Use of miR-6074 inhibitors

Abstract

The application discloses an application of a miR-6074 inhibitor and belongs to the technical field of biological medicines. The miR-6074 inhibitor is used for preparing a medicine for treating hypertension, and the nucleotide sequence is as follows: CCACCUAGCCUCUGAAUAUC. The miR-6074 inhibitor can obviously inhibit the expression level of miR-6074 in cells caused by Ang II (P<0.0001), obviously increase cell viability (P<0.001), obviously reduce the apoptosis rate of cells (P<0.001) by pre-treatment of the miR-6074 inhibitor, obviously increase the NO release amount of cells (P<0.01) by pre-treatment of the miR-6074 inhibitor, obviously reduce the ET-1 content in cells (P<0.01) by pre-treatment of the miR-6074 inhibitor, and obviously increase the p-eNOS protein expression level in cells (P<0.01) by pre-treatment of the miR-6074 inhibitor.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of a miR-6074 inhibitor. Background Technology

[0002] Hypertension is characterized by a sustained increase in systemic arterial pressure and is a major risk factor for stroke, chronic kidney disease, and myocardial infarction. It is also a major risk factor for disability and premature death worldwide.

[0003] Currently, hypertension is primarily treated with medication, including angiotensin-converting enzyme inhibitors (lisinopril and captopril), angiotensin II receptor antagonists (losartan, valsartan, and olmesartan), calcium channel blockers (nifedipine, diltiazem, and verapamil), and diuretics (furosemide). Long-term medication is usually required, but the intolerances and side effects of prolonged use of antihypertensive drugs cannot be ignored. Therefore, there is an urgent need to develop effective drugs with excellent tolerability and safety. Summary of the Invention

[0004] MicroRNAs (miRNAs) are a class of non-coding single-stranded RNA molecules, approximately 22 nucleotides in length, encoded by endogenous genes. They are post-transcriptional regulators of gene expression, degrading and / or inhibiting the expression of target genes by binding to the 3' untranslated region (3'UTR) of target messenger RNA (mRNA). miRNAs play an important role in hypertension and have become potential biomarkers, effectors, and targets for its diagnosis, prognosis, and treatment. The advantage of using miRNA-targeted drugs is that a single miRNA can target multiple mRNAs, and a single mRNA can serve as a target gene for different miRNAs, forming a gene expression regulatory network that affects multiple genes within the network, thereby improving its efficiency.

[0005] The purpose of this invention is to find and discover miRNA biomarkers related to the diagnosis and treatment of hypertension. The inventors, in their research on the pathogenesis of hypertension, discovered that miR-6074 expression is significantly elevated in hypertensive patients. Further cell experiments showed that the addition of a miR-6074 inhibitor significantly reduced Ang II-induced miR-6074 expression in HUVEC cells, improving the effects of Ang II on HUVEC cell viability, apoptosis, NO, ET-1, and p-eNOS proteins, demonstrating a significant therapeutic effect on the hypertensive cell model. Endothelial dysfunction is a major cause of hypertension and its most common pathological feature. The renin-angiotensin-aldosterone system (RAAS) is an important endocrine system in the human body, primarily responsible for regulating blood pressure. Angiotensin II (Ang II), as a core effector molecule of the RAAS system, can cause vasoconstriction and increase peripheral circulatory resistance, leading to elevated blood pressure. Currently, numerous studies use Ang II-exposed human umbilical vein endothelial cells (HUVECs) to construct hypertensive endothelial dysfunction models for research on hypertension. Hypertension induces HUVEC cytotoxicity by increasing ROS levels and apoptosis rates. Molecules related to vasodilation and vasoconstriction are affected by downregulation of Ang II and p-eNOS, reducing NO synthesis and increasing ET-1 synthesis.

[0006] The miR-6074 inhibitor described in this invention is used to prepare a drug for treating hypertension, and its nucleotide sequence is as follows: CCACCUAGCCUCUGAAUAUC.

[0007] The beneficial effects of this invention are:

[0008] The miR-6074 inhibitor described in this invention significantly inhibited the increase in miR-6074 expression level in cells induced by Ang II (P < 0.0001), significantly increased cell viability (P < 0.001), significantly reduced the apoptosis rate (P < 0.001), significantly increased the amount of NO released from cells (P < 0.01), significantly reduced the content of ET-1 in cells (P < 0.01), and significantly increased the expression level of p-eNOS protein in cells (P < 0.01). Attached Figure Description

[0009] Figure 1 The expression status of miR-6074 in plasma ( ### (P < 0.001 compared to the control group).

[0010] Figure 2A comparative figure showing the effects of miR-6074 inhibitors on miR-6074 expression in Ang II-induced HUVECs ( #### The value was marked as P < 0.0001 compared to the control group; **** (This indicates that compared to the model group, P < 0.0001).

[0011] Figure 3 A comparative diagram showing the effects of miR-6074 inhibitors on Ang II-induced HUVEC cell viability. #### The value was marked as P < 0.0001 compared to the control group; *** (This indicates that compared to the model group, P < 0.001).

[0012] Figure 4 A comparative diagram showing the effects of miR-6074 inhibitors on Ang II-induced apoptosis in HUVEC cells. #### The value was marked as P < 0.0001 compared to the control group; *** (This indicates that compared to the model group, P < 0.001).

[0013] Figure 5 A comparative figure showing the effect of miR-6074 inhibitors on Ang II-induced NO release in HUVEC cells. ### The value was marked as P < 0.001 compared to the control group; ** (This indicates that compared to the model group, P < 0.01).

[0014] Figure 6 A comparative diagram showing the effects of miR-6074 inhibitors on Ang II-induced ET-1 in HUVEC cells ( ### The value was marked as P < 0.001 compared to the control group; ** (This indicates that compared to the model group, P < 0.01).

[0015] Figure 7 A comparative diagram showing the effects of miR-6074 inhibitors on p-eNOS protein expression induced by Ang II in HUVEC cells. ### The value was marked as P < 0.001 compared to the control group; ** This indicates that compared to the model group, P < 0.01. Detailed Implementation

[0016] The present invention will be further described below with reference to embodiments, but this is not intended to limit the present invention in any way. Any modifications or substitutions made based on the teachings of the present invention shall fall within the protection scope of the present invention.

[0017] 1. Expression characteristics and clinical significance of miR-6074 in hypertensive patients

[0018] 1.1 Main Reagents

[0019] Reagent Name company miRcute miRNA Extraction and Isolation Kit Heavenly Root Chloroform Xilong Science Anhydrous ethanol Xilong Science miRNA cDNA First-Strand Synthesis Kit Heavenly Root miRNA Quantitative Real-Time Detection Kit (SYBR Green) Heavenly Root

[0020] 1.2 Main Instruments

[0021] Instrument Name company Vortex mixer SCILOGEX High-speed refrigerated centrifuge SCILOGEX Handheld centrifuge SCILOGEX 96-well plate centrifuge Qilinbell water bath Jintan Science and Technology Quantitative PCR instrument Roche

[0022] 1.3 Experimental Methods

[0023] 1.3.1 Sample Collection

[0024] Ten plasma samples were collected from hypertensive patients and 10 from healthy volunteers (control group) as study subjects. Plasma sample preparation method: Approximately 4 mL of fasting peripheral venous blood was collected from the subjects. After collection, the plasma samples were stored in sodium citrate anticoagulant tubes, centrifuged (3000 rpm, 4℃, 10 min), and the plasma was immediately stored in a -80℃ refrigerator for later use.

[0025] 1.3.2 Primer Design and Synthesis

[0026] The corresponding sequence was obtained from the NCBI database, and primers for miR-6074 were designed. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd. The primer sequence is as follows: miR-6074 Forward: 5'-GATATTCAGAGGCTAGGTGG-3'.

[0027] 1.3.3 miRNA extraction

[0028] Take 200µL of plasma sample and extract miRNA from the plasma sample using the miRcute miRNA extraction and isolation kit.

[0029] 1.3.4 miRNA reverse transcription

[0030] The reverse transcription system was performed according to the miRNA-cDNA first-strand synthesis kit instructions.

[0031] Element volume 2×miRNA RT Reaction Buffer 10μL miRNA RT Enzyme Mix 2μL miRNA samples 8μL

[0032] Bring the total volume of the three components to 20 µL, gently shake, centrifuge for 3-5 seconds to mix the reaction mixture, incubate at 42°C for 60 min, then at 95°C for 3 min to obtain the first strand of reverse-transcribed cDNA. Immediately place on ice or store at -20°C.

[0033] 1.3.5 qPCR detection of target gene expression

[0034] Following the instructions of the miRNA fluorescence quantitative detection kit, add the following reagents to each well of a 96-well PCR plate in the order of sample loading:

[0035] Element volume 2×miRcute Plus miRNA PreMix(SYBR&ROX) 5μL Forward Primer 0.2μL Reverse Primer (10µM) 0.2μL miRNA first-strand cDNA 1μL <![CDATA[ddH2O]]> 3.6μL Total system 10µL

[0036] After thoroughly mixing the above system and briefly centrifuging, the mixture was placed in a LightCycler 96 instrument for detection. Amplification signals were collected. The following were the quantitative PCR conditions: pre-denaturation 95℃, 600s; 95℃: 5s, 60℃: 30s, 72℃: 30s, 45 cycles; melting curve analysis: 95℃: 15s; 60℃: 30s, 95℃: 1s. U6 was selected as an internal control, and 2 was selected for relative expression level analysis of the target gene. -△△Ct The method is used for calculation.

[0037] 1.3.6 Statistical Analysis

[0038] The analysis and comparison were performed using GraphPad Prism 9.0.0. The independent samples t-test was used to compare between groups, and P < 0.05 was considered statistically significant.

[0039] 1.4 Experimental Results

[0040] The results are as follows Figure 1 As shown, compared with healthy volunteers (control group), the expression level of miR-6074 in the plasma of hypertensive patients was significantly increased (P<0.001).

[0041] 2. Effects of miR-6074 inhibitors on a hypertensive cell model

[0042] 2.1 Cell Information

[0043] Human umbilical vein endothelial cells (HUVECs) were purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd.

[0044] 2.2 Main reagents and consumables

[0045] Reagent Name company Angiotensin II (Ang II) Mce DMEM basal culture medium Gibco Penicillin-Streptomycin (P / S) Gibco fetal bovine serum Gibco <![CDATA[lipofectamine TM 3000]]> Gibco Trizol Thermo Fisher Isopropanol Xilong Science Chloroform Xilong Science Anhydrous ethanol Xilong Science miRNA cDNA First-Strand Synthesis Kit Heavenly Root miRNA Quantitative Real-Time Detection Kit (SYBR Green) Heavenly Root Annexin V-FITC Apoptosis Detection Kit Azure Sky Endothelin 1 (ET-1) ELISA kit Wuhan Elite Nitric Oxide (NO) Detection Kit Wuhan Elairite RIPA lysis buffer (strong) Azure Sky p-eNOS antibody Abcam GAPDH antibody Abcam Anti-rabbit IgG CST Surper ECL Plus Hypersensitive Light Emission Prile

[0046] 2.3 Main Instruments

[0047] Instrument Name company Cell incubator Thermo Fisher Scientific 3141 Clean bench Haier HCB-1300V Inverted microscope OLYMPUS BX 53 Nanophotometer IMPLEN Quantitative PCR instrument Roche Flow cytometer ACEA Novocyte 2060R Multifunctional ELISA reader Feyond-A300 Protein electrophoresis tank, electroporation tank, power supply Bio-Rad ECL luminescence imaging system Tanon

[0048] 2.4 Experimental Methods

[0049] 2.4.1 Reagent Preparation

[0050] Preparation of angiotensin II (Ang II): In a clean bench, add 956 μL of sterile distilled water to a 1 mg Ang II reagent tube to prepare a 1 mM Ang II stock solution. Filter the solution through a 0.22 μm cell filter for sterilization, dispense into individual containers, protect from light with aluminum foil, and store at -80°C to avoid repeated freeze-thaw cycles.

[0051] 2.4.2 Cell Culture and Treatment

[0052] HUVEC cells were cultured in DMEM complete medium (89% DMEM + 10% FBS + 1% P / S) and incubated in a 5% CO2, 37°C incubator. HUVEC cells in the logarithmic growth phase were harvested and 5 × 10⁶ cells were added to each well of a 6-well plate. 4 5 × 10⁶ cells per well in a 96-well plate 3 After culturing (5% CO2, 37℃) cells for 24 hours, the medium was changed and cultured in the following groups:

[0053] ① Control group: cultured in DMEM complete medium for 24 hours, then the medium was changed to DMEM medium without FBS and cultured for another 24 hours;

[0054] ② Model group: Cultured in DMEM complete medium for 24 h, then the medium was changed to DMEM medium containing 10 μM Ang II without FBS and cultured for another 24 h;

[0055] ③ miR-6074 inhibitor group: The diluted miR-6074 inhibitor was mixed with lipofectamine TM Mix 3000g of transfection reagent, gently mix, and incubate at room temperature for 20 min to form a transfection complex. Add the above mixture to the cells, gently shake the cell plate before and after incubation, and incubate for 24 h in a 5% CO2, 37°C incubator. Then change the medium to DMEM medium containing 10 μM Ang II and without FBS and continue incubation for another 24 h. The self-designed miR-6074 inhibitor sequence is as follows: CCACCUAGCCUCUGAAUAUC, synthesized by Shanghai Sangon Biotech Co., Ltd.

[0056] 2.4.3 qPCR detection

[0057] Cells from different treatment groups were collected, and total RNA was extracted using the Trizol method. The concentration and purity of total RNA were detected using a micro spectrophotometer. The RNA was then reverse transcribed into cDNA, and PCR amplification was performed using a Roche quantitative PCR instrument. The reaction conditions were: pre-denaturation 95℃ for 600 s; 95℃: 5 s, 60℃: 30 s, 72℃: 30 s, 45 cycles; melting curve analysis: 95℃: 15 s; 60℃: 30 s; 95℃: 1 s. U6 was selected as an internal control, and 2 was used for relative expression level analysis of the target gene. -△△Ct The method is used for calculation.

[0058] 2.4.4 Cell viability assay

[0059] After cell culture in each group was completed, the culture medium was carefully aspirated, and then 100 μL of MEM / F12 basal medium containing 10% CCK8 solution was added to each well. The cells were then incubated at 37°C in the dark for 2 hours. The absorbance at 450 nm was measured using a full-wavelength microplate reader.

[0060] 2.4.5 Flow cytometry apoptosis detection

[0061] Cells from different treatment groups were collected, resuspended in 400 μL of binding buffer, and 5 μL of Annexin V-FITC was added and gently mixed. After incubation in the dark for 15 min, 10 μL of PI was added and mixed. After reacting at room temperature in the dark for 5 min, the cells were analyzed by flow cytometry.

[0062] 2.4.6 NO content detection

[0063] Cell supernatants from different treatment groups were collected, and the corresponding detection reagents were added according to the instructions of the NO detection kit. A sodium nitrite standard curve was prepared. After adding the colorimetric reagent for 15 minutes, the OD value of each well was detected at 550 nm, and the NO content of the sample was calculated based on the standard curve.

[0064] 2.4.7 ET-1 content detection

[0065] Cells from different treatment groups were collected, suspended in PBS buffer, and repeatedly frozen and thawed three times in a -80°C freezer and a 37°C water bath to fully release the cell contents. After centrifugation, the supernatant was used as the test sample, and the ET-1 content in the cells was determined according to the instructions of the ET-1 ELISA assay kit.

[0066] 2.4.8 Western Blot Detection

[0067] Cells from different treatment groups were lysed in RIPA lysis buffer containing protease inhibitors. The supernatant was collected by centrifugation, and 1 / 4 volume of 5× loading buffer was added. After mixing, the mixture was briefly centrifuged for 10 seconds and then boiled in a metal bath at 100°C for 10 minutes to ensure complete protein denaturation. Protein concentration was measured after sample cooling. Proteins were separated using SDS-PAGE and transferred to PVDF membranes. The membranes were blocked with 5% skim milk at room temperature for 2 hours, incubated overnight at 4°C with primary antibodies (p-eNOS antibody 1:1000, GAPDH antibody 1:2000), and then incubated with secondary antibodies at room temperature for 2 hours for immunoassay. Protein bands were imaged and observed using a chemiluminescence imaging system and ImageJ.

[0068] 2.4.9 Statistical Analysis

[0069] The analysis and comparison were performed using GraphPad Prism 9.0.0. One-way ANOVA was used for comparisons between groups, and LSD method was used for pairwise comparisons. P < 0.05 was considered statistically significant.

[0070] 2.5 Experimental Results

[0071] 2.5.1 Effect of miR-6074 inhibitor on miR-6074 expression in Ang II-induced HUVECs

[0072] The results are as follows Figure 2 As shown, compared with the control group, 10 μM Ang II stimulation of HUVECs could increase the expression level of miR-6074 (P < 0.0001); pretreatment with miR-6074 inhibitor significantly inhibited the increase in miR-6074 expression level in cells induced by Ang II (P < 0.0001).

[0073] 2.5.2 Effects of miR-6074 inhibitor on Ang II-induced HUVEC cell viability

[0074] The results are as follows Figure 3 As shown, compared with the control group, 10 μM Ang II stimulation of HUVECs resulted in a significant decrease in cell viability (P < 0.0001); compared with the model group, the miR-6074 inhibition group showed a significant increase in cell viability (P < 0.001).

[0075] 2.5.3 Effect of miR-6074 inhibitor on Ang II-induced apoptosis in HUVEC cells

[0076] The results are as follows Figure 4 As shown, compared with the control group, 10 μM Ang II stimulation of HUVECs led to a significant increase in the apoptosis rate (P < 0.0001); compared with the model group, pretreatment with miR-6074 inhibitor significantly reduced the apoptosis rate (P < 0.001).

[0077] 2.5.4 Effect of miR-6074 inhibitor on NO release in Ang II-induced HUVEC cells

[0078] The results are as follows Figure 5 As shown, compared with the control group, 10 μM Ang II stimulation of HUVECs significantly reduced the amount of NO released by cells (P < 0.001); compared with the model group, miR-6074 inhibition pretreatment significantly increased the amount of NO released by cells (P < 0.01).

[0079] 2.5.5 Effect of miR-6074 inhibitor on Ang II-induced ET-1 content in HUVEC cells

[0080] The results are as follows Figure 6 As shown, compared with the control group, 10 μM Ang II stimulation of HUVECs led to a significant increase in ET-1 content in cells (P < 0.001); compared with the model group, miR-6074 inhibition pretreatment significantly reduced the ET-1 content in cells (P < 0.01).

[0081] 2.5.6 Effect of miR-6074 inhibitor on p-eNOS protein expression in Ang II-induced HUVEC cells

[0082] The results are as follows Figure 7 As shown, compared with the control group, 10 μM Ang II stimulation of HUVECs led to a decrease in the expression level of p-eNOS protein in cells (P < 0.001); compared with the model group, miR-6074 inhibition pretreatment significantly increased the expression level of p-eNOS protein in cells (P < 0.01).

Claims

1. The application of miR-6074 inhibitors, characterized in that, The formulation is used to prepare a drug for treating hypertension, and its nucleotide sequence is: CCACCUAGCCUCUGAAUAUC.

Images