Use of miR-4692 inhibitors

Abstract

The application discloses an application of a miR-4692 inhibitor and belongs to the technical field of biological medicines. In the research on the pathogenesis of epilepsy, it is found that the expression of miR-4692 in the plasma of patients with epilepsy is abnormally increased, and it is found that the miR-4692 inhibitor given 72 hours before the construction of a tree shrew epilepsy model can effectively reduce the seizure level, convulsion rate and mortality rate of the epilepsy tree shrew and reduce the brain pathological injury of the epilepsy tree shrew. The miR-4692 inhibitor disclosed by the application is used for preparing a medicine for treating epilepsy, and the nucleotide sequence is as follows: AUCUGAUACCCACACUGCCUGA. The miR-4692 inhibitor disclosed by the application can well reduce the convulsion rate and mortality rate of the epilepsy tree shrew, can effectively prolong the clonic latent period and convulsion latent period of the epilepsy tree shrew, can shorten the convulsion duration of the epilepsy tree shrew, can effectively reduce the seizure level of the epilepsy tree shrew, and can effectively reduce the neuron injury of the tree shrew epilepsy when the miR-4692 inhibitor is given in advance.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of a miR-4692 inhibitor. Background Technology

[0002] Epilepsy is a common chronic neurological disorder characterized by recurrent, unpredictable seizures. Seizures result from abnormally excessive neuronal discharge in the brain, and clinical manifestations are primarily recurrent convulsions and altered consciousness. Due to its high disability rate, recurrent seizures, and long course, it seriously affects the physical and mental health of patients and imposes an economic burden on society.

[0003] Currently, the diagnosis of epilepsy mainly relies on detailed medical history and clinical auxiliary examinations. However, the information provided by patients or their families is often insufficient. Among auxiliary examinations, apart from long-term ambulatory electroencephalography (EEG) in epilepsy monitoring units, the detection rate of other types of EEG is limited. Many epilepsy patients have negative brain imaging results, leading to misdiagnosis and missed diagnosis, resulting in delayed treatment and further aggravation of the patient's condition. Currently, most epilepsy patients can effectively control their condition with regular antiepileptic drug treatment, but some patients cannot achieve complete control. One of the main factors is the complexity and heterogeneity of the etiology of epilepsy. With the emergence of the concept of precision medicine in recent years, more and more scholars have begun to focus on how to achieve accurate diagnosis and targeted treatment of the disease. Therefore, identifying effective biomarkers will help in the rapid and accurate diagnosis and classification of epilepsy, and at the same time provide a theoretical basis for the development of targeted drug treatments for epilepsy. Summary of the Invention

[0004] The purpose of this invention is to identify miRNA biomarkers related to epilepsy treatment. In their research on the pathogenesis of epilepsy, the inventors discovered that miR-4692 expression is abnormally elevated in the plasma of epilepsy patients. The study found that administering a miR-4692 inhibitor 72 hours before establishing a tree shrew epilepsy model effectively reduced the seizure severity, seizure rate, and mortality rate in epileptic tree shrews, and alleviated brain pathological damage.

[0005] The miR-4692 inhibitor described in this invention is used to prepare a drug for treating epilepsy, and its nucleotide sequence is as follows: AUCUGAUACCCACACUGCCUGA.

[0006] The beneficial effects of this invention are:

[0007] The miR-4692 inhibitor described in this invention can effectively reduce the seizure rate and mortality rate of epileptic tree shrews, effectively prolong the clonic latency and seizure latency of epileptic tree shrews, shorten the duration of seizures in epileptic tree shrews, effectively reduce the seizure severity of epileptic tree shrews, and pre-administration of miR-4692 inhibitor can effectively reduce neuronal damage in tree shrew epilepsy. Attached Figure Description

[0008] Figure 1 The expression status of miR-4692 in plasma ( ## (This indicates that compared with the control group, p < 0.01).

[0009] Figure 2 Comparison of HE staining changes in hippocampal tissue of tree shrews (200×);

[0010] Figure 3 Comparison of immunofluorescence staining of NeuN-positive neurons in the hippocampus region of a tree shrew (400×).

[0011] Figure 4 A comparative diagram showing changes in NeuN expression in the hippocampus region of tree shrews. Detailed Implementation

[0012] The present invention will be further described below with reference to embodiments, but this is not intended to limit the present invention in any way. Any modifications or substitutions made based on the teachings of the present invention shall fall within the protection scope of the present invention.

[0013] 1. Expression characteristics and clinical significance of miR-4692 in patients with epilepsy

[0014] 1.1 Main reagents and consumables

[0015]

[0016] 1.2 Main Instruments

[0017]

[0018] 1.3 Experimental Methods

[0019] 1.3.1 Sample Collection

[0020] Ten plasma samples were collected from epilepsy patients and 10 from healthy volunteers (control group) as study subjects. Plasma sample preparation method: Approximately 4 mL of fasting peripheral venous blood was collected from the subjects. After collection, the plasma samples were stored in sodium citrate anticoagulant tubes, centrifuged (3000 rpm, 4℃, 10 min), and the plasma was immediately stored in a -80℃ freezer for later use.

[0021] 1.3.2 Primer Design and Synthesis

[0022] The corresponding sequence was obtained from the NCBI database, and primers for miR-4692 were designed. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd. The primer sequence is as follows: miR-4692 Forward: 5'-TCAGGCAGTGTGGGTATCAGAT-3'.

[0023] 1.3.3 miRNA extraction

[0024] Take 200 µL of plasma sample and extract miRNA from the plasma sample using the miRcute miRNA extraction and isolation kit.

[0025] 1.3.4 miRNA reverse transcription

[0026] The reverse transcription system was performed according to the miRNA-cDNA first-strand synthesis kit instructions.

[0027]

[0028] Bring the total volume of the three reagents to 20 µL, gently shake, centrifuge for 3-5 s to mix the reactants, incubate at 42°C for 60 min, then at 95°C for 3 min to obtain the first strand of reverse-transcribed cDNA. Immediately place on ice or store at -20°C.

[0029] 1.3.5 qPCR detection of target gene expression

[0030] Following the instructions of the miRNA fluorescence quantitative detection kit, add the following reagents to each well of a 96-well PCR plate in the order of sample loading:

[0031]

[0032] The above system was thoroughly mixed, briefly centrifuged, and then placed in a LightCycler 96 instrument for detection. Amplification signals were collected. The following were the quantitative PCR conditions: pre-denaturation 95℃, 600s; 95℃: 5s, 60℃: 30s, 72℃: 30s, 45 cycles; melting curve analysis: 95℃: 15s; 60℃: 30s; 95℃: 1s. U6 was selected as an internal control. For the analysis of relative expression levels of the target gene, 2... -△△Ct The method is used for calculation.

[0033] 1.3.6 Statistical Analysis

[0034] The analysis and comparison were performed using GraphPad Prism 9.0.0. The two independent samples t-test was used to compare between groups, and P < 0.05 was considered statistically significant.

[0035] 1.4 Experimental Results

[0036] The results are as follows Figure 1 As shown, compared with healthy volunteers (control group), the expression level of miR-4692 in the plasma of epilepsy patients was significantly increased (p<0.01).

[0037] 2. Neuroprotective effect of miR-4692 inhibitors on tree shrew epilepsy

[0038] 2.1 Laboratory Animals

[0039] Fifteen Class CL male Burmese tree shrews, weighing 120-150 g, were purchased from the Institute of Medical Biology, Chinese Academy of Medical Sciences [SCXK(Yunnan)K2023-0003] and housed in the general-grade animal facility of Yunnan Luoyu Biotechnology Co., Ltd. [SYXK(Yunnan)K2021-0003]. They were housed in stainless steel cages at a room temperature of (24±2)℃, relative humidity of (50±5)%, and a light / dark cycle of 12h / 12h.

[0040] 2.2 Main Reagents

[0041]

[0042] 2.3 Main Instruments

[0043]

[0044] 2.4 Preparation of drugs and reagents

[0045] Phrixotoxin-1 was prepared by dissolving Phrixotoxin-1 in physiological saline to prepare a solution with a concentration of 10 μg / mL and a pH of 7.4.

[0046] 2.5 Experimental Methods

[0047] 2.5.1 Animal Model Making

[0048] Experimental Groups:

[0049] ① Control group: 2 μL of 0.9% saline was injected into the hippocampus via stereotactic brain imaging, and an equal volume of 0.9% saline was injected intraperitoneally 72 hours later;

[0050] ② Model group: 2 μL of 0.9% saline was injected into the hippocampus via stereotactic brain imaging, followed by an intraperitoneal injection of 4 μg / kg Phrixotoxin-1 72 h later to establish a tree shrew epilepsy model;

[0051] ③ miR-4692 inhibitor group: 2 μL of 1.0 nmol miR-4692 inhibitor was injected into the hippocampus via stereotactic injection, followed by an intraperitoneal injection of 4 μg / kg Phrixotoxin-1 72 h later to establish a tree shrew epilepsy model. The self-designed miR-4692 inhibitor sequence is as follows: AUCUGAUACCCACACUGCCUGA, synthesized by Shanghai Sangon Biotech Co., Ltd.

[0052] 2.5.2 Stereotactic Injection of the Brain

[0053] (1) Fixing the tree shrew: The tree shrew was anesthetized by intraperitoneal injection of 3% sodium pentobarbital at 2 μL / g body weight. After complete anesthesia, the hair on the cranial face of the tree shrew was removed with animal clippers and fixed on the stereotaxic device. The ear rod was inserted into the tree shrew's ear canal and the left and right ear rods were balanced so that the line connecting the two ears of the tree shrew was in the same straight line as the ear rod. The tree shrew's incisors were pried open with tweezers and the upper incisors were locked in the hole of the adapter. The nose rod locking screw was pressed down and the height of the incisor clamp was adjusted up and down, and the position of the adapter was adjusted back and forth to keep the cranial face of the tree shrew horizontal. The screw was locked so that the tree shrew's head could not move. According to the tree shrew's body size, the tree shrew's body was raised with foam on the base of the stereotaxic device so that the head and body were kept horizontal to prevent the tree shrew's breathing from being blocked.

[0054] (2) Micro-injection pump parameter settings: Turn on the power switch of the micro-injection pump, set the operation mode to first draw and then infuse, and set the drawing parameters: the volume of liquid drawn, the drawing time is 0.5 min; the interval between drawing and infusing is 0.5 min; and the infusing time is 5 min.

[0055] (3) Positioning reference point: After fixing the RN type injection needle (specification 10μL) on the holder, turn on the power switch of the digital positioning instrument, disinfect the skin surface of the tree shrew skull with iodine, make a longitudinal incision from the line connecting the two ears to the eyes to expose the skull, find the intersection of the interauricular line and the sagittal suture, i.e. the anterior fontanelle point, and use this point as the reference point O of the three-dimensional coordinate system. Move the three-dimensional manipulator arm to align its positioning point with the anterior fontanelle point, and press the "CLR" key of the digital display base X, Y, and Z axes to return to zero (desktop digital positioning instrument).

[0056] (4) Locating the target area: The stereotactic positioning parameters for the hippocampus were selected according to the "Stereotactic Atlas of Tree Shrew Brain": AP (Y-axis): 2.5mm; ML (X-axis): ±6.5mm; DV (Z-axis): -8mm (starting from the dura mater). That is, move forward 2.5mm along the Y-axis from point O, and then move left and right 6.5mm along the X-axis, marking the position with a marker; remove the cross arm, drill a hole in the skull, and expose the brain tissue.

[0057] (5) Experiment: After the micro-injection pump is turned on to draw the prepared composite solution, within 0.5 min, according to the determined value DV: 8 mm below the dura mater, the operating arm is moved downward to the target depth. After the injection is completed, the needle is left in place for 5 min, and then the needle is slowly withdrawn at a speed of 1.0 mm / min. The coordinate values ​​are set according to the method of locating the target area to carry out the injection experiment at another coordinate point. After the injection is completed, the RN-type injection needle is withdrawn, the injection hole is glued with bone glue, the wound is sutured and disinfected with povidone-iodine, and an appropriate amount of erythromycin ointment is applied to the wound. After the operation, penicillin (22000 IU / kg) is injected into the peritoneum.

[0058] 2.5.3 Assessment of Seizure Behavior

[0059] The Racine scale was used to assess the seizure behavior of tree shrews. Grade 0: no seizure behavior; Grade 1: rhythmic twitching of the corner of the mouth, facial muscles, or ears; Grade 2: more severe focal twitching; Grade 3: clonic jerking of the forelimbs, without standing or falling; Grade 4: generalized tonic-clonic jerking, with falling while standing or lying on one's side; Grade 5: generalized tonic-clonic seizure, with falling while supine; Grade 6: death. Tree shrews were observed continuously for 60 minutes. The seizure latency was recorded, including the time from drug administration to the onset of a Grade 3 seizure (clonic latency) and the time from drug administration to the onset of a tonic-clonic seizure (tonic latency). The seizure rate was also recorded.

[0060] 2.5.4 HE staining

[0061] Twenty-four hours after intraperitoneal injection, tree shrew tissue was harvested. Following anesthesia, the tree shrews were perfused sequentially with physiological saline and then 4% paraformaldehyde solution via the heart. The brain tissue was then fixed in 4% paraformaldehyde for 48 hours. The brain tissue was then dehydrated using a gradient of 75%, 85%, 90%, 95%, and 100% ethanol. After clearing in xylene, the dehydrated and cleared brain tissue was embedded in paraffin to displace the xylene, followed by paraffin embedding, sectioning, and subsequent hematoxylin and eosin (HE) staining.

[0062] Paraffin sections were dewaxed to water and stained with hematoxylin at room temperature for 3-5 minutes. They were then washed with tap water for 10 minutes to remove excess stain, differentiated with 1% hydrochloric acid alcohol for 2 seconds, rinsed with tap water for 10 minutes, and observed under a microscope after the cell nuclei turned blue-purple. They were then stained with eosin at room temperature for 5 minutes, dehydrated in graded alcohols, cleared in xylene, mounted with neutral resin, and the color development results were observed and photographed under a regular optical microscope.

[0063] 2.5.5 Immunofluorescence staining

[0064] Paraffin sections were dewaxed to water, then immersed in an antigen retrieval box containing citrate buffer (pH 6.0) in a microwave oven for antigen retrieval. After blocking with 5% goat serum for 1 hour, primary antibody (NeuN 1:100) was added and incubated overnight at 4°C. Then, 488-labeled goat anti-rabbit IgG (1:1000) was added and incubated at room temperature in the dark for 2 hours. The sections were then mounted with mounting medium containing DAPI and observed and photographed under a fluorescence microscope.

[0065] 2.5.6 Statistical Analysis

[0066] The analysis and comparison were performed using GraphPad Prism 9.0.0. One-way ANOVA was used for comparisons between groups, and LSD method was used for pairwise comparisons. A p-value < 0.05 was considered statistically significant.

[0067] 2.6 Experimental Results

[0068] 2.6.1 Incidence of epilepsy in each group of tree shrews

[0069] This experiment used a total of 15 tree shrews (n=5). The control group of tree shrews were normal, with no seizures or deaths; the model group had a seizure rate of 100.00% and a mortality rate of 20.00%; the miR-4692 inhibitor group had a seizure rate of 40.00% and a mortality rate of 0.00%. The results showed that miR-4692 inhibitors can effectively reduce the seizure rate and mortality rate of epileptic tree shrews (Table 1).

[0070] Table 1. Incidence of epilepsy in tree shrews in each group

[0071]

[0072] 2.6.2 Assessment of seizure behavior in tree shrews of each group

[0073] The seizure severity of tree shrew epilepsy was assessed using the Racine score. The results showed that, compared with the model group, the miR-4692 inhibitor group could effectively prolong the clonic latency and seizure latency of epileptic tree shrews and shorten the duration of seizures (Table 2).

[0074] Table 2. Assessment of seizure behavior in tree shrews

[0075]

[0076] 2.6.3 Assessment of Seizure Severity in Tree Shrews of Each Group

[0077] The seizure severity of tree shrews was assessed using the Racine score. Results showed that all seizures in the model group were grade V or higher; in the miR-4692 inhibitor group, only 1, 2, and 2 tree shrews experienced grade II, III, and IV seizures, respectively. This indicates that miR-4692 inhibitors can effectively reduce the seizure severity in epileptic tree shrews (Table 3).

[0078] Table 3. Levels of Tree Shredder Seizures

[0079]

[0080] 2.6.4 HE staining results

[0081] HE results showed that in the control group, the hippocampal neurons of the tree shrew were plump and round, with close intercellular arrangement, and the nuclei and nucleoli were of normal size. The nuclei were round and bluish-purple, and the cytoplasm was transparent and pale red. In the model group, the hippocampal neurons of the tree shrew varied in size and shape, had disordered structure, and were irregularly arranged. They showed nuclear pyknosis, nuclear fragmentation, nuclear dissolution, and deep staining of the nucleoplasm and vacuolar changes. The miR-4692 inhibitor group showed significantly reduced hippocampal neuronal damage, with a small number of neurons showing degeneration and deep nuclear pyknosis and staining (see...). Figure 2 ).

[0082] 2.6.5 NeuN immunofluorescence staining results

[0083] Immunofluorescence staining results of NeuN showed that, compared with the control group, the mean fluorescence intensity of NeuN in the model group was significantly reduced (<0.0001), indicating severe damage to neurons in the hippocampus of epileptic tree shrews; the mean fluorescence intensity of NeuN in the miR-4692 inhibitor group was significantly increased compared with the model group (P<0.01), indicating that early administration of miR-4692 inhibitor can effectively reduce neuronal damage in tree shrew epilepsy. Figure 3 ,4). NeuN expression is highly neuron-specific and is a specific marker for differentiating mature neurons.

Claims

1. The application of miR-4692 inhibitors, characterized in that, The inhibitor is used to prepare a drug for treating epilepsy, and its nucleotide sequence is: AUCUGAUACCCACACUGCCUGA.

Images