied to induce proximity between any two proteins within a cell. The novel and ingenious combination of dTAG ligands with BromoTag ligands provides an excellent platform for testing whether modulating any of the more than 500 post-translational modifications on a target protein by recruiting modifying enzymes to the target protein's neighborhood affects target protein function. This approach may reveal novel drug paradigms, as the inventors have done here with targeted dephosphorylation. As demonstrated by the inventors, CRISPR / Cas9 gene editing technology allows for the efficient knock-in of dTAG and BromoTag onto target proteins and enzymes in any cell type.

[0228] Experimental section: Targeted dephosphorylation of TFEB

[0229] Material: The following primary antibodies were used: antiphosphorylation-TFEBSer211 (catalog number 37681S) and antiphosphorylation-TFEB Ser122 (catalog number 87932) from Cell Signalling Technology (CST); antiphosphorylation-TFEB Ser142 (ABE1971-I) from Merck; and anti-TFEB (13372-1-AP) from Proteintech. Rabbit antiphosphorylated-TFEBSer109 and antiphosphorylated-TFEB Ser138 were custom-generated using YenZym and rabbits were immunized with the following antigens: for phosphorylated-TFEB Ser109, the human TFEB peptide contained residues 102-113 (NKFAAHI-pS-PAQG), with pS at 109; for phosphorylated-TFEB Ser138, the human TFEB peptide contained residues 128-140 (GHVLSSSAGN-pS-AP), with pS at 138. The antibodies were affinity-purified using the phosphorylated peptide antigens and further removed by immobilized dephosphorylated peptides to eliminate non-phosphorylated binding. The specificity of these antibodies was tested by immunoblotting using HEK293 extracts expressing TFEB WT, S109A, and S138A mutants. Figure 8(B&C). Sheep anti-GFP, sheep anti-dTAG, and sheep anti-BromoTag antibodies were manufactured by MRC-PPU Reagents and Services, University of Dundee. Rabbit anti-GFP (598) for immunofluorescence was purchased from MBL. Secondary antibodies used: goat anti-rabbit IgG (H+L), HRP conjugate; horse anti-mouse IgG (H+L), HRP conjugate were purchased from CST. Goat anti-rabbit IgG (H+L), rabbit anti-sheep IgG (H+L), HRP conjugate were purchased from Thermo Fisher Scientific. MK-8722 was purchased from MedChemExpress. Torin 1 was purchased from Tocris. RNA extraction was performed using the Monarch Total RNA Mini-Preparation Kit. cDNA synthesis was performed using the iSCRIPT cDNA Synthesis Kit (Bio-Rad). Dulbecco Modified Eagle Medium (DMEM) was purchased from Life Technologies. Fetal bovine serum (FBS) was purchased from Thermo Fisher Scientific. Dithiobis(succinimide) propionate (DSP) was purchased from ThermoFisher Scientific. All plasmids used in this study were generated by MRC-PPU Reagents and Services, University of Dundee; details can be found at https: / / mrcppureagents.dundee.ac.uk. dTAG V -1-NEG purchased from Tocris (item number 6915). BDPIC, HDPIC, and PhosTAC7 (Chen et al.) ACS Chem . Biol (2021, 16, 2808) was synthesized by Natalia Shpiro.

[0230] Cell culture: Mouse myoblast C2C12 cells, human embryonic kidney cells 293FT, and human osteosarcoma U2OS cells were cultured in DMEM containing 10% FBS, 2 mM L-glutamine, and 1% streptomycin / penicillin. All cell lines were maintained in a humidified tissue incubator at 37°C and 5% CO2. Cells were exposed to different stimuli and compounds as described in the corresponding figures, followed by lysis.

[0231] plasmid: To produce the retroviral vector, the following construct was cloned into the pBABED-purinemycin plasmid: FLAG-aGFP 6M-PPP1CA (DU62917), FLAG-aGFP 6M -PPP1CA H125Q (DU62964), FLAG-aGFP 6M -PPP2CA(DU62902), FLAG-aGFP 6M -PPP2CA H118Q (DU62960), 3HA-5Gly-BromoTag-5Gly (DU71673), 3HA-5Gly-BromoTag-5Gly-PPP2CA (DU75905), 3HA-5Gly-BromoTag-5Gly-PPP2CA H118Q (DU75906). All constructs were validated by DNA Sequencing Service, University of Dundee (http: / / www.dnaseq.co.uk). For CRISPR / Cas9 gene editing, the following guide RNA (gRNA) and donor cDNA were used: mouse TFEB C-terminal GFP knock-in (KI): sense gRNA (DU69664), antisense gRNA (DU69669), GFP donor (69673). Mouse TFE3 Knockout: sense gRNA (DU69717), antisense gRNA (DU69720). Human TFEB C-terminal dTAG KI: single gRNA (DU69426), dTAG-IRES2-GFP donor (DU74451). Human PPP2CA N-terminal BromoTag KI: Single guide (DU69331), mCherry-IRES2-BromoTag donor (DU74520). These constructs can be requested from the MRC-PPU Reagents and Services webpage (http: / / mrcppureagents.dundee.ac.uk), and the unique identifier (DU) number also provides a direct link to the cloning strategy and sequence details.

[0232] Cell line generation using CRISPR / Cas9: To generate mouse TFEB-GFP KI cells, a pair of targeted [cells] were used. TFEB Vectors containing guide RNAs (pBabeD-puro-sgRNA1 (1 μg) and pX335-CAS9-D10A-sgRNA2 (1 μg)) in the region near the stop codon, as well as GFP-KI insert fragments within the carrying frame and flanking regions. TFEB C2C12 cells were transfected with the corresponding donor plasmid (3 μg) of the homologous arm. To generate mouse TFE3 KO cells, a pair of targeted plasmids were used. TFE3 The vectors containing exon 3 guide RNAs (pBABED-Puro-sgRNA1 (1 μg) and pX335-CAS9-D10A-sgRNA2 (1 μg)) were transfected into C2C12 cells. TFEB GFP / GFP Cells. To generate human TFEB-dTAG KI cells, a coding target was used. TFEB The vector and carrying flanking region of a single gRNA (pX459-CAS9-gRNA (1 μg)) near the stop codon are TFEB The donor plasmid (3 μg) of the homologous arm of the dTAG-IRES2-GFP KI cassette was transfected into U2OS cells. TFEB dTAG / dTAG To generate human BromoTag-PPP2CA KI cells, a gene encoding the N-terminus of PPP2CA was used. BromoTag / BromoTag PPP2CA The vector and flanking structures for a single gRNA (pX459-Puro-CAS9-gRNA (1 μg)) are as follows: PPP2CA donor plasmid (3 μg) of the homologous arm of the mCherry-IRES2-BromoTag KI box was transfected into U2OS TFEB dTAG / dTAGCells. One day after transfection, cells were selected with 2 μg / mL puromycin for 48 h. For KO cells, cells were expanded in fresh medium, and knockout efficiency was confirmed by Western blotting. For KI cells, after puromycin selection, the transfection process was repeated once when cell confluence reached 60-70%. For 24 h after transfection, cells were maintained in fresh medium until single-cell isolation. To obtain single-cell clones of KO, GFP, dTAG, and BromoTag KI, single cells were isolated using fluorescence-activated cell sorting (FACS) with an Influx cell sorter (Becton Dickinson). Single-cell clones were seeded into the wells of 96-well plates pre-coated with 1% (w / v) gelatin to aid cell adhesion. Viable clones were expanded, and successful KO or integration of GFP, dTAG, or BromoTag cDNA at the target locus was confirmed by both Western blotting and genomic DNA sequencing. The CRISPR / Cas9 method used in this paper for KI and KO has been described previously (Brewer et al., 10.1101 / 2023.09.19.558429; Dunbar et al., 10.26508 / lsa.202000805; Fulcher et al., 10.1098 / rsob.160255; Rojas-Fernandez et al., Sci . Rep ., 2015, 5, 9811; Roth et al., Cell Chem . Biol ., 2020, 27, 1151).

[0233] Retrovirus generation in stable cell lines: Stable cell lines were generated via retroviral transduction. Target cDNA was inserted into the pBabeD-puromycin vector (6 μg) and co-transfected with pCMV5-GAG / POL (3.2 μg) and pCMV5-VSV-G plasmid (2.8 μg) (Clontech) into 10-cm dishes of ~60% confluence 293FT cells using 36 μL of 1 mg / mL PEI, as previously described (Fulcher et al., 10.1098 / rsob.160255). Forty-eight hours post-transfection, the culture medium containing retroviral particles was collected, filtered through a 0.45 mm filter, and added to target cells in the presence of 10 μg / mL polybrene (Sigma-Aldrich). After exposure to the retroviral particles, cells were selected for 48 hours with 2 μg / mL puromycin (Sigma-Aldrich). Subsequent experiments were then performed using the transduced cell pool.

[0234] Cell lysis: Cells were harvested by washing twice with phosphate-buffered saline (PBS) and scraping into ice-cold lysis buffer (containing 50 mM HEPES pH 7.4, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 1 mM DTT, 1 mM PMSF, 1.15 mM sodium molybdate, 4 mM sodium tartrate, 10 mM β-glycerophosphate, 1 mM sodium fluoride, 1 mM sodium orthovanadate, and 1x complete protease inhibitor mixture (Roche)). After incubation on ice for 10 min, the lysis buffer was clarified by centrifugation at 20,000 xg for 10 min at 4°C. Protein concentration was determined using the Bradford protein assay. For DSP chemical crosslinking, cells were treated with the compound for 2 h and then lysed. For this purpose, cells were washed twice with pre-warmed PBS and then further incubated with pre-warmed PBS containing 1 mM DSP and the compound at 37°C for 30 min. The reaction was quenched by adding PBS containing 20 mM Tris-HCl for 20 min. Cells were then lysed in lysis buffer without reducing agent.

[0235] Immunoprecipitation: After protein concentration was determined using the Bradford assay, immunoprecipitation (IP) was performed to separate specific target proteins. For anti-FLAG IP, anti-FLAG M2 resin (Sigma-Aldrich) was used; for anti-HA IP, anti-HA frankenbody Sepharose beads (MRC-PPU Reagents and Services) were used. Before IP, a small amount of each lysate (10 μg protein) was reserved for comparison and determination of IP efficiency. The sample (1 mg total protein) was incubated overnight at 4°C on a rotating wheel with 10 μL of packed beads. The beads were collected by centrifugation at 1000 xg for 5 min at 4°C, and the supernatant sample was retained. The IP was then washed twice with 1 mL of lysis buffer (in the presence of 500 mM NaCl), washed once with 1 mL of lysis buffer, and then resuspended in 20 μL of lysis buffer. The input, IP, and post-IP flow-through extract (equivalent to input) samples were reduced in 1X LDS sample buffer (Invitrogen), boiled at 95°C for 5 min, and then subjected to SDS-PAGE.

[0236] Immunoblotting: Reductively denatured cell lysates containing equal amounts of protein (10-30 μg) were separated by SDS-PAGE and transferred to nitrocellulose membranes. After blocking with TBS-T (20 mM Tris, 150 mM NaCl, 0.1% Tween-20) containing 5% (w / v) skim milk for 1 h at room temperature, the membrane was incubated overnight at 4°C with primary antibody diluted in TBS-T containing 5% milk on a shaker. The membrane was then washed for 3 x 10 mins in TBS-T with continuous shaking, followed by incubation with HRP-conjugated secondary antibody diluted in TBS-T containing 5% milk at room temperature for 1 h. The membrane was then washed again in TBS-T for 3 x 10 mins, and finally, signal detection was performed using a ChemiDoc imaging system (Bio-Rad) via chemiluminescence (Promega).

[0237] Immunofluorescence microscopy: Cells were seeded onto sterile glass coverslips in 12-well plates. After treatment, cells were washed twice with PBS and fixed with pre-chilled methanol for 20 min. Cells were blocked by washing twice and incubating in blocking buffer (1% (w / v) BSA / PBS) for 30 min. The coverslips were incubated with the primary antibody in the blocking buffer at 37°C for 1 h and washed three times in the blocking buffer. Then, the coverslips were incubated with the Alexa Fluor-conjugated secondary antibody (Life Technologies) in the blocking buffer at room temperature for 1 h and washed three more times in the blocking buffer. After immersion in ddH2O, cells were mounted on slides using prolong gold anti-quenching mounting medium containing DAPI (Life Technologies) and visualized using a Zeiss LSM880 Airyscan or LSM710 confocal scanning microscope (ZEISS; Plan Apochromat X63 objective, NA 1.4). Images were processed using ZEISS Zen software.

[0238] Quantitative reverse transcription PCR (qRT-qPCR): Total cellular RNA was isolated from C2C12 or U2OS cells using the RNeasy® Micro Kit (Qiagen) according to the manufacturer's instructions. 1 μg of total RNA was reverse transcribed into cDNA using the SuperScript cDNA Kit. The resulting cDNA sample was used as a template for qPCR using a CFX384 real-time qPCR instrument (Bio-Rad). Data are presented as housekeeping genes. Tbp The mean was normalized. The following primer sequences were used: mouse Hexa: 5'- GCT GAG GGC ACG TTC TTT ATC-3', antisense 5'- GCG AGA TGT ATC CAG CAG TAC G-3'; mouse Fnip1 : 5'-sense 5'- GAT GCG TGT TCATGT CAA GG-3', antisense 5'- GGA GAG TGG GTG CTT GCT AC-3'; mouse Flcn : 5'- TGG ATCGGA TCT ACC TCA TCA-3', antisense 5'- TGG ACA TCC AAA CTG CTC TG-3'; mouse Tbp Meaningful 5'-CCT TGT ACC CTT CAC CAA TGA C -3', Antonymous 5'-ACA GCC AAG ATT CAC GGT AGA -3'; Hexa : 5'- CAA CCA ACA CAT TCT TCT CCA-3', 5'- CGC TAT CGT GAC CTG CTTTT; person Fnip1 Meaningful 5' - GGT TCT CGG TGC TCT TCT GAT-3', Antonymous 5' - GCT GTG GAG GGG AACGAA T-3'; Flcn Meaningful 5' - GAT TGA AGC GGC TCT GAC CAA C-3', Antonymous 5' - TCG ACT GTCCAC CTT GGT GAA C-3'; Gpnmb sense 5'- GAT GCC AAA AGG AAG ATG CC-3', antisense 5'-CTC TGA CCA TGC TGT CCA GTT-3'; human Tbp Meaningful 5'- AGG GTT TCT GGT TTG CCA AGA-3', Antonymous 5'- CTG AAT AGG CTG TGG GGT CA-3'.

[0239] Cell viability assay : 0.5×10 3Cells were seeded into each well of a 96-well plate and incubated overnight in a humidified incubator at 37°C and 5% CO2. Different concentrations of BDPIC compound were added to the culture medium, and the plates were incubated for another 48 hours. After incubation, 10 μL of Alamar Blue reagent (Thermo) was added to each well, equal to 10% of the total volume, and the plates were incubated at 37°C for 2 hours. Absorbance was measured at 570 nm and 600 nm.

[0240] Phosphorylation-TFEB analysis by mass spectrometry: Cells were first lysed in NP-40 lysis buffer. The clarified lysate (5 mg protein) was incubated with Flag resin (25 μL packed beads) at 4°C on a rotating wheel for 4 h. After incubation, the beads were washed three times with standard lysis buffer. The protein bound to the beads was eluted in 2x LDS at 95°C for 5 min to denature. The sample was then filtered through a Spin-X column to remove the beads from the eluent. The filtered eluent was loaded onto a 4–12% Bis-Tris gradient gel and proteins were separated by SDS-PAGE. The gel was stained with Instant Blue and then destained in deionized water. A small fraction of the eluent was retained for Western blotting for analysis and validation. To minimize potential protein contamination, all steps beginning at this stage were performed under laminar flow hood. Target protein bands were excised from the Instant Blue-stained gel using a disposable scalpel, cut into 1–2 cm cubes, and transferred to LoBind 1.5 mL Eppendorf tubes. The gel block was washed once with HPLC-grade water and then gently swollen in anhydrous acetonitrile (MeCN) for 5 min. The MeCN was removed, and the gel block was re-swollen with 50 mM Tris-HCl pH 8.0 for 5 min, followed by swirl. This shrinkage-swelling process was repeated once, and then the protein in the gel block was reduced with 5 mM DTT in 50 mM Tris-HCl pH 8.0 at 65°C for 20 min. Next, the protein in the gel block was alkylated with 20 mM iodoacetamide (IAA) in 50 mM Tris-HCl pH 8.0 at room temperature for 20 min. The gel block was then shrunk in MeCN for 5 min, dried, and re-swollen in 50 μL of 50 mM triethylammonium bicarbonate (TEAB) pH 8.0 containing 5 mg / mL trypsin, and incubated overnight at 37°C for digestion. An equal volume of MeCN was added to the digest, and the mixture was swollen for 15 min. The supernatant was collected into a new LoBind 1.5 mL Eppendorf tube. The gel block was then re-swollen with 0.1% (v / v) trifluoroacetic acid (TFA) for 5 min, agitated, and the peptide was extracted twice with MeCN for 5 min each time, agitated. After each extraction, the supernatant was collected and combined with the previous supernatant. The supernatant was then dried by vacuum centrifugation using SpeedVac. The digested peptide was reconstituted in HPLC-grade 5% (v / v) MeCN containing 0.1% (v / v) formic acid and injected into a U3000 RSLC (Rapid Separation Liquid Chromatography) HPLC system (Thermo Fisher Scientific) coupled to a linear ion trap-orbit trap hybrid mass spectrometer (Orbitrap Velos Pro, Thermo Fisher Scientific).Peptides were captured on nanoViper Trap columns (2 cm x 100 μM, C18 5 μM, 100 Å, Thermo Fisher Scientific) and then separated on 15-cm EasySpray columns (Thermo Fisher Scientific) at a flow rate of 300 nL / min. Data were acquired in a data-dependent mode, automatically switching between MS1 ​​and MS2 acquisitions. Full-scan spectra (m / z 400–1,600) were acquired in the orbital trap at a resolution of 60,000 at m / z 400. The 20 most intense ions (above a specified minimum signal threshold of 2,000) were fragmented by collision-induced dissociation and recorded in linear ion traps (all-motion gain control (AGC) target: 30,000; Msn AGC target: 5,000). The raw files were then converted into a list of identified peptides and the strength of identified peptide precursors, and submitted to the internal Mascot server (MRC-PPU, University of Dundee). Data were searched against the SwissProt human database, allowing Met oxidation, Ser / Thr or Tyr residue phosphorylation, and oxidation or dioxide modification as variable modifications. Cys carbamidomethylation was set as a fixed modification. Error tolerances were set to 10 ppm for MS1 and 0.6 Da for MS2. Data analysis was performed using Scaffold v 4.4.6 (Proteome Software).

[0241] Quantitative and statistical analysis: Statistical significance was determined using the following methods: Unpaired Student's t-test was used for comparisons between two groups; one-way ANOVA and Dunnett's multiple comparison test were used for comparisons of more than two groups with the control group. For multiple comparisons, significance was determined using two-way ANOVA and Bonferroni post-hoc test. Statistical significance is indicated in the figures.

[0242] Targeted dephosphorylation of SMAD3

[0243] Cell lines: All operations were performed under aseptic conditions that met biosafety requirements. A549 cells (ATCC, catalog number CVCL_0023) were derived from human lung adenocarcinoma cells from a 58-year-old male; HEK293-FT cells (Invitrogen, catalog number R70007) were HEK293 cell clones transformed with the SV40 large T antigen; and U2OS cells (ATCC, catalog number HTB-96) were derived from human epithelial osteosarcoma cells from a 15-year-old female. For growth, A549, HEK293-FT, and U2OS cells were maintained in DMEM (Life Technologies) containing 10% (v / v) fetal bovine serum (FBS, Thermo Fisher Scientific), 2 mM L-glutamine (Lonza), 100 U / mL penicillin (Lonza), and 0.1 mg / mL streptomycin (Lonza). Cells were grown in a water-saturated incubator at 37°C and 5% CO2. During passage, cells were incubated with trypsin / EDTA at 37°C to detach the cells.

[0244] plasmid: To produce retroviral vectors, the following constructs were cloned into the pBABED plasmid: FLAG-BromoTag(L387A)-PPP2CA (DU78036), FLAG-BromoTag(L387A)-PPP2CA(H118Q) (DU78037), FLAG-dTAG-SMAD3 (DU71496), FLAG-NLS-Halo-HiBiT (DU61387), 3HA-BromoTag(L387V)-PPM1A (DU71699), 3HA-BromoTag(L387A)-PPM1A(D239A) (DU77740), 3HA-BromoTag(L387A)-PPM1H (DU78038), and 3HA-BromoTag(L387A)-PPM1H(H153D). (DU77739), 3HA-BromoTag(L387V)-PPP1CA (DU71698), HA-dTAG-PPM1H (DU77742), Halo-SMAD3 (DU77738). All constructs were sequenced and validated by the DNA Sequencing Service, University of Dundee (http: / / www.dnaseq.co.uk). These constructs can be obtained from the MRC PPU Reagents and Services website (http: / / mrcppureagents.dundee.ac.uk), and the unique identifier (DU) number provides a direct link to the cloning strategy and sequence details.

[0245] Retrovirus generation in stable cell lines: The retroviral vector pBABED-purinomycin or hygromycin encoding the desired construct (6 μg) was co-transfected with pCMV5-gag-pol (3.2 μg) and pCMV5-VSV-G (2.8 μg) (Cell Biolabs) into 10-cm dishes of HEK293-FT cells at ~70% confluence. The plasmid was added to 1 mL of Opti-MEM medium, followed by 24 μL of 1 mg / mL PEI, and then gently mixed and incubated at room temperature for 20 min. The transfection mixture was then added dropwise to HEK293-FT cells. 16 h post-transfection, fresh medium was added to the cells. After 24 h, the retroviral medium was collected and filtered through a 0.45 μm sterile syringe filter. The optimized titer of retroviral medium was diluted (usually 1:1) with fresh medium containing 8 μg / mL polybrene (Sigma-Aldrich) and transduced into target cells (~60% confluence) for 24 h. Cells were then placed in fresh culture medium containing an appropriate concentration of antibiotics to screen for cells that had integrated the construct, while a control untransduced plate was placed for parallel screening. After the control plate had completely died, the transduced cell pool was used for subsequent experiments.

[0246] Cell line generation using CRISPR / Cas9 technology: Using the CRISPR / Cas9 genome editing system (Cong et al., Science , 2013, 339, 819; Ran et al., Nat . Protoc ., 2013, 8, 2281) generate HEK293 homozygous dTAG / dTAG PPP2CA Cells, A549 heterozygotes Halo / WT SMAD3 Cells and A549 BromoTag / BromoTag PPM1H homozygous dTAG / dTAG SMAD3 cell.

[0247] To generate HEK293 dTAG / dTAG PPP2CA Cells, using guide RNA (DU69331 pX459 puromycin Cas9) encoding a target PPP2CA exon 1 locus. D10A PPP2CA (1µg) and donor (DU69361 pMA PPP2CA NterGFP IRES2 FKBP12) F36V (3µg) and PEI transfected cells. This was to generate A549. Halo / WT SMAD3Cells were transfected with a pair of gRNAs targeting SMAD3 exon 1 (DU52711 and DU52710, pX335 sgRNA1 Cas9n and pBABED puromycin U6sgRNA2) (1 µg each) and a donor (3 µg) (DU69866 pMA SMAD3 Nter mCherry IRES2 Halo-tag) and PEI. This was done to generate A549. BromoTag / BromoTag PPM1H Cells were transfected with R. fasimoye cells containing a pair of gRNAs (1 µg each) targeting exon 1 of PPM1H (DU64667 and DU64673 pX335 sgRNA1 Cas9n and pBABED puromycin U6 sgRNA2) and a donor (3 µg) (DU64751 pMK-RQ PPM1H Nter GFP IRES2 BRD4 333-460 L387A donor) to generate A549. BromoTag / BromoTag PPM1H / dTAG / dTAG SMAD3 Cells were transfected with a pair of gRNAs targeting SMAD3 exon 1 (1 µg each) (DU52710 and DU52711 pX335 sgRNA1 Cas9n and pBABED puromycin U6 sgRNA2) and a donor (3 µg) (DU74453 pMA SMAD3 Nter mCherry IRES2 FKBP12). F36V HEK293 cells were selected with 1 μg / mL puromycin (Sigma-Aldrich) and A549 cells were selected with 3.5 µg / mL puromycin for 48 hours 16 h post-transfection. The transfection process was repeated (without another round of selection). Cells were sorted by flow cytometry and single cells were seeded into the wells of a 96-well plate. Viable clones were amplified, and the knock-in integration of the target locus was verified by Western blotting, polymerase chain reaction (PCR), and genome sequencing.

[0248] Stimulation / compound treatment of cells: The following reagents were added to the cell culture medium at specified concentrations and times: recombinant TGFβ1 (Peprotech, catalog number 100-21) (reconstructed in 4 mM HCl / 1 µg / mL BSA), SB-505124 (Sigma, catalog number S4696-5MG), BDPIC, HDPIC, HDPIC-Neg, and PhosTAC7. For serum starvation, cells were washed with phosphate-buffered saline (PBS) and then incubated in serum-free medium for 16 h.

[0249] Quantitative reverse transcription PCR (RT-qPCR): RNA was isolated from cells using the Qiagen RNeasy kit. cDNA was produced using 1 μg of isolated RNA and the iScript cDNA kit (Bio-Rad) according to the manufacturer's instructions. qPCR reactions were performed in triplicate, with a final volume of 10 μL in each 384-well plate. Each well contained 5 μL of PowerUp SYBR Green premix (mastermix), 1 μL of a 20 μM forward and reverse primer mixture, and 2 μL of cDNA. qPCR was performed using a CFX384 real-time qPCR instrument (Bio-Rad). The primers used were (5'-3'): GAPDH Fw (TGCACCACCAACTGCTTAGC), GAPDH Rev (GGCATGGACTGTGGTCATGAG), PAI-1 Fw (AGCTCCTTGTACAGATGCCG), PAI-1 Rev (ACAACAGGAGGAGAAACCCA), SMAD7 Fw (CTGTGCAAAGTGTTCAGGTG), and SMAD7 Rev (TTGAGAAAATCCATCGGGTA). Data were normalized to the mean of housekeeping genes (GAPDH) and used 2 -ΔΔCt The methods were used to analyze and compare relative gene expression. Microsoft Excel and GraphPad Prism software were used for data analysis and graph generation.

[0250] Cell lysis and immunoprecipitation: Cells were harvested by washing twice with PBS and scraping into ice-cold lysis buffer (50 mM Tris-HCl pH 7.5, 0.27 M sucrose, 150 mM NaCl, 1 mM EGTA, 1 mM EDTA, 1 mM sodium orthovanadate, 10 mM sodium β-glycerophosphate, 50 mM sodium fluoride, 5 mM sodium pyrophosphate, and 1% NP-40), with the lysis buffer supplemented with 1x EDTA-free protease inhibitor mixture (Roche). After incubation on ice for 10 min, the lysis buffer was clarified by centrifugation at 17,000 G for 20 min at 4°C. Protein concentration was determined using the Bradford method to achieve inter-sample normalization. For immunoprecipitation (IP), as described above, lyse cells and take 1 mL of a solution containing at least 1 mg of protein. Perform immunoprecipitation using 20 μL of 50 / 50 (v / v) HA-frankenbody resin slurry (MRC Reagents and Services), prepared with lysis buffer supplemented with a protease inhibitor mixture. Take 40 µL for the input sample and add 8 µL of 6X SDS sample buffer. The IP sample is then incubated by rotation at 4°C for 2 h. Then, remove the effluent sample (40 µL). The IP sample is eluted in 40 µL of 2X SDS sample buffer, and 20 µL of IP and input samples are immunoblotted. The IP:input ratio is approximately 25:1.

[0251] Cytoplasmic / nucleus fractionation: Cells were washed twice with PBS, scraped, and centrifuged at 4°C (1200 rpm, 2 min) to collect the pellet. To extract the cytoplasmic fraction, cells were resuspended in cytoplasmic lysis buffer (20 mM Tris-HCl (pH 7.5), 0.1 mM EDTA, 2 mM MgCl2, 1% NP40, 50 nM β-glycerophosphate, and 1x EDTA-free protease inhibitor mixture (Roche)). The sample was incubated at room temperature for 2 min, then on ice for 10 min, and centrifuged at 4°C (3000 rpm, 5 min). The supernatant was collected as the cytoplasmic fraction, and the pellet was subsequently washed three times with washing buffer (20 mM Tris-HCl (pH 7.5), 0.1 mM EDTA, 2 mM MgCl2, 50 nM β-glycerophosphate, and 1x EDTA-free protease inhibitor mixture (Roche)). The remaining precipitate was resuspended in nuclear lysis buffer (20 mM Hepes, 0.4 M NaCl, 25% glycerol, 1 mM EDTA, 0.5 mM NaF, 0.5 mM Na3VO4, 0.5 mM DTT, and 1 x EDTA-free protease inhibitor mixture (Roche)) and lysed by three rapid freeze / thaw cycles. The lysate was then incubated on ice for 30 min with periodic vortexing, followed by clarification at 17,000 G for 20 min at 4°C. The supernatant was collected as the nuclear fraction.

[0252] SDS-PAGE and Western blot : Cell lysates containing an equal amount of protein (15-20 μg) were separated by SDS-PAGE and transferred to nitrocellulose membranes. The membranes were blocked in 5% (w / v) skim milk (Marvel) in TBS-T (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.2% Tween-20) and incubated overnight at 4°C in 5% (w / v) BSA / TBS-T or 5% (w / v) milk / TBS-T with an appropriate primary antibody. Primary antibodies used at specified dilutions include: anti-BRD4 BD2 (SA599, MRC PPU Reagents & Services, 1µg / mL), anti-dTAG (DA179, MRC PPU Reagents and Services, 1µg / mL), anti-FKBP12 (ab24373, Abcam, 1:1000), anti-FLAG M2-peroxidase (A8592-.2MG, Sigma, 1:500), anti-GAPDH (10494-1-AP Proteintech, 1:5000), anti-GAPDH-HRP (HRP-60004, Proteintech, 1:30000), anti-HA-HRP (11867423001, Roche, 1:1000), and anti-Halo-tag (G9281, Promega, ...). Anti-lamin A / C (2032S, CST, 1:1000), anti-PAI-1 (ab66705, Abcam, 1:1000), anti-PPM1H (DA064, MRC PPU Reagents and Services, 1µg / mL), anti-SMAD2 / 3 (8685S, CST, 1:1000), anti-SMAD3 (9523S, CST, 1:1000), anti-SMAD3 p-S423 / S425 (600-401-919, Rockland, 1:1000), anti-α-tubulin (MA1-80189, Invitrogen, 1:5000), anti-neoprotein (ab129002, Abcam, 1:1000), anti ...neoprotein (ab129002, Abcam, 1:1000), anti-neoprotein (ab129002, Abcam, 1:1000), anti-neoprotein (ab129002, Ab The membrane was then washed with TBS-T at a ratio of 1:10000 and incubated at room temperature with a secondary antibody conjugated with HRP (horseradish peroxidase) or IRDye800 for 1 hour.The HRP-conjugated secondary antibodies used at the specified dilutions included: goat anti-rabbit IgG (7074, CST, 1:5000), rabbit anti-sheep IgG (31480, Thermo Fisher Scientific, 1:5000), goat anti-rat IgG (62-9520, Thermo Fisher Scientific, 1:5000), and goat anti-mouse IgG (31430, Thermo Fisher Scientific, 1:5000). The IRDye800-conjugated secondary antibodies used included: IRDye800CW donkey anti-rabbit IgG (H+L) (926-32213, Licor, 1:5000). After further washing, signal detection of the HRP-conjugated secondary antibodies was performed using ECL (Merck) and the ChemiDoc MP system (Bio-Rad). Protein bands were analyzed by density method using ImageLab software (version 6.0.1) (Bio-Rad).

[0253] Cytotoxicity assay: The cytotoxicity of BDPIC, HDPIC, and HDPIC-Neg at specified concentrations and treatment times in A549 and U2OS cells was evaluated using the CellTox Green Assay (Promega, catalog number G8742). The fluorescence signal generated by CellTox Green dyes upon selective binding to DNA in cells with impaired membrane integrity was proportional to the cytotoxicity. Fluorescence was measured at excitation 480 nm / emission 530 nm using a Pherastar FS plate reader, then subtracted from blank measurements (using wells containing only culture medium and no cells), and normalized to the DMSO treatment group. MG132 treatment (20 µM) or the lysis solution included in the kit served as a positive control at each time point. Data were analyzed using Excel (Microsoft) and GraphPad Prism software (Version 8).

[0254] Quantitative and statistical analysis: Statistical analyses were performed using the following methods: unpaired Student's t-test for single comparisons, ANOVA for multiple treatments, followed by post-hoc tests as described in the legend, using Prism® version 8.0.

[0255] Targeted dephosphorylation of Tau

[0256] Cell lysis

[0257] Cells were collected by washing twice with phosphate-buffered saline (PBS) and then gently scraping into ice-cold lysis buffer. The lysis buffer composition consisted of: 50 mM HEPES pH 7.4, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 1 mM DTT, 1 mM PMSF, 1.15 mM sodium molybdate, 4 mM sodium tartrate, 10 mM β-glycerophosphate, 1 mM sodium fluoride, 1 mM sodium orthovanadate, and 1x complete protease inhibitor mixture (Roche). After incubation on ice for 10 minutes, the lysis buffer was clarified by centrifugation at 20,000 xg for 10 min at 4°C. Protein concentration was determined using the BCA protein assay.

[0258] Immunoprecipitation

[0259] After protein concentration was determined by BCA protein assay, immunoprecipitation (IP) was performed to pull down the target protein. For anti-FLAG IP, anti-FLAG M2 resin (Sigma-Aldrich) was used; for anti-GFP IP, anti-GFP Sepharose beads (MRC-PPU Reagents and Services) were used. Before IP, a small amount of each lysate (20 μg protein) was reserved for comparison and determination of IP efficiency. The sample (1 mg total protein) was incubated overnight at 4°C on a rotating wheel with 10 μL of packed beads. The beads were collected by centrifugation at 1000 xg for 5 min at 4°C, and the supernatant sample was retained. The IP was then washed three times with 1 mL of lysis buffer and resuspended in 20 μL of lysis buffer. The input, IP, and post-IP effluent extracts (equivalent to the input) were reduced in 1X LDS sample buffer (Invitrogen), boiled at 95°C for 5 min, and then subjected to SDS-PAGE.

[0260] Immunoblotting

[0261] Reductively denatured cell lysates containing an equal amount of protein (30 μg) were separated by SDS-PAGE and transferred to a nitrocellulose membrane. After blocking with 5% (w / v) skim milk TBS-T (20 mM Tris, 150 mM NaCl, 0.1% Tween-20) for 1 h at room temperature, the membrane was incubated overnight at 4°C with primary antibody diluted in 5% milk TBS-T on a shaker. The membrane was then washed with TBS-T 3 × 10 min with continuous shaking, and incubated with HRP-conjugated secondary antibody diluted in 5% milk TBS-T for 1 h at room temperature. The membrane was washed with TBS-T 3 × 10 min, and the signal was detected by chemiluminescence (Promega) using a ChemiDoc imaging system (Bio-Rad).

[0262] Chemical synthesis

[0263] abbreviation:

[0264] General notes: All chemicals were purchased directly from commercial suppliers and used without further purification. Ortho-AP1867, such as (Simpson et al.), Cell Chem . BiolPreparations were performed as described in [Journal Name], 2022, 29, 1482. Rapid column chromatography and preparative HPLC were performed using a Buchi PrepChrom C-700, a pre-packed Buchi Sepacore rapid column, and an HPLC C18 column (Gemini NY(RP)C18 110, 21.2 × 150 mm, 10 µm particle size). Details of the conditions used for preparative HPLC are provided in the Methods section. NMR spectra were recorded on a Bruker Ascend 500 MHz. Chemical shifts are reported in parts per million (ppm) with reference to the residual solvent peak (CDCl3 = 7.26 ppm). Only the chemical shifts of the major rotational isomers are reported. The following abbreviations are used to report the spectra: s (singleton), d (doublet), t (triplet), q (quartet), m (multiplex), dd (doublet), bs (broad signal). Low-resolution mass spectrometry and analytical HPLC traces were recorded using an Agilent Technologies 1200 Series HPLC system connected to an Agilent Technologies 6130 quadrupole LC / MS and an Agilent diode array detector. Waters XBridge columns (50 mm × 2.1 mm, 3.5 μm particle size) were used, with a gradient of 5% to 95% acetonitrile in aqueous solution (containing 0.1% formic acid or ammonia) for 3 or 7 min. The flow rate was 0.7 mL / min.

[0265] Synthesis of BDPIC:

[0266] (2 S ,3 R )-2-(((benzyloxy)carbonyl)amino)-3-ethylsuccinate 1-tert-butyl ester 4-methyl ester (2) and (2) S ,3 S 1-tert-butyl succinate and 4-methyl ester of 2-((benzyloxy)carbonyl)amino)-3-ethylsuccinate (3)

[0267] At 68 °C, 1-tert-butyl 4-methyl ester of ((benzyloxy)carbonyl)-L-aspartic acid 1-tert-butyl ester (Nowak et al.) was subjected to oxidation. J . Med . Chem(9.38 g, 27.80 mmol) A solution of 1.3 M LiHMDS in THF (45 mL, 58.5 mmol) was added dropwise to a solution of 250 mL of anhydrous THF. The reaction mixture was stirred at -68 °C for 1 h, then at -40 °C for 1 h, and then cooled to -68 °C. Iodethane (5.6 mL, 10.86 g, 69.62 mmol) was then added dropwise, and the mixture was stirred at -10 °C for 1 h, quenched with saturated NH4Cl solution (75 mL), and extracted with EtOAc (2 x 100 mL). The organic layers were washed with brine (75 mL), combined, and concentrated. The crude residue (10 g) was purified by rapid column chromatography on silica gel (200 g) with a gradient of petroleum ether to 40% EtOAc in petroleum ether solution to give compounds 2 (5.79 g, 15.84 mmol, 57%) and 3 (2.28 g, 6.23 mmol, 22%).

[0268] 2: 1 H NMR (500 MHz, CDCl3,): δ = 7.40-7.37 (m, 4H); 7.36-7.30 (m, 1H); 5.70 (d, J=9.3 Hz, 1H); 5.15 (s, 2H); 4.55 (dd, J=4.0 Hz, J=9.75 Hz, 1H); 3.69 (s, 3H); 2.96 (ddd, J=4.0 Hz, 1H); 1.85-1.73 (m, 1H); 1.64-1.55 (m, 1H); 1.45 (s, 9H); 1.01 (t, J=7.4 Hz, 3H).

[0269] 3: 1 H NMR (500 MHz, CDCl3,): δ = 7.40-7.37 (m, 4H); 7.36-7.31 (m, 1H); 5.49 (d, J=7.2 Hz, 1H); 5.12 (s, 2H); 4.56 (dd, J=5.0 Hz, J=8.3 Hz, 1H); 3.71(s, 3H); 2.78-2.72 (m, 1H); 1.90-1.80 (m, 1H); 1.62-1.53 ​​(m, 1H); 1.48 (s,9H); 0.98 (t, J=7.2 Hz, 3H).

[0270] C 19 H27 NNaO6, predicted value [M+Na] + 388.17, Measured value [M+Na] + 388.0.

[0271]

[0272] (2 S ,3 R )-2-(((benzyloxy)carbonyl)amino)-3-(methoxycarbonyl)valeric acid (4)

[0273] To a solution of (2S,3R)-2-(((benzyloxy)carbonyl)amino)-3-ethylsuccinate 1-tert-butyl ester 4-methyl ester (2) in DCM (5 mL), a solution of TFA in DCM (40 mL, 1:3 v / v) was added. The reaction mixture was stirred at RT for 16 h and concentrated. The crude residue was purified by RP C18 rapid column chromatography (SVP D40-RP18 25-40 µm 90 g) with a gradient of MeOH / H2O (5% to 95%) to give compound 4 (1.39 g, 4.50 mmol, 78%).

[0274] 1 H NMR (500 MHz, CDCl3,): δ = 7.40-7.33 (m, 5H); 5.89 (d, J=9.4 Hz,1H); 5.17 (s, 2H); 4.68 (dd, J=3.6 Hz, J=9.4 Hz, 1H); 3.73 (s, 3H); 3.08(ddd, J=3.5 Hz, 1H); 1.89-1.80 (m, 1H); 1.70-1.60 (m, 1H); 1.05 (t, J=7.4 Hz, 3H).

[0275] C 15 H 19 NNaO6, predicted value [M+Na] + 332.11, Measured value [M+Na] + 332.1.

[0276]

[0277] (2 R ,3 S )-3-(((benzyloxy)carbonyl)amino)-4-((3-(4-chlorobenzoyl)-4,5-dimethylthiophene-2-yl)amino)-2-ethyl-4-oxobutyrate methyl ester (6)

[0278] At RT, 5 (Michio et al., 1.53 g, 4.94 mmol) was added to a solution of 4 (1.53 g, 4.94 mmol) in DCE (45 mL). J . Med . Chem Compound 6 (1.31 g, 4.94 mmol), DIPEA (4.30 mL, 24.7 mmol), and PyBOP (6.42 g, 12.35 mmol) were extracted. The reaction mixture was stirred at 50 °C for 48 h, cooled to RT, diluted with water (25 mL), and extracted with DCM (2 × 50 mL). The organic layer was washed with brine (25 mL) and concentrated. The crude residue (160 g) was purified by silica gel column chromatography with a gradient of petroleum ether to 40% EtOAc petroleum ether solution to give crude substance (1.57 g), which was further purified by RP C18 rapid column chromatography (SVP D40-RP18 25-40 µm 90 g) with a gradient of MeCN / H2O (5% to 95%) to give compound 6 (1.13 g, 2.02 mmol, 41%).

[0279] 1 H NMR (500 MHz, CDCl3,): δ = 11.74 (s,1H); 7.56(d, J=8.4 Hz, 2H); 7.45 (d, J=8.4 Hz,4H); 7.34-7.29 (m, 3H); 6.24(d, J=9.4 Hz,1H); 5.30 (d, J=12.1 Hz, 1H); 5.18 (d, J=12.1 Hz,1H); 4.75 (dd, J=3.4 Hz, J=9.6 Hz, 1H); 3.68(s, 3H); 3.34-3.27 (m, 1H); 2.27 (s, 3H); 1.89-1.79 (m, 1H); 1.71 (s, 3H);1.67-1.59 (m, 1H); 1.05 (t, J=7.4 Hz, 3H).

[0280] C 28 H 29 ClN2NaO6S, predicted value [M+Na] + 579.13, Measured value [M+Na] + 579.0.

[0281]

[0282] ( R )-2-(( S methyl 5-(4-chlorophenyl)-6,7-dimethyl-2-oxo-2,3-dihydro-1H-thieno[2,3-e][1,4]diaza-3-yl)butyrate (8)

[0283] Pd(OAc)₂ (0.04 g, 0.17 mmol) and Et₃N (0.1 mL, 0.71 mmol) were added to a solution of 6 (0.98 g, 1.76 mmol) in DCM (18 mL). The reaction mixture was heated at 45 °C for 5 min while triethylsilane (1.40 mL, 1.01 g, 8.76 mmol) was added dropwise. The reaction mixture was stirred at 45 °C for another 2 h, cooled to RT, diluted with DCM (20 mL), filtered through diatomaceous earth, and concentrated. The crude residue (2... R ,3 S Methyl methyl 3-amino-4-((3-(4-chlorobenzoyl)-4,5-dimethylthiophen-2-yl)amino)-2-ethyl-4-oxobutyrate (7) was used for the next step without further purification.

[0284] C 20 H 24 ClN2O4S, predicted value [M+H] + 423.11, Measured value [M+H] + 423.1.

[0285] 10% acetic acid was added to a solution of 7 (1.1 g crude residue) in DCE (10 mL), and the reaction mixture was kept at 60 °C for 16 h and concentrated. The crude residue was purified by rapid column chromatography on silica gel (160 g) in a gradient of petroleum ether to 50% EtOAc in petroleum ether to give compound 8 (0.37 g, 0.91 mmol, 51%, two steps) as shiny yellow crystals. The solution was purified by chiral column CHIRALPAC IA (20 x 250 mm, 5 µm particle size, DAICEL), 20% EtOAc in heptane, 220 nm, v = 6 mL / min, t R =15.1 min, the purity of the enantiomer of 8 was determined to be 99%. ee .

[0286] 1H NMR (500 MHz, CDCl3,): δ = 8.70 (br s,1H); 7.34 (m, 4H); 3.88 (d, J=10.4 Hz, 1H); 3.83 (s, 3H); 3.66 (ddd, J=4.5 Hz, 1H); 2.31 (s, 3H); 1.97-1.89 (m, 1H); 1.62 (s, 3H); 1.63-1.57 (m, 1H); 1.03 (t, J=7.5 Hz, 3H).

[0287] C 20 H 22 ClN2O3S, predicted value [M+H] + 405.10, Measured value [M+H] + 405.1.

[0288] [α] 20 D = +44.1 (c 0.5, CHCl3).

[0289]

[0290] ( R )-2-(( S 4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diaza-6-yl)methyl butyrate (9)

[0291] Such as Filippakopoulos et al. Nature As described in 2010, 468, 1067, the title compound was obtained from 8 (0.25 g, 0.61 mmol) as a starting material, in 73% yield (0.20 g, 0.45 mmol), as white crystals. The solution was prepared by chiral column CHIRALPAC IA (20 x 250 mm, 5 µm particle size, DAICEL), 20% EtOAc in heptane, 220 nm, v = 6 mL / min, t R =19.2 min, the purity of the enantiomer of 9 was determined to be 99%. ee .

[0292] 1H NMR (500 MHz, CDCl3,): δ = 7.34 (m, 4H); 4.26 (d, J=10.9 Hz,1H); 4.01 (ddd, J=3.8 Hz, 10.7 Hz, 10.9 Hz, 1H); 3.87 (s, 3H); 2.69 (s, 3H); 2.44(s, 3H); 2.25-2.15 (m, 1H); 1.70 (s, 3H); 1.74-1.63 (m, 1H); 1.04 (t, J=7.4Hz, 3H).

[0293] 13 C NMR (126 MHz, CDCl3) δ = 175.4, 163.2, 154.45, 149.9, 149.8,136.8, 136.6, 132.1, 130.9, 130.5, 129.8, 128.7, 59.4, 51.6, 49.7, 23.3,14.5, 13.2, 11.9, 11.7.

[0294] C 22 H 24 ClN4O2S, predicted value [M+H] + 443.13, Measured value [M+H] + 443.1.

[0295] [α] 20 D = +70.1 (c 0.5, CHCl3).

[0296] To a solution of compound 9 (0.20 g, 0.45 mmol) in a 1:1 THF:EtOH mixture (5 mL), 0.5 M LiOH solution (2.7 mL, 1.35 mmol) was added. The mixture was stirred at 45 °C for 24 h, cooled to RT, acidified with 1 M HCl (1.5 mL, 1.5 mmol), and concentrated. Water (5 mL) was added to the crude residue, and the precipitate was collected using a sintered glass filter. Purification was performed by RP C18 rapid column chromatography (SVP D40-RP18 25–40 µm 90 g) with a MeCN / H2O gradient (5% to 95%) to give compound 10 (0.115 g, 0.26 mmol, 59%).

[0297] 1H NMR (500 MHz, CDCl3,): δ = 7.44 (d, J=8.6 Hz, 2H); 7.36 (d, J-8.6Hz, 2H); 4.25 (d, J=6.1, 1H); 3.73-3.63 (m, 1H); 2.71 (s, 3H); 2.46 (s, 3H); 2.12-2.02 (m, 1H); 2.00-1.90 (m, 1H); 1.74 (s, 3H); 1.12 (t, J=7.4 Hz, 3H).

[0298] 13 C NMR (126 MHz, CDCl3) δ = 174.8, 164.7, 154.8, 150.0, 137.4, 135.8,132.4, 131.4, 131.2, 130.1, 128.8, 58.0, 48.4, 23.8, 14.7, 13.2, 11.8.

[0299] C 21 H 22 ClN4O2S, predicted value [M+H] + 429.12, Measured value [M+H] + 429.1.

[0300] [α] 20 D = +103.5 (c 0.5, CHCl3).

[0301]

[0302] ( R )-2-(( S 2,2-Dimethyl-4-oxo-3,8,11,14-tetraoxa-5-azahexadecane-16-yl ester of 4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diaza-6-yl)butyric acid (11)

[0303] To a solution of 10 (0.030 g, 0.07 mmol) in DCM (2 mL), add DIC (0.043 mL, 0.035 g, 0.277 mmol) and DMAP (0.011 g, 0.09 mmol), and stir the mixture at RT for 30 min. Then add tert-butyl- NA solution of 14-(2-(2-[2-(2-hydroxyethoxy)ethoxy]ethoxy)ethyl)carbamate 14 (0.082 g, 0.28 mmol) in DCM (0.5 mL) was prepared, and the reaction mixture was heated at 40 °C for 4 h and concentrated. The crude residue (0.15 g) was purified by HPLC RP C18 column with a gradient of MeCN / H2O (5% to 95%) to give 11 (0.028 g, 0.039 mmol, 56%) as an amorphous solid.

[0304] 1 H NMR (500 MHz, CDCl3,): δ = 7.36 (d, J=8.6 Hz, 2H); 7.33(d, J-8.6Hz, 2H); 5.03 (br s, 1H); 4.49-4.37 (m, 2H); 4.27 (d, J=10.8 Hz, 1H); 4.02(ddd, J=3.6 Hz, 1H); 3.86-3.78 (m, 2H); 3.74-3.70 (m, 2H); 3.68-3.61 (m, 6H); 3.55 (t, J=5.2 Hz, 2H); 3.35-3.30 (m, 2H); 2.68 (s, 3H); 2.44 (s, 3H); 2.25-2.16 (m, 1H), 1.76-1.66 (m, 1H); 1.71 (s, 3H); 1.46 (s 9H); 1.06 (t, J=7.4Hz, 3H).

[0305] C 34 H 47 ClN5O7S, predicted value [M+H] + 704.29, Measured value [M+H] + 704.3.

[0306] ( R )-2-(( S 2-(2-(2-(2-(2-aminoethoxy)ethoxy)ethoxy)ethyl ester of 4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diaza-6-yl)butyric acid (12)

[0307] The solution of 11 (0.028 g, 0.039 mmol) in formic acid (1 mL) was kept at RT for 16 h. Volatile substances were removed under vacuum to obtain 12 (0.028 g, 0.039 mmol), and the crude residue was used for the next step without further purification.

[0308] C 29 H 39 ClN5O5S, predicted value [M+H] + 604.24, Measured value [M+H] + 604.2.

[0309]

[0310] (S)-1-((S)-2-(3,4,5-trimethoxyphenyl)butyryl)piperidine-2-carboxylic acid R )-1-(2-((( R )-17-(( S 3-(3,4-dimethoxyphenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diaza-6-yl)-2,16-dioxo-6,9,12,15-tetraoxa-3-azanonadecanyl)oxy)phenyl)-3-(3,4-dimethoxyphenyl)propyl ester (13, BDPIC)

[0311] In RT, ortho-AP1867 (Simpson et al., Cell Chem . Biol A solution of 12 (0.028 g, 0.038 mmol) in DCM (0.5 mL) was added to a solution of 12 (0.028 g, 0.038 mmol) in DCM (1 mL), DIPEA (0.093 mL, 0.53 mmol), and 50% T3P in ethyl acetate. The mixture was stirred at RT for 16 h, diluted with water (2 mL), and extracted with EtOAc (20 mL). The organic layer was washed with brine (5 mL) and concentrated. The crude residue was purified by HPLC RP C18 column with a gradient of MeCN / H2O (5% to 95%) to give 13 BDPIC (0.021 g, 0.016 mmol, 42%) as a white powder.

[0312] 1¹H NMR (500 MHz, CDCl₃, mixture of rotational isomers, only peaks of the major rotational isomers are reported): δ = 7.42–7.37 (m, 1H); 7.36 (d, J = 8.6 Hz, 2H); 7.32 (d, J = 8.6 Hz, 2H); 7.22 (dt, J = 1.7 Hz, J = 7.8 Hz, 1H); 7.10–6.99 (m, 1H); 6.89 (t, J = 7.6 Hz, 1H); 6.86–6.76 (m, 2H); 6.73–6.69 (m, 1H); 6.68 (s, 1H); 6.52–6.41 (m, 2H); 6.49 (s, 1H); 6.17 (dd, J = 1.8 Hz, 4.27 (d, J=10.8 Hz, 1H); 4.50 (q, J=14.8 Hz, 2H); 4.27 (d, J=10.8 Hz, 1H); (ddd, J=3.6 Hz, 1H); 3.88-3.84 (m, 12H); 3.80 (s, 3H); 3.70 (s, 3H); 3.69-3.64 (m, 2H); 3.62-3.51 (m, 11H); 3.50-3.40 (m, 2H); 2.68 (s, 3H); 2.69-2.46 (m, 2H); 2.43 (s, 3H); 2.33-1.93 (m, 6H); 1.82-1.73 (m, 1H); 1.72-1.64(m, 1H); 1.70 (s, 3H); 1.05 (t, J=7.4 Hz, 3H); 0.90 (t, J=7.2 Hz, 3H).

[0313] C 67 H 84 ClN6O 15 S, Predicted value [M+H] + 1279.54, Measured value [M+H] + 1279.6.

[0314] Synthesis of HDPIC and HDPIC-Neg:

[0315] (18-Chloro-3,6,9,12-tetraoxaoctadecyl)tert-butyl carbamate (15)

[0316] At 0 °C, a solution of tert-butyl carbamate 14 (1.46 g, 5.0 mmol) in anhydrous DMF (20 mL) was added to a mineral oil solution of 60% sodium hydride (0.24 g, 6.0 mmol), and the mixture was stirred at 0 °C for 1 h. Subsequently, a solution of 1-chloro-6-iodohexane (1.35 g, 5.5 mmol) in anhydrous DMF (5 mL) was added. The reaction mixture was stirred overnight at RT, diluted with water (25 mL), and extracted with EtOAc (50 mL). The organic layer was washed with brine (20 mL) and concentrated. The crude residue was purified by silica gel (80 g) column chromatography, gradient from petroleum ether to 100% EtOAc, to give 15 (0.75 g, 1.82 mmol, 35%).

[0317] 1 H NMR (400 MHz, CDCl3) δ = 5.04 (bs, 1H), 3.70-3.63 (m, 10 H); 3.62-3.58 (m, 2H), 3.58-3.52 (m, 4H); 3.48 (t, 2H), 3.33 (q, 2H); 1.84-1.75 (m, 2H), 1.65-1.57 (m, 4H), 1.47 (s, 9H); 1.44-1.36 (m, 2H).

[0318] C 19 H 38 ClNO6, predicted value [M+H] + 412.25, Measured value [M-Boc+H] + 312.

[0319]

[0320] 18-Chloro-3,6,9,12-Tetraoxaoctadecyl-1-amine hydrochloride (16)

[0321] A solution of 15 (0.75 g, 1.82 mmol) in a 9:1 mixture of DCM:MeOH (10 mL) was added to a solution of 4 M HCl in dioxane (1.82 mL, 7.28 mmol), and the mixture was stirred at RT for 16 h. The reaction mixture was concentrated, and the crude residue of 16 as an HCl salt (0.63 g, 1.80 mmol, 99%) was used for the next step without further purification.

[0322] 1H NMR (400 MHz, MeOD- d 4) δ = 3.74 (t, J=5.06 Hz, 2H), 3.72-3.63 (m,10 H); 3.63-3.59 (m, 2H), 3.57 (t, J=6.5 Hz, 2H); 3.51 (t, J=6.5 Hz,2H), 3.14(t, J=5.06 Hz, 2H); 1.83-1.75 (m, 2H), 1.65-1.57 (m, 2H), 1.54-1.38 (m, 4H).

[0323] C 14 H 30 ClNO4, predicted value [M+H] + 312.19, Measured value [M+H] + 312.

[0324]

[0325] (S)-1-((S)-2-(3,4,5-trimethoxyphenyl)butyryl)piperidin-2-carboxylic acid (R)-1-(2-((21-chloro-2-oxo-6,9,12,15-tetraoxa-3-aza-eicosenoyl)oxy)phenyl)-3-(3,4-dimethoxyphenyl)propyl ester 17 (HDPIC)

[0326] At RT, 16 (0.044 g, 0.126 mmol), DIPEA (0.1 mL, 0.575 mmol), and HATU (0.065 g, 0.172 mmol) were added to a solution of ortho-AP1867 (0.08 g, 0.115 mmol) in DCM (5 mL). The reaction mixture was stirred at RT for 16 h and concentrated. The crude residue was purified by silica gel (16 g) column chromatography in a gradient from DCM to 100% EtOAc, then to a 20% MeOH solution of EtOAc. Thus, the resulting crude material (0.09 g) was further purified by HPLC RP C18 column chromatography in a gradient of MeCN / H2O (5% to 95%) to give 17 (HDPIC) (0.084 g, 0.085 mmol, 73%) as an amorphous solid.

[0327] 1¹H NMR (500 MHz, CDCl₃, mixture of rotational isomers, only peaks of the major rotational isomers are reported): δ = 7.40 (t, J = 5.5 Hz, 1H); 7.22 (dt, J = 1.5 Hz, J = 7.8 Hz, 1H); 7.19–7.15 (m, 1H); 7.09–7.06 (m, 1H); 6.91–6.87 (m, 1H); 6.84–6.77 (m, 2H); 6.73–6.66 (m, 1H); 6.69 (s, 1H); 6.49 (s, 1H); 6.51–6.42 (m, 1H); 6.41–6.32 (m, 1H); 6.17 (t, J = 6.8 Hz, 1H); 5.51(d, J=4.4 Hz, 1H); 4.66-4.44 (m, 3H); 3.90-3.85 (m,12H); 3.80 (s, 2H); 3.71 (s, 3H); 3.64-3.52 (m, 20H); 3.46 (t, J=6.5 Hz, 2H); 2.71-2.44 (m, 3H); 2.32-1.93 (m, 4H); 1.83-1.75 (m, 2H); 1.64-1.55 (m, 2H); 1.50-1.34 (m, 4H);

[0328] C 52 H 75 ClN2O 14 Predicted value [M+H] + 987.50, Measured value [M+H] + 988, 989.

[0329]

[0330] (2,2-Dimethyl-3,3-diphenyl-4,11,14,17,20-pentaoxa-3-silazoconecosano-22-yl)carbamic acid Uncle Ding Ester (18)

[0331] At 0 °C, a solution of 60% sodium hydride in mineral oil (0.146 g, 3.66 mmol) was added to a solution of (2-(2-(2-hydroxyethoxy)ethoxy)ethoxy)ethyl)carbamate tert-butyl 14 (0.89 g, 3.05 mmol) in anhydrous DMF (15 mL). The mixture was stirred at 0 °C for 1 h, followed by the addition of a solution of ((6-bromohexyl)oxy)(tert-butyl)diphenylsilane (1.27 g, 3.05 mmol) in anhydrous DMF (3 mL). The reaction mixture was stirred overnight at RT, diluted with water (20 mL), and extracted with EtOAc (50 mL). The organic layer was washed with brine (20 mL) and concentrated. The crude residue was purified by silica gel (80 g) column chromatography with a gradient of petroleum ether-50% EtOAc petroleum ether solution to give 18 (0.85 g, 1.34 mmol, 44%).

[0332] 1 H NMR (500 MHz, CDCl3) δ = 7.68 (d, J=7.7 Hz, 4H); 7.46-7.37 (m, 6H); 5.09 (bs, 1H); 3.69-3.58 (m, 14 H); 3.56 (t, J=5.0 Hz, 2H); 3.45 (t, J=6.8Hz, 2H); 3.33 (q, 2H); 1.64-1.54 (m, 4H); 1.46 (s, 9H); 1.42-1.27 (m, 4H); 1.06 (s, 9H).

[0333] C 35 H 57 NO7Si, predicted value [M+Na] + 654.38, Measured value [M+Na] + 654.4.

[0334]

[0335] (18-hydroxy-3,6,9,12-tetraoxaoctadecyl) tert-butyl carbamate (19)

[0336] At 0 °C, a solution of 1 M TBAF in THF (1.47 mL, 1.47 mmol) was added to a solution of 18 (0.85 g, 1.34 mmol) in THF (5 mL). The mixture was stirred overnight at RT, water (5 mL) was added, and the mixture was extracted twice with EtOAc. The organic layer was washed with brine and concentrated. The crude residue (40 g) was purified by silica gel column chromatography with a gradient of DCM to 10% MeOH in DCM to give 19 (0.38 g, 0.965 mmol, 72%).

[0337] 1 1.64-1.56 (m, 4H); 1.46 (s, 9H); 1.42-1.38 (m, 4H).

[0338] C 19 H 39 NO7, Predicted value [M+H] + 394.28, Measured value [M-Boc+H] + 294.3.

[0339]

[0340] (18-Fluoro-3,6,9,12-Tetraoxaoctadecyl)tert-butyl carbamate (20)

[0341] At -70 °C, a solution of 19 (0.087 g, 0.221 mmol) in DCM (1 mL) was added to a solution of diethylaminosulfur trifluoride (DAST) (0.089 g, 0.072 mL, 0.552 mmol) in DCM (0.5 mL). The mixture was stirred at room temperature for 12 h, quenched with saturated NaHCO3 (2 mL), and extracted with DCM (10 mL). The organic layer was washed with brine and concentrated. The crude residue (12 g) was purified by silica gel column chromatography with a gradient of DCM to 10% MeOH in DCM to give 20 (0.055 g, 0.139 mmol, 62%).

[0342] 1H NMR (500 MHz, CDCl3) δ = 5.09 (bs, 1H); 4.45 (dt, J=6.2 Hz, J=47.4Hz, 2H); 3.71-3.58 (m, 10 H); 3.56 (t, J=5.0 Hz, 2H); 3.48 (t, J=6.6 Hz, 2H); 3.33 (m, 2H); 3.23 (m, 2H); 1.65-1.58 (m, 4H); 1.46 (s, 9H); 1.43-1.39 (m, 4H).

[0343] 19 F NMR: δ = -218.1.

[0344] C 19 H 38 FNO6, Predicted value [M+H] + 396.28, Measured value [M-Boc+H] + 296.3.

[0345]

[0346] 18-Fluoro-3,6,9,12-Tetraoxaoctadecyl-1-amine (21)

[0347] At RT, TFA (0.5 mL) was added to a solution of 20 (0.053 g, 0.134 mmol) in DCM (2 mL), and the reaction mixture was stirred at RT for 2 h and concentrated. The crude residue of 21 as TFA salt (0.050 g, 0.122 mmol) was used for the next step without further purification.

[0348] 1 H NMR (500 MHz, CDCl3) δ = 7.69 (bs, 2H); 4.46 (dt, J=6.2 Hz, J=47.4Hz, 2H); 3.90-3.50 (m, 16 H); 3.21-3.14 (m, 2H); 1.65-1.38 (m, 8H).

[0349] 19 F NMR: δ = -75.1, -76.0.

[0350] C 14 H 30 FNO4, predicted value [M+H] + 296.22, Measured value [M+H] +296.2.

[0351]

[0352] (S)-1-((S)-2-(3,4,5-trimethoxyphenyl)butyryl)piperidin-2-carboxylic acid(R)-3-(3,4-dimethoxyphenyl)-1-(2-((21-fluoro-2-oxo-6,9,12,15-tetraoxa-3-aza-eicosenoyl)oxy)phenyl)propyl ester 22 (HDPIC-Neg)

[0353] At RT, 21 (0.05 g, 0.122 mmol), DIPEA (0.05 mL, 0.259 mmol), and HATU (0.015 g, 0.039 mmol) were added to a solution of acid ortho-AP1867 (0.018 g, 0.0259 mmol) in DCM (0.5 mL). The reaction mixture was stirred at RT for 16 h and concentrated. The crude residue (12 g) was purified by silica gel column chromatography with a gradient of petroleum ether:DCM (4:1) to 10% MeOH in petroleum ether:DCM (4:1). Thus, the crude substance (0.02 g) was further purified by HPLC RPC18 column with a gradient of MeCN / H2O (5% to 95%) to give 22 (HDPIC-Neg) (0.012 g, 0.0122 mmol, 47%) as an oil.

[0354] 1¹H NMR (500 MHz, CDCl₃, mixture of rotational isomers, only peaks of the major rotational isomers are reported): δ = 7.40 (t, J = 5.5 Hz, 1H); 7.38–7.24 (m, 1H); 7.24–7.18 (m, 1H); 7.10–7.01 (m, 1H); 6.88 (t, J = 7.2 Hz, 1H); 6.86–6.76 (m, 1H); 6.73–6.66 (m, 1H); 6.69 (s, 1H); 6.49 (s, 1H); 6.44–6.25 (m, 2H); 6.16 (t, J = 6.6 Hz, 1H); 5.51 (d, J = 4.4 Hz, 1H); 4.67-4.51 (m, 4H); 4.45 (dt, J=6.2 Hz, J=47.4 Hz, 2H); 3.90-3.85(m, 12H); 3.80 (s, 3H); 3.70 (s, 3H); 3.64-3.52 (m, 20H); 0.90 (t, J=7.2 Hz, 3H).

[0355] 19 F NMR: δ = -218.13.

[0356] C 52 H 75 FN2O 14 Predicted value [M+H] + 971.53, Measured value [M+H] + 971.5.

[0357] Synthesis of PhosTAC7: As reported above (Chen et al., ACS Chem . Biol Synthesized in 2021, 16, 2808, with a yield of 24%.

Claims

1. A proximity-inducing compound for inducing proximity between two biomolecules, enabling the biomolecules to interact, wherein the proximity-inducing compound corresponds to formula (Ia): (Ia) in: It is the first ligand capable of binding to biomolecules with hole-modified Brd bromine domains; It is a second ligand capable of binding to biomolecules with FKBP; and L 1 It is a connector.

2. The proximity-inducing compound of claim 1, wherein the hole-modified Brd bromine domain is Brd4BD2. L387A Brd4BD2 L387V Brd4BD1 L94A Brd4BD1 L94V ,Brd2BD2 L383A ,Brd2BD2 L383V , Brd2BD1 L110A , Brd2BD1 L110V Brd3BD2 L344A Brd3BD2 L344V Brd3BD1 L70A Brd3BD1 L70V ,BrdTBD2 L306A ,BrdTBD2 L306V ,BrdTBD1 L63A Or BrdTBD1 L63V Bromine domain.

3. The proximity-inducing compound of claim 1 or 2, wherein FKPB is FKBP12 F36V .

4. The proximity-inducing compound according to any of the preceding claims, wherein L 1 Having formula (IIIa): –(L 2 ) w – (IIIa) Where w is an integer from 1 to 10; each L 2 Independently selected from C(O)NH, C(O)O, CH2CH2O, CH2, ethynyl group, triazole subunit, piperazine subunit, and piperidine subunit; and wherein Indicates the connection location.

5. The proximity-inducing compound of claim 1, wherein the proximity-inducing compound has the formula (Ib): (Ib) in X is a halogen; R 1 R 4 and R 6 Each is independently selected from C1-6 alkyl, C1-6 haloalkyl, C 1-6 Alkyl groups, halogens, and hydroxyl groups; G 1 It is a 5-membered heteroaromatic hydrocarbon, optionally substituted with one or two substituents selected from C14. 1-3 Alkyl, C1-3 haloalkyl, C 1-3 alkoxy, halogen, hydroxyl and amino, or G 1 It is a 6-membered aromatic hydrocarbon or a heteroaromatic hydrocarbon, which may optionally be substituted with methyl, halogen, hydroxyl and mercapto groups; G 2 It's 5 yuan. N - A heteroaromatic hydrocarbon selected from pyrrolidine, pyrrole, imidazoline, pyrazole, imidazoline, triazole, and tetraazole, optionally substituted with one or more substituents selected from C1-3 alkyl, C1-3 haloalkyl, C1-3 ... 1-3 Alkyl, halogen, hydroxyl, and amino; R 2 It is H, C 1-3 Alkyl, C 1-3 Halogenated alkyl groups or halogens; R 3 It is C 1-4 Alkyl or C 1-4 Halogenated alkyl groups; B 1 and B 2 Independently possessing formula (IIa): –(A 2 ) a –(CH2) b –(A 3 ) c –(C(O)) d –(CH2) e –(A 4 ) f –(CH2) g – (IIa) Where A 2 A 3 and A 4 Independently selected from NH and NC 1-4 Alkyl, O, and S; a, c, d, and f are integers independently selected from 0 and 1; b, e, and g are integers independently selected from 0 to 4; and wherein Indicates the connection position; L 3 It is a connector; A 1 Selected from O, NH and NC 1-4 alkyl; H is an integer that is either 0 or 1; R 5 It is C 1-4 Alkyl or C 1-4 Halogenated alkyl groups; and ni, n-ii, and n-iii are integers independently selected from 0 to 3.

6. The proximity-inducing compound of claim 5, wherein L 3 Having formula (IIIb): –(L 4 ) s – (IIIb) Where s is an integer from 0 to 4; each L 4 Independently selected from CH2CH2O, CH2, ethynyl group, triazole subunit, piperazine subunit, and piperidine subunit; and wherein Indicates the connection location.

7. The proximity-inducing compound of claim 5 or 6, wherein B 1 Choose any one of formulas (IIb) to (IIe): Where p is an integer from 0 to 4; and the wavy line indicates the connection position.

8. The proximity-inducing compound of claim 7, wherein B 1 It has equation (IIb) or (IIc); and p is 0.

9. The proximity-inducing compound according to any of the preceding claims, wherein B 2 Having the formula (IIf) or (IIg): Where A 5 It is O or NH; A 6 It is O, NH, or S; m and q are independent integers selected from 0 to 4; and the wavy line indicates the connection position.

10. The proximity-inducing compound of claim 9, wherein B 2 It has the formula (IIf); A 5 It is NH; A 6 It is O; m is 2; and q is 1.

11. The proximity-inducing compound of any one of claims 5 and 7 to 10, wherein L 3 Having formula (IIIc): Where t is an integer selected from 1 to 10; and the wavy line indicates the connection position.

12. The proximity-inducing compound of claim 11, wherein t in formula (IIIc) is selected from 1, 2, 3, 4, 5, 6 and 7.

13. The proximity-inducing compound of claim 11, wherein t in formula (IIIc) is 3.

14. The proximity-inducing compound according to any one of claims 5-13, wherein R 4 It is a C1-6 alkoxy group; R 5 It is a C1-4 alkyl group; and R 6 It is a C1-6 alkoxy group.

15. The proximity-inducing compound according to any one of claims 5-14, wherein h is 1; A 1 It is O; R 4 It is a methoxy group; R 5 It is ethyl; R 6 It is a methoxy group; n-ii is 2; and n-iii is 3.

16. The proximity-inducing compound of any one of claims 5-15, wherein ni is 0.

17. The proximity-inducing compound according to any one of claims 5-16, wherein R 2 It is H; and R 3 It is C 1-4 alkyl.

18. The proximity-inducing compound according to any one of claims 5-17, wherein G 1 It is thiophene, which is substituted twice with a methyl group; G 2 It is a triazole, which is substituted once with a methyl group; X is chlorine; and R 3 It is an ethyl group.

19. The proximity-inducing compound of claim 1, wherein the proximity-inducing compound has the formula (IVa): (IVa) Among them B 1 L 3 and B 2 Independently as defined in any of the preceding claims.

20. The proximity-inducing compound of claim 1, wherein the proximity-inducing compound has the formula (IVb): (IVb).

21. A method for inducing proximity between two biomolecules, the method comprising: The first and second biomolecules are brought into contact with the proximity-inducing compound of any of the preceding claims to form a ternary complex, thereby inducing proximity between the two biomolecules so that they can interact. And optional: Detection of ternary complex formation; and / or Detecting the interaction or lack thereof between two biomolecules; in: The first biomolecule contains a hole-modified Brd bromine domain; and The second biomolecule contains FKBP.

22. The method of claim 21, wherein the detection of the formation and / or the detection of the interaction or the lack thereof is performed by one or more methods selected from immunoprecipitation, Western blotting, and mass spectrometry.

23. The method of claim 21 or 22, wherein the interaction is a post-translational modification.

24. The method of any one of claims 21 to 23, wherein: The first biomolecule is a tagged protein comprising a hole-modified Brd bromine domain as defined in claim 2; and The second biomolecule is a tagged protein that contains FKBP as defined in claim 3.

25. The method of claim 24, wherein the tagged protein comprising the hole-modified Brd bromine domain is a phosphatase.

Images