Application of long non-coding RNA IIRF in regulating the replication of subgroup J avian leukosis virus

Abstract

The application discloses application of long-chain non-coding RNA IIRF in regulation of subgroup J avian leukemia virus (ALV-J) replication and belongs to the technical field of molecular biology and virology. The application finds for the first time that long-chain non-coding RNA IIRF (lncIIRF) is involved in regulation of ALV-J replication, overexpression of lncIIRF can inhibit ALV-J replication, and down-regulation of lncIIRF expression can promote ALV-J replication. Therefore, lncIIRF as a target can be used for preparation of a medicine for preventing and treating ALV-J infection and construction of an ALV-J in-vitro replication model, and has important significance for prevention and control of ALV-J.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and virology, specifically to the application of a long non-coding RNA IIRF in regulating the replication of subgroup J avian leukosis virus. Background Technology

[0002] Avian leukosis virus subgroup J (ALV-J) is an enveloped retrovirus. After infecting chicken cells, ALV-J undergoes a series of processes including viral adsorption and entry, reverse transcription, provirus integration, viral gene transcription and translation, and progeny virus assembly and release. ALV-J infection can cause neoplastic diseases such as myeloma and hemangioma, and can lead to decreased growth performance, immunosuppression, reduced egg production, and increased mortality in infected chickens, causing significant economic losses to the poultry industry. Because ALV-J has both vertical and horizontal transmission capabilities, and may lack obvious clinical symptoms in the early stages of infection, current control measures mainly rely on population purification, pathogen detection, and biosafety management, and still lack effective host molecular targets that can directly and stably intervene in the viral replication process.

[0003] Long non-coding RNAs (lncRNAs) are a class of non-coding RNA molecules longer than 200 nucleotides, transcribed by RNA polymerase II. While they do not encode proteins, they participate in various important biological processes through epigenetic regulation, gene expression regulation, and signaling pathway mediation. Although a few host lncRNAs have been shown to inhibit ALV-J replication, such as chicken-derived long non-coding RNAs lnc-LTR5B and lnc-ALVE1-AS1, the chicken genome contains numerous tissue- and cell-specific lncRNAs. Currently, functionally validated anti-ALV-J host lncRNAs are still relatively few, and further research is needed to develop new long non-coding RNAs that participate in regulating ALV-J replication. Summary of the Invention

[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide an application of long non-coding RNA IIRF in regulating the replication of ALV-J subgroup avian leukosis virus. This invention is the first to discover that long non-coding RNA IIRF (lncIIRF) participates in the regulation of ALV-J replication, and can be used to prepare drugs for the prevention and treatment of ALV-J infection and to construct an in vitro ALV-J replication model, which is of great significance for the prevention and control of ALV-J.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides the use of a substance overexpressing a long non-coding RNA IIRF in the preparation of a medicament for preventing and treating ALV-J infection; the nucleotide sequence of said long non-coding RNA IIRF is shown in SEQ ID NO.1; specifically as follows: .

[0006] In the above applications, the substance that overexpresses long non-coding RNA IIRF is any one of the following C1)-C4): C1) Expression cassettes containing long non-coding RNA IIRFs; C2) Gene delivery vectors containing long non-coding RNA IIRFs, or gene delivery vectors containing the expression cassette described in C1); C3) Nucleic acid delivery system that encapsulates long non-coding RNA IIRFs; C4) Functionalized modified formulations loaded with long non-coding RNA IIRF.

[0007] Preferably, the gene delivery vector is a lentiviral vector, an adeno-associated virus vector (AAV vector), or a plasmid vector.

[0008] Preferably, the nucleic acid delivery system is a cationic liposome, polymer nanoparticle, or exosome that encapsulates long non-coding RNA IIRF.

[0009] Preferably, the functionalized modified formulation is a delivery system formed by loading long non-coding RNA IIRF onto a nanocarrier modified with cell-penetrating peptides (such as TAT ​​peptide), which is used to improve intracellular delivery efficiency and targeting.

[0010] In the above applications, the drug prevents and treats ALV-J infection by inhibiting ALV-J replication.

[0011] A second aspect of the present invention provides the use of a substance that downregulates the expression of long non-coding RNA IIRF in constructing an ALV-J in vitro replication model; the nucleotide sequence of said long non-coding RNA IIRF is shown in SEQ ID NO.1.

[0012] In the above applications, the substances that downregulate the expression of long non-coding RNA IIRF are selected from one or more of microRNA molecules (miRNA), small interfering RNA (siRNA), or artificial microRNA (amiRNA).

[0013] Furthermore, the substance that downregulates the expression of long non-coding RNA IIRF is siRNA, and the siRNA is any one of the following (1)-(3): (1) siRNA-1, the nucleotide sequence of which is shown in SEQ ID NO.2; (2) siRNA-2, the nucleotide sequence of which is shown in SEQ ID NO.3; (3) siRNA-3, whose nucleotide sequence is shown in SEQ ID NO.4.

[0014] The beneficial effects of this invention are: (1) This invention is the first to confirm the regulatory relationship between long non-coding RNA IIRF and ALV-J infection replication, and to clarify the anti-ALV-J function of long non-coding RNA IIRF: ALV-J infection can induce host long non-coding RNA IIRF expression upregulation. Overexpression of long non-coding RNA IIRF can significantly inhibit ALV-J replication at the RNA and protein levels. In vivo experiments also confirmed that overexpression of long non-coding RNA IIRF can significantly alleviate tissue lesions and growth inhibition caused by ALV-J infection, and reduce viral load and viral shedding levels.

[0015] (2) This invention provides a novel host target for ALV-J. Long non-coding RNA IIRF can be used as a target for drug development to prepare drugs against ALV-J infection, providing a new strategy and theoretical basis for the prevention and control of ALV-J in poultry. At the same time, downregulation of long non-coding RNA IIRF can promote viral replication and can be used to construct an efficient ALV-J infection model, providing a powerful tool for the study of viral pathogenesis and the screening of antiviral drugs. Attached Figure Description

[0016] Figure 1 The figure shows the results of qRT-PCR detection of the relative expression level of lncIIRF in CEF cells infected with ALV-J at different times (0 h, 24 h, 48 h, 72 h, 96 h).

[0017] Figure 2 The image shows the subcellular co-localization results of lncIIRF and ALV-J after ALV-J infection of DF-1 cells by RNAFISH combined with immunofluorescence detection.

[0018] Figure 3 The figure shows the results of qRT-PCR detection of the relative level of ALV-J mRNA after lncIIRF overexpression.

[0019] Figure 4 The figure shows the results of Western blot analysis of ALV-J protein expression levels after lncIIRF overexpression.

[0020] Figure 5 The figure shows the results of qRT-PCR detection of the relative level of ALV-J mRNA after interfering with lncIIRF expression.

[0021] Figure 6 The figure shows the results of Western blot analysis of ALV-J protein expression levels after interfering with lncIIRF expression.

[0022] Figure 7 This is a graph showing the weight changes of chickens at different ages after ALV-J infection.

[0023] Figure 8 This is a graph showing the statistical results of the indices of immune organs (thymus, spleen, and bursa of Fabricius) in chickens after ALV-J infection.

[0024] Figure 9 The results of in vivo imaging system detection of the main organs in which lncIIRF lentivirus is distributed in chickens are shown in the figure.

[0025] Figure 10 The results of ALV-J p27 antigen ELISA detection of viral shedding levels in chicken anal swabs are shown in the figure.

[0026] Figure 11 The figure shows the results of qRT-PCR detection of ALV-J viral load in thymus tissue.

[0027] Figure 12 The image shows the results of immunofluorescence detection of ALV-J protein expression in thymus tissue from frozen sections.

[0028] Figure 13 Image showing the pathological histological changes of thymus tissue observed after HE staining of paraffin sections. Detailed Implementation

[0029] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0030] To enable those skilled in the art to better understand the technical solutions of this application, the technical solutions of this application will be described in detail below with reference to specific embodiments. Unless otherwise specified, experimental conditions not detailed in the embodiments are generally based on conventional conditions or conditions recommended by the reagent company; reagents, consumables, etc., used in the following embodiments can be obtained commercially unless otherwise specified.

[0031] Example 1: Effects of ALV-J infection on lncIIRF expression and subcellular localization 1. Test method: (1) Preparation of chicken embryo fibroblasts (CEF): Select 10-day-old specific pathogen-free (SPF) chicken embryos. After sterilizing the surface of the chicken embryos with povidone-iodine and 75% ethanol, the chicken embryo trunk tissue (removing the head, limbs and internal organs) was aseptically dissected. After washing with sterile PBS, the tissue was cut into 1 mm pieces. 3Tissue blocks were collected from approximately 1000 cells. 0.25% trypsin-EDTA solution was added, and the cells were digested in a 37°C water bath for 15-20 min, with gentle shaking several times during digestion. After digestion, DMEM medium containing 10% fetal bovine serum (FBS) was added to neutralize the trypsin activity. The cells were then filtered through a 70 μL cell strainer and centrifuged at 1000 rpm for 5 min to collect the cells. The cells were resuspended in DMEM complete medium containing 10% FBS and 1% penicillin-streptomycin antibiotics, seeded into cell culture flasks, and cultured in a 37°C, 5% CO2 incubator. After 24 h, the medium was replaced with fresh medium to remove unattached tissue fragments and dead cells. When the cell confluence reached 80%-90%, the cells were passaged for expansion to obtain CEF cells.

[0032] (2) ALV-J inoculation: Take CEF cells in good growth condition, digest them, and then use 1×10⁻⁶ cells. 5 Cells were seeded at a density of 1 cell / well in culture plates. When the cell confluence reached 70%, ALV-J strain NX0101 (GenBank accession number: DQ115805.1) was inoculated, and a blank control group without virus inoculation was set up. After 1.5 h of virus adsorption, the virus solution was discarded and replaced with DMEM maintenance medium containing 1% FBS, and the cells were incubated at 37 ℃ in a 5% CO2 incubator. Cell samples were collected at 24 h, 48 h, 72 h, and 96 h after inoculation for subsequent RNA extraction and expression detection.

[0033] (3) qRT-PCR detection of lncIIRF expression level: Total RNA was extracted from cells in each group using TRNzol reagent. Reverse transcription of lncRNA was performed using the lnRcute lncRNA cDNA first-strand synthesis kit (purchased from Tiangen Biotech (Beijing) Co., Ltd.). Using the cDNA obtained from reverse transcription as a template, qRT-PCR was performed using the lnRcute lncRNA quantitative PCR kit (purchased from Tiangen Biotech (Beijing) Co., Ltd.) to detect the relative expression level of lncIIRF. The reaction system and procedure were strictly configured according to the kit instructions. Three technical replicates were set up for each sample. The chicken GAPDH gene was used as an internal reference gene, and the 2^-ΔΔCT method was used to calculate the relative expression level of lncIIRF at different infection time points.

[0034] The primer sequences for qRT-PCR detection are as follows: qRT-GAPDH-F:GAACATCATCCCAGCGTCCA; (SEQ ID NO.5) qRT-GAPDH-R: CGGCAGGTCAGGTCAACAAC. (SEQ ID NO.6) qRT-lncIIRF-F:ACTTCGGACTCCAAAACTCA; (SEQ ID NO.7) qRT-lncIIRF-R:TCATGCTTGATATGGGCTGT. (SEQ ID NO.8) (4) RNA FISH combined with immunofluorescence detection of subcellular co-localization of lncIIRF and ALV-J: Cells cultured on cell slides were washed three times with PBS, fixed with 4% paraformaldehyde at room temperature for 15 min, the fixative was discarded, and the cells were washed three times with PBS for 5 min each time. After treatment with 0.1% Triton-X-100 for 10 min, the cells were washed three times with PBS. 2×SSC was added, and the cells were incubated at 37 °C for 30 min. After discarding the fixative, lncIIRF probe mixture (probe sequences are shown in SEQ ID NO.9: CAGAACATGAAAACCTCTGAGTGAG; SEQ ID NO.10: TGCACTTTCATGCTTGATATGGGCTG; SEQ ID NO.11: AAGTCAGAAATCCCTTGAGGAGATG) was added, and hybridization was performed overnight at 37 °C. After discarding the probe, the cells were washed with 0.1% Tween-20 for 5 min, followed by washing with 2×SSC and 1×SSC for 5 min each. After RNA FISH, immunofluorescence detection was performed: the cells were blocked with 5% BSA at room temperature for 1 h. Add ALV-J gp85 primary antibody, incubate overnight at 4 ℃, wash 3 times with TBST, add Cy3 fluorescent secondary antibody, and incubate at room temperature for 45 min. Wash 3 times with PBS, add DAPI solution and incubate in the dark for 5 min, wash 3 times with 1×PBS, and mount with anti-quenching mounting medium. Observe and acquire images using laser confocal fluorescence microscopy.

[0035] 2. Test Results: The results of lncIIRF expression level measurement after ALV-J infection are as follows: Figure 1 As shown, the results indicate that ALV-J infection can stably induce upregulation of lncIIRF expression in CEF cells.

[0036] Subcellular colocalization results as follows Figure 2 As shown, the results indicate that lncIIRF and ALV-J are co-localized intracellularly, suggesting that lncIIRF is involved in the ALV-J infection process.

[0037] Example 2: Effects of in vitro regulation of lncIIRF expression on ALV-J replication 1. Test method: To verify the regulatory role of lncIIRF in ALV-J replication, this embodiment constructed a recombinant plasmid lncIIRF-pcDNA3.1 overexpressing lncIIRF using pcDNA3.1 as the backbone; simultaneously, three interfering siRNAs targeting lncIIRF and a negative control si-ctrl were designed, with the sequences as follows: siRNA-1: GAGCUGAGAAGCAAAUUCUTT; (SEQ ID NO.2) siRNA-2: CAGCUACCCUUCACUUAAATT; (SEQ ID NO.3) siRNA-3: GCCCAUAUCAAGCAUGAAATT; (SEQ ID NO.4) si-ctrl:UUCUCCGAACGUGUCACGUTT. (SEQ ID NO.12) Note: According to WIPO ST.26, the "U" in the RNA sequence is represented by "T" in the sequence listing.

[0038] CEF cells were transfected with the overexpression plasmid, three targeting siRNAs, and the negative control si-ctrl, and then ALV-J was seeded. The replication level of ALV-J was detected at the mRNA and protein levels by qRT-PCR and Western blot, respectively.

[0039] Specifically as follows: (1) Cell transfection: Select CEF cells in the logarithmic growth phase and good condition, seed them into culture plates at the corresponding density, and transfect them when the cell confluence reaches 70%. Dilute an appropriate amount of overexpression plasmid and P3000 reagent with Opti-MEM, and separately dilute Lipofectamine 3000 with Opti-MEM; Dilute appropriate amounts of siRNA and Lipofectamine 3000 separately with Opti-MEM.

[0040] Gently mix the two solutions and incubate at room temperature for 10-15 min to form the transfection complex. Aspirate the original culture medium from the cells, add fresh serum-free Opti-MEM, and add the transfection complex dropwise evenly to the wells. Gently shake the culture plate to distribute the complex evenly. Incubate at 37 ℃ and 5% CO2 for 12 h, then replace with complete culture medium and continue culturing.

[0041] (2) ALV-J infection: The ALV-J NX0101 strain virus solution was thawed on ice. After 12 h of cell transfection, ALV-J cells were inoculated with a multiplicity of infection (MOI) of 1. After 1.5 h of virus adsorption, the maintenance medium was replaced, and the cells were cultured for another 48 h before being collected for total RNA and total protein extraction. (3) qRT-PCR detection of ALV-J viral RNA levels: Total RNA was extracted from cells in each group using TRNzol reagent. Reverse transcription was performed using the Evo M-MLV reverse transcription premixed kit (purchased from Hunan Aikerui Biotechnology Co., Ltd.), with 1 μg of total RNA added to every 20 μL of the system. The gDNA removal program was 42 ℃ for 2 min, and the reverse transcription program was 37 ℃ for 15 min, followed by 85 ℃ for 5 s. Using the cDNA obtained from reverse transcription as a template, qPCR was performed using the SYBR Green Pro Taq HS premixed qPCR kit (purchased from Hunan Aikerui Biotechnology Co., Ltd.) to detect ALV-J mRNA levels. The reaction system and program were strictly performed according to the kit instructions. Three technical replicates were set for each sample, with chicken GAPDH as an internal control. The relative expression level of viral genes was calculated using the 2-ΔΔCT method. Independent samples t-tests were used for statistical analysis of differences between groups, with P < 0.05 considered statistically significant. The primer sequences for detecting ALV-J gp85 are as follows: ALV-J gp85-F: TGCGTGCGTGGTTATTATTTC; (SEQ ID NO.13) ALV-J gp85-R:AATGGTGAGGTCGCTGACTGT. (SEQ ID NO.14) (4) Western blot detection of ALV-J protein levels: The expression level of ALV-J envelope protein gp85 in cells of each group was detected by Western blot, with β-actin selected as the internal control gene. Cells were washed three times with pre-chilled PBS, and PMSF was added to RIPA lysis buffer to a final concentration of 1 mM. Cells were lysed on ice with lysis buffer for about 5 min. After thorough lysis by repeated pipetting, the cells were collected into EP tubes, centrifuged at 12000×g for 5 min at 4°C, and the supernatant was collected. Protein concentration was measured by BCA method. Take an appropriate amount of protein sample, add 5× SDS protein loading buffer, mix well, and denature in a 100 ℃ water bath for 5 min; prepare a separating gel and a stacking gel of appropriate concentrations, add sufficient 1× electrophoresis buffer to the electrophoresis tank, add 20 μg of protein sample to each well, add 10 μL of protein marker, turn on the power, and electrophores at 80 V for 30 min at the stacking gel. When the dye enters the boundary between the separating gel and the stacking gel, adjust the voltage to 110 V and electrophores for about 1.5 h, until the bromophenol blue indicator reaches the bottom of the separating gel, then turn off the power; after electrophoresis, pry open the glass plate, remove the gel, cut an appropriate gel piece according to the size of the target protein, cut the PVDF membrane to the same size as the gel, activate it in methanol for about 1 min, and then soak it in electroporation buffer for about 5 minutes. For the first 30 minutes, install the transfer apparatus using the sandwich method: negative electrode clamp - sponge pad - three layers of filter paper - gel - PVDF membrane - three layers of filter paper - sponge pad - positive electrode clamp, ensuring there are no air bubbles between the gel and the PVDF membrane. Place the transfer apparatus in the transfer tank and use rapid transfer buffer (purchased from Xinsaimei) at a constant current of 400 mA for 30 minutes to transfer the protein onto the PVDF membrane. After the transfer, remove the PVDF membrane, wash with TBST buffer for 5 minutes, and block with TBST solution containing 5% skim milk powder at 37 °C for 2 hours. After blocking, wash three times with TBST buffer for 10 minutes each time, incubate overnight with specific monoclonal antibody at 4 °C, wash three times with TBST buffer for 10 minutes each time, add HRP-labeled goat anti-mouse IgG secondary antibody, incubate at 37 °C for 1 hour, and wash three times with TBST buffer. Prepare an appropriate amount of developing solution (A:B = 1:1) under light-protected conditions, cover the entire membrane with the developing solution, and detect the protein signal in an ECL chemiluminescence imaging system.

[0042] 2. Test Results: Compared with the empty pcDNA3.1 vector group, transfection of the overexpression plasmid into CEF cells significantly inhibited ALV-J replication at the RNA level. Figure 3 ), and also significantly inhibited ALV-J replication at the protein level ( Figure 4 ).

[0043] Compared with the negative control group transfected with siRNA, transfection of lncIIRF-siRNA in CEF cells significantly promoted ALV-J replication at the RNA level. Figure 5 ), and also significantly promoted ALV-J replication at the protein level ( Figure 6 ).

[0044] Example 3: Effect of in vivo overexpression of lncIIRF on ALV-J replication 1. Test method: To verify the regulatory effect of lncIIRF on ALV-J replication in vivo, this embodiment commissioned Gemma Corporation to construct a lentiviral overexpression vector carrying a GFP tag. LV5 (EF-1a promoter, carrying GFP and Puromycin resistance) was selected as the lentiviral backbone vector, which was injected into SPF chicken embryos via yolk sac injection, followed by inoculation with ALV-J. The in vivo antiviral effect was evaluated by in vivo imaging, tissue viral load detection, and pathological observation.

[0045] Specifically as follows: (1) Construction of in vivo overexpression system and viral infection: Three-year-old SPF chicken embryos were randomly divided into 5 groups. All injection systems were supplemented with a final concentration of 20 μg / mL Polybrene to ensure single-variable control and improve viral infection efficiency. The yolk sac injections and subsequent treatments for each group were as follows: PBS+NC group: injected with an equal volume of sterile PBS, without ALV-J inoculation; LV-LncIIRF+NC group: injected with 5×10... 3 TU / embryo lncIIRF overexpressing lentivirus, without ALV-J inoculation; PBS+ALV-J group: injected with an equal volume of sterile PBS, and inoculated into the allantoic cavity of 10 embryos with ALV-J NX0101 strain (10 3.05 TCID50 / embryo); EV-Ctrl+ALV-J group: injection of 5×10 3 TU / embryo empty lentivirus EV-Ctrl, inoculated with the same dose of ALV-J at embryonic stage 10; LV-LncIIRF+ALV-J group: injected with 5×10 3 TU / embryos overexpressed lentivirus in lncIIRF and were inoculated with the same dose of ALV-J at 10 embryonic stages. After injection, the chicken embryos were sealed and placed in an incubator at 37.8℃ and 60% relative humidity for continuous incubation. The eggs were candled daily and dead embryos were removed. After hatching, the chicks were weighed at 1 day, 7 days, and 14 days of age, and cloacal swabs and organ tissue samples were collected simultaneously for subsequent testing.

[0046] (2) In vivo imaging and tissue distribution detection: The fluorescence distribution of GFP carried by lentivirus was observed using a small animal in vivo imaging system, and the distribution of the lncIIRF overexpression vector in various organs of chickens was analyzed. After sacrifice, major organs such as the thymus, spleen, and bursa of Fabricius were isolated, and their fluorescence distribution was observed.

[0047] (3) Detection of viral load in tissues: Thymus cells from each group of chickens were collected, and total RNA was extracted according to the method in Example 2. The ALV-J mRNA level in the tissues was detected by qRT-PCR to evaluate the viral load in the tissues.

[0048] (4) Immunofluorescence detection of viral protein levels in tissues: Thymus tissue was used to prepare frozen sections. After thawing at room temperature, the sections were fixed with 4% paraformaldehyde for 15 min. The fixative was removed by thorough washing with PBS. Permeabilization buffer containing 0.2% Triton X-100 was added, and the sections were incubated at room temperature for 15 min for permeabilization. After washing with PBS, blocking buffer was added, and the sections were blocked at room temperature for 1.5 h to block non-specific binding sites. The blocking buffer was discarded, and primary antibody against ALV-J gp85 was added. The sections were then incubated overnight at 4 °C in the dark. The next day, unbound primary antibody was removed by thorough washing with PBS, and Cy3-labeled goat anti-mouse secondary antibody was added. The sections were incubated at room temperature in the dark for 1 h. After secondary antibody incubation, the sections were thoroughly washed with PBS, mounted with anti-fluorescence quenching mounting medium containing DAPI, and covered with a coverslip and gently pressed to remove air bubbles. The fluorescence signal in the sections was observed using a laser confocal microscope.

[0049] (5) Pathological and histological observation: Thymus tissue was collected from each group of chickens and fixed with 4% paraformaldehyde. After trimming, gradient dehydration, clearing, paraffin embedding, and embedding, paraffin tissue blocks were prepared. After trimming the paraffin blocks, serial sections were prepared with a section thickness of 4 μm. After spreading, retrieving, and drying, hematoxylin-eosin (HE) staining was performed: the sections were dewaxed with xylene, hydrated with gradient ethanol, and rinsed with distilled water. The cell nuclei were stained with hematoxylin solution for 5 min. Differentiation was performed with hydrochloric acid alcohol, followed by blue staining with running water. The cytoplasm and stroma were stained with eosin solution for 30 s. After gradient ethanol dehydration and xylene clearing, the sections were mounted with neutral resin and observed under an optical microscope for histopathological changes.

[0050] (6) Detection of viral shedding level using p27 antigen ELISA: The collected anal swabs were diluted with sample diluent, centrifuged after thorough shaking, and the supernatant was collected. The avian leukosis virus p27 antigen ELISA kit (purchased from Tianzhitai Biotechnology Research Institute Co., Ltd.) was used for detection, strictly following the kit instructions: The ELISA plate was set up with negative control wells, positive control wells, and sample wells. The corresponding sample was added to each well, and the plate was sealed and incubated at room temperature for 1 h. The plate was washed 3 times, dried, and then enzyme-labeled antibody was added, incubating at room temperature for 1 h. The plate was washed 3 times again, and chromogenic solutions A and B were added to each well, incubating at room temperature in the dark for 30 min. The reaction was terminated by adding stop solution, and the OD value of each well at 450 nm was read using an ELISA reader. The S / P value was calculated, and the positive or negative result of the sample was determined according to the kit's criteria to evaluate the viral shedding level in the chickens.

[0051] 2. Test Results: The results showed that in vivo imaging verified that the lncIIRF lentiviral vector could be successfully delivered to the thymus, a major target organ in chickens (e.g., ...). Figure 9 As shown); in vivo overexpression of lncIIRF can effectively inhibit ALV-J replication and significantly reduce the viral shedding level in chickens (e.g. Figure 10 As shown), reduce viral load in thymus tissue (e.g. Figure 11 As shown); immunofluorescence results showed a significant decrease in the fluorescence signal of ALV-J viral protein in thymus tissue, suggesting a downregulation of protein expression levels (e.g. Figure 12 As shown); it can also reduce viral damage to immune organs (such as...). Figure 8 (as shown), alleviate thymic tissue pathological and histological changes (such as...) Figure 13 As shown), ultimately improving growth inhibition caused by ALV-J infection (e.g. Figure 7 As shown in the figure, it exerts a clear antiviral protective effect in vivo.

[0052] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. The application of a substance overexpressing long non-coding RNA IIRF in the preparation of drugs for preventing and treating ALV-J infection, characterized in that, The nucleotide sequence of the long non-coding RNA IIRF is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, Substances that overexpress long non-coding RNA IIRF are any of the following C1)-C4): C1) Expression cassettes containing long non-coding RNA IIRFs; C2) Gene delivery vectors containing long non-coding RNA IIRFs, or gene delivery vectors containing the expression cassette described in C1); C3) Nucleic acid delivery system that encapsulates long non-coding RNA IIRFs; C4) Functionalized modified formulations loaded with long non-coding RNA IIRF.

3. The application according to claim 2, characterized in that, The gene delivery vector is a lentiviral vector, an adeno-associated virus vector, or a plasmid vector.

4. The application according to claim 2, characterized in that, The nucleic acid delivery system is a cationic liposome, polymer nanoparticle, or exosome that encapsulates long-chain non-coding RNA IIRF.

5. The application according to claim 1, characterized in that, The drug prevents and treats ALV-J infection by inhibiting ALV-J replication.

6. The application of substances that downregulate the expression of long non-coding RNA IIRF in constructing an ALV-J in vitro replication model, characterized in that... The nucleotide sequence of the long non-coding RNA IIRF is shown in SEQ ID NO.

1.

7. The application according to claim 6, characterized in that, The substance that downregulates the expression of long noncoding RNA IIRF is selected from one or more of miRNA, siRNA, or amiRNA.

8. The application according to claim 7, characterized in that, The substance that downregulates the expression of long non-coding RNA IIRF is siRNA, and the siRNA is any one of the following (1)-(3): (1) siRNA-1, the nucleotide sequence of which is shown in SEQ ID NO.2; (2) siRNA-2, the nucleotide sequence of which is shown in SEQ ID NO.3; (3) siRNA-3, whose nucleotide sequence is shown in SEQ ID NO.4.

Images