Use of n-terminal active peptide ac2-26 of annexin a1 in preventing and / or treating drug-induced liver injury

Abstract

The application discloses application of an N-terminal active peptide Ac2-26 of annexin A1 in prevention and / or treatment of drug-induced liver injury, and relates to the field of biological medicines, and provides application of the N-terminal active peptide Ac2-26 of annexin A1 in preparation of products for preventing and / or treating drug-induced liver injury. The application proves that Ac2-26 can inhibit neutrophil extracellular traps (NETs) and promote neutrophil polarization to N2 type, reduce liver injury area, and promote liver repair. The application provides a new strategy for preventing and / or treating drug-induced liver injury (DILI).

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to the use of the N-terminal active peptide Ac2-26 of annexin A1 in the prevention and / or treatment of drug-induced liver injury. Background Technology

[0002] Drug-induced liver injury (DILI) is the most common cause of drug withdrawal from the market, accounting for 15% of acute liver failure cases. According to the World Health Organization, DILI has risen to the fifth leading cause of death globally. Currently, due to a lack of multicenter, large-sample prospective studies, the true incidence of DILI in the general population is difficult to estimate. The estimated annual incidence of DILI in my country is no less than 23.80 per 100,000, and it shows a year-on-year upward trend. Furthermore, DILI cases in Chinese individuals are often more severe, with liver failure or mortality rates as high as 3.09%.

[0003] Drug-induced acute liver failure (DILI) occurs when altered drug metabolism leads to liver damage caused by oxidative stress, inflammatory damage, apoptosis, necrosis, or mitochondrial membrane rupture and organ dysfunction. Acetaminophen (APAP) overdose is a major cause of drug-induced acute liver failure.

[0004] Given the public concern surrounding APAP-induced hepatotoxicity, increasing research is focusing on the mechanisms of its toxic effects. Previous studies have shown that APAP-induced oxidative stress and mitochondrial dysfunction play a central role in the pathogenesis of acetaminophen-induced acute liver injury (AILI). Therefore, the U.S. Food and Drug Administration recommends N-acetylcysteine ​​(NAC), a known antioxidant, as the sole treatment option for patients with APAP overdose; however, this drug has limitations, including adverse reactions and a narrow therapeutic window. If the early and / or most treatable stage is missed, liver transplantation is the only option to improve the survival rate of AILI patients. Therefore, there is an urgent need to develop alternative treatments for patients with APAP overdose.

[0005] In recent years, many scholars have gradually recognized that APAP toxicity consists of multiple stages and multiple signaling pathways, including APAP metabolism, oxidative stress, endoplasmic reticulum (ER) stress, autophagy, aseptic inflammation, microcirculatory dysfunction, and compensatory liver repair and regeneration. Many genes and molecules have been identified as playing key roles in the regulation of APAP hepatotoxicity, and therefore they are considered potential therapeutic targets for APAP-induced liver injury. However, some pathophysiological processes may play contradictory roles at different stages of AILI, making them two-sided in regulating APAP hepatotoxicity. Treatment strategies targeting these processes may not benefit patients, a situation reflected in some preclinical studies. Therefore, the prevention or treatment of drug-induced liver injury caused by APAP overdose remains an important clinical problem that urgently needs to be addressed.

[0006] ANXA1 is the first member of the annexin superfamily to be discovered; it is a 37-cell protein. k Da is a calcium-dependent phospholipid-binding protein, primarily expressed in neutrophils, monocytes, and macrophages. It is a key protein with anti-inflammatory, anti-apoptotic, and tissue repair functions. Previous studies have suggested that the pharmacophore Ac2-26 of ANXA1 can mimic the biological functions of ANXA1, making it a suitable candidate for ANXA1 research. More importantly, Ac2-26 may have better clinical application prospects. However, the role and potential therapeutic value of Ac2-26 in APAP-induced DILI have not yet been investigated. Summary of the Invention

[0007] The purpose of this invention is to provide the use of Ac2-26, the N-terminal active peptide of annexin A1, in the prevention and / or treatment of drug-induced liver injury.

[0008] In a first aspect, the present invention claims the use of the N-terminal active peptide Ac2-26 of annexin A1 in the preparation of products for the prevention and / or treatment of drug-induced liver injury. Secondly, the present invention claims the use of the N-terminal active peptide Ac2-26 of annexin A1 in the preparation of products for relieving symptoms of drug-induced liver injury.

[0009] In the first and second aspects mentioned above, the drug-induced liver injury may be acetaminophen-induced liver injury.

[0010] Thirdly, the present invention claims the use of the N-terminal active peptide Ac2-26 of annexin A1 in the preparation of products having any of the following functions: (A1) Reduces drug-induced liver injury; (A2) Promotes liver repair in the body caused by drug-induced liver injury; (A3) Promotes N2 polarization of intrahepatic neutrophils in patients with drug-induced liver injury; (A4) Inhibit extracellular traps (NETs) of intrahepatic neutrophils in the body caused by drug-induced liver injury.

[0011] Furthermore, the drug-induced liver injury may be acetaminophen-induced liver injury.

[0012] The product may be a drug. Further, the drug may be a preventative drug, namely, administering the N-terminal active peptide Ac2-26 of annexin A1 to the body before drug-induced liver injury occurs.

[0013] In this invention, reducing liver damage and promoting liver repair can be manifested in all or part of the following: reducing the area of ​​liver damage, lowering serum AST levels, upregulating PCNA protein expression, and increasing Ki67. + Cell number, upregulation of the expression of proliferation-related genes (such as Cyclin D1, Cyclin A2 and / or Cyclin B1 genes).

[0014] In this invention, the promotion of neutrophil polarization to N2 type and the inhibition of neutrophil extracellular traps (NETs) can be manifested as: upregulation of the expression of marker proteins (such as Arg-1, YM1, CD206) for N2 type neutrophils, downregulation of the expression of marker proteins (such as TNFα, ICAM-1) for N1 type neutrophils, and downregulation of the expression of marker proteins (such as MPO, CitH3) for NETs.

[0015] Fourthly, the present invention claims protection for a complete set of products for screening drugs.

[0016] The complete product claimed by this invention consists of the following (1) and (2): (1) Ac2-26, the N-terminal active peptide of annexin A1, which served as a positive control drug; (2) Recipient animals and acetaminophen used to prepare animal models of drug-induced liver injury; The drug in question is used to prevent drug-induced liver injury.

[0017] In drug screening, the candidate drug is first administered to the recipient animals, followed by the administration of an effective dose of acetaminophen used to construct a drug-induced liver injury animal model. Simultaneously, a positive control is established using the N-terminal active peptide Ac2-26 of annexin A1 instead of the candidate drug, and the same treatment is applied. The liver injury status of the two groups of animals is observed and detected to evaluate the efficacy of the candidate drug in preventing drug-induced liver injury. If the efficacy of the candidate drug reaches or exceeds that of the N-terminal active peptide Ac2-26 of annexin A1, the candidate drug is deemed to have potential value.

[0018] The effective dose of acetaminophen is a dose of acetaminophen that can cause drug-induced liver injury in the untreated recipient animals without causing death. This dose is generally determined according to the following principles: (1) Avoid animal death: The dose should not be too high to avoid the rapid death of the animals due to acute liver failure, which would prevent the experiment from continuing. Generally, the maximum tolerable dose range of the animals is explored through preliminary experiments, and the injury dose is adjusted on this basis. (2) Induce liver injury: The dose should be sufficient to cause obvious liver injury, so that the animals show abnormal liver function indicators, such as elevated serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST), and typical pathological changes in liver histology, such as hepatocyte necrosis and inflammatory cell infiltration. If the dose is too low, it will not cause observable liver injury, and the model cannot be successfully established.

[0019] Furthermore, the animal may be a mouse.

[0020] In one embodiment of the present invention, the drug-induced liver injury animal model was specifically obtained by intraperitoneal injection of acetaminophen at a dose of 400 mg / kg into wild-type mice.

[0021] Fifthly, the present invention claims protection for the use of the complete product described in the fourth aspect above in screening drugs; the drugs are drugs for preventing drug-induced liver injury.

[0022] Sixthly, the present invention claims a method for preparing an animal model of liver injury.

[0023] The method for preparing an animal model of liver injury claimed in this invention may include the following steps: (B1) Reduces the expression of ANXA1 protein in neutrophils of recipient animals; (B2) Administer an effective dose of acetaminophen to animals treated with (B1).

[0024] The animal models prepared by this method have a stronger degree of liver damage than the drug-induced liver injury animal models prepared using only acetaminophen. In other words, this method is actually a way to obtain animal models with a stronger degree of liver damage.

[0025] In (1), reducing the expression of ANXA1 protein in the neutrophils of the recipient animal can be achieved by specifically knocking out the gene encoding the ANXA1 protein in the neutrophils of the recipient animal.

[0026] In one embodiment of the present invention, specifically through Ly6G cre Mice and ANXA1 flox / flox The animal model was obtained by breeding mice.

[0027] Furthermore, the animal may be a mouse. Accordingly, in (B2), the mouse treated in (B1) may be intraperitoneally injected with a dose of 400 mg / kg of acetaminophen.

[0028] Seventhly, the present invention claims protection for substances capable of reducing the expression of ANXA1 protein in neutrophils of recipient animals and the use of acetaminophen in the preparation of animal models of liver injury.

[0029] The liver damage in the animal model was more severe than that in the drug-induced liver injury animal model prepared using only acetylamino acid.

[0030] Furthermore, the substance may be a substance capable of specifically knocking out the gene encoding the ANXA1 protein in the neutrophils of the recipient animal.

[0031] In this invention, the amino acid sequence of the N-terminal active peptide Ac2-26 of annexin A1 is specifically: Ac-Ala-Met-Val-Ser-Glu-Phe-Leu-Lys-Gln-Ala-Trp-Phe-Ile-Glu-Asn-Glu-Glu-Gln-Glu-Tyr-Val-Gln-Thr-Val-Lys.

[0032] In this invention, the N-terminal active peptide Ac2-26 of annexin A1 is applied to mice at a dose of 1 mg / kg.

[0033] Experiments have shown that Ac2-26, the N-terminal active peptide of annexin A1, can inhibit neutrophil extracellular traps (NETs) and promote neutrophil polarization towards the N2 type. By reducing the area of ​​liver damage and promoting liver repair, it provides a new strategy for the prevention and / or treatment of drug-induced liver injury (DILI). Attached Figure Description

[0034] Figure 1 The image shows the expression results of ANXA1 in liver tissue in Example 1. A represents Western blot analysis of ANXA1 in liver tissue at different time points after intraperitoneal injection of APAP; B represents immunofluorescence images of ANXA1 in liver tissue at different time points after intraperitoneal injection of APAP.

[0035] Figure 2 This is a diagram showing the results of aggravated liver injury due to neutrophil ANXA1-specific knockout in Example 2. Neutrophil ANXA1-specific knockout (ANXA1) NKO Mice and their littermates (wild-type, WT) were intraperitoneally injected with 400 mg / kg APAP. A shows pathological damage to the liver tissue of mice with two different genotypes after intraperitoneal injection of APAP at 24 h, 48 h, and 72 h, respectively; B and C show serum AST and ALT levels in the same mice at the same genotypes; D shows the number of CD45+ neutrophils in the liver of the mice with the same genotypes after intraperitoneal injection of APAP at 24 h, 48 h, and 72 h. + Ly6G + Flow cytometry.

[0036] Figure 3 This is a diagram showing the delayed liver repair results caused by neutrophil ANXA1-specific knockout in Example 3. Neutrophil ANXA1-specific knockout (ANXA1) NKO Mice and their littermates (wild-type) mice were intraperitoneally injected with 400 mg / kg APAP. Among them, A represents the intraperitoneal injection of repair-type macrophages (CD11b) derived from liver mononuclear cells in mice of two genotypes at 24 h, 48 h, and 72 h after APAP injection. + Ly6C low A) Flow cytometry plot; B) Electrophoresis plot of PCNA protein in liver tissue of two genotype mice 24 h after intraperitoneal injection of APAP; C) Immunohistochemical plot of Ki67 in liver tissue of two genotype mice 48 h after intraperitoneal injection of APAP; D) mRNA level plot of Cyclin D1, Cyclin A2, and Cyclin B1 in liver tissue of two genotype mice 48 h after intraperitoneal injection of APAP.

[0037] Figure 4This is a graph showing the results of Ac2-26 intervention in Example 4, which reduced liver damage and promoted liver repair. 1 mg / kg Ac2-26 was administered intraperitoneally 1 hour before modeling. In the figures, A shows the pathological damage to the livers of mice pretreated with Ac2-26 and untreated (Vehicle) mice 24 h and 48 h after intraperitoneal injection of APAP; B shows the serum AST levels of mice pretreated with Ac2-26 and untreated (Vehicle) mice 24 h and 48 h after intraperitoneal injection of APAP; C shows the immunohistochemical staining of Ki67 in the liver tissues of mice pretreated with Ac2-26 and untreated (Vehicle) mice 48 h after intraperitoneal injection of APAP; D shows the protein electrophoresis of PCNA protein in the liver tissues of mice pretreated with Ac2-26 and untreated (Vehicle) mice 24 h after intraperitoneal injection of APAP; and E shows the mRNA levels of Cyclin D1, Cyclin A2, and Cyclin B1 in the liver tissues of mice pretreated with Ac2-26 and untreated (Vehicle) mice 48 h after intraperitoneal injection of APAP.

[0038] Figure 5 This is a graph showing the results of Ac2-26 inhibiting NETs and promoting N2-type polarization of neutrophils in Example 5. In the graph, A is an electrophoresis image of polarization and NETs-related marker proteins; B is a NETs fluorescence image; and C is a flow cytometry image of N2-type neutrophils.

[0039] In each figure, ns indicates no statistically significant difference, * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001, and **** indicates P<0.0001. Detailed Implementation

[0040] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0041] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0042] The N-terminal active peptide Ac2-26 of annexin A1 (abbreviated as Ac2-26, MedChemExpress, HY-P1098) used in the following examples.

[0043] The antibody information used in the following examples is shown in Table 1.

[0044] Table 1. Antibody Information

[0045] The experimental methods involved in the following embodiments: 1. H&E staining (1) Paraffin sections: Fresh liver tissue was fixed with 4% paraformaldehyde and properly stored in a refrigerator at 4°C. Then, it was embedded in paraffin according to the procedure. The paraffin block was cut into pieces of about 5μm and placed on a glass slide to prevent detachment.

[0046] (2) Baking: Baking the sheets in an oven at 65°C until the paraffin melts.

[0047] (3) Dewaxing and rehydration: Place the sections in the following tanks in sequence: xylene I and II for 15 min each; then soak them in the following tanks in sequence: anhydrous ethanol I and II for 5 min each; 95% ethanol, 85% ethanol, 75% ethanol, 50% ethanol and distilled water for 5 min each.

[0048] (4) Staining with hematoxylin: Add hematoxylin to the tissue section, stain for 3 minutes, and rinse with tap water to remove excess stain (be careful not to let the water flow directly rinse the tissue to prevent tissue rupture or even peeling).

[0049] (5) Differentiation: After the hydrochloric acid and alcohol are differentiated, the alcohol is rinsed off with distilled water.

[0050] (6) Blueing: Rinse with tap water after the ammonia solution turns blue.

[0051] (7) Eosin staining: stain with eosin staining solution and rinse with distilled water.

[0052] (8) Dehydration and clearing: The stained paraffin sections were placed in the following containers in sequence: 75% ethanol, 2-3 s; 85% ethanol, 2-3 s; 95% ethanol, 2-3 s; anhydrous ethanol, 5 min; xylene I, 8 min; xylene II, 8 min.

[0053] (9) Covering: Mix neutral resin and xylene until it becomes a flowing, viscous mixture, and drop it onto the tissue to cover it. Slowly place the coverslip on top to prevent air bubbles from forming.

[0054] (10) Observe and collect images under a microscope.

[0055] 2. Western blotting (WB) 2.1 Tissue protein extraction (1) After washing the blood off the surface of the fresh liver with PBS, weigh about 50 mg of liver tissue and put it into a grinder.

[0056] (2) Add 990 μl of RIPA lysis buffer and 10 μl of PMSF to each sample, and grind quickly on ice until homogenized, avoiding the generation of bubbles as much as possible.

[0057] (3) Aspirate the tissue homogenate into a centrifuge tube and let it stand on ice for a few minutes. Set the centrifuge temperature to 4°C, the speed to 12000 rpm, and the time to 10 min in advance. After centrifugation, the tissue homogenate is divided into three layers (from longest to shortest: fat, protein, and precipitate). Attach a 10 μl pipette tip to a 200 μl pipette tip and aspirate the protein in the middle layer into a 1.5 ml EP tube.

[0058] (4) Add 5× loading buffer, the ratio of buffer to protein is 1:4 (equivalent to 1× loading buffer), and boil in a metal bath at 100℃ for 10 min.

[0059] (5) After the protein is aliquoted (to prevent repeated freezing and thawing), it is stored in a -80℃ refrigerator.

[0060] 2.2 BCA protein quantification Protein concentration was determined according to the steps described in the BCA kit (purchased from Beyotime, cat#P0010S).

[0061] 2.3 Preparation of SDS-PAGE adhesive (1) Leak detection: Take two clean glass plates (one short plate with groove and one long plate of 1.5mm), align the two plates and clamp them on the glue maker. Add an appropriate amount of ddH2O water and let it stand for a few minutes to see if there is any leakage.

[0062] (2) Gel preparation: Strictly follow the formula to prepare the gel and make sure to mix it evenly. If it is not mixed evenly, the gel may not solidify or the sample may be skewed.

[0063] 12% lower gel (separating gel) formulation: ddH2O 1.5 ml; 30% Acr-Bis 3 ml; pH 8.8 Tris-HCl 2.85 ml; 10% SD 75 μl; 10% APS 75 μl; TEMED 6 μl.

[0064] (3) Filling the adhesive: Fill the prepared lower layer adhesive between the two glass plates. The height can be determined using a comb, approximately 1 cm below the comb. After sealing, let it stand at room temperature for 30 minutes. Once the lower layer adhesive has solidified, pour off the sealing solution. Then, add the following reagents in sequence according to the upper layer adhesive formula, mix well, and slowly add the adhesive using a 1 ml syringe. Gently insert a 1.5 mm comb into the upper layer adhesive and let it stand at room temperature until the upper layer adhesive is completely solidified. It can be used immediately after preparation, or the prepared adhesive can be stored at 4℃.

[0065] Formula for a top layer gel (stack gel): ddH2O 2.1 ml; 30% Acr-Bis 0.5 ml; pH 6.8 Tris-HCl 0.38 ml; 10% SDS 30 μl; 10% APS 30 μl; TEMED 3 μl.

[0066] 2.4 Electrophoresis Place the gel in the electrophoresis tank, add an appropriate amount of 1× protein loading buffer, and add the protein markers and samples to the sample wells in the correct groups. Cover the wells with the cap and wires, and set the voltage to start electrophoresis. In the stacking gel area, set the voltage to 60 V for electrophoresis. In the separating gel area, change the voltage to 120 V. Continue electrophoresis until the samples reach the end of the separating gel.

[0067] 2.5 Transfer film (1) After electrophoresis, place the gel in the transfer buffer. Place the gel in the transfer clamp in the following order: black electrode, sponge, 3 layers of filter paper, gel, PVDF membrane, 3 layers of filter paper, sponge, red electrode. The entire process should be carried out in the transfer buffer to avoid generating air bubbles.

[0068] (2) Place the transfer clamp into the tank. Ensure that the black side faces the black side and the white side faces the red side. The transfer process will generate heat, so add ice to the tank and place the entire transfer tank in ice water. Under normal circumstances, a current of 250 mA can be selected for 1.5 hours of transfer.

[0069] 2.6 Membrane blocking and antibody incubation (1) The membrane was soaked in 5% skim milk powder and sealed on a shaker at the lowest speed for 1 hour. After sealing, the membrane was washed 3 times with 1×TBST for 5 minutes each time.

[0070] (2) Transfer the membrane to a dedicated antibody incubation box, add the diluted antibody (diluted according to the antibody instructions), and incubate overnight at 4°C.

[0071] (3) Wash the membrane with 1×TBST after the primary antibody incubation is complete.

[0072] (4) Add the diluted secondary antibody and incubate at room temperature on a shaker at the lowest speed for 1 hour. After incubation, wash 3 times with TBST for about 5 minutes each time.

[0073] 2.7 color rendering (1) Add luminescent liquid A and liquid B in a 1:1 ratio to a 1.5 mL EP tube and mix well. Then, draw the mixture onto the prepared sealing film and invert the PVDF film onto the luminescent liquid on the sealing film (make sure no air bubbles are left) and incubate for 3-5 minutes.

[0074] (2) Place the PVDF film face up on the imaging stage, hold it with tweezers, and gently lower it along one side of the film (be careful not to leave air bubbles). Then use the imaging system to form an image and save the image.

[0075] 3. Tissue fluorescence (IF) (1) Baking: Baking at 65℃ for 1-2 hours (the time should be extended appropriately for non-solid organs) or baking at 95℃ for 20-30 minutes.

[0076] (2) Dewaxing and rehydration: Place the slices in xylene tanks 1-3 in sequence for 15 min each; soak them in anhydrous ethanol tanks 1 and 2 for 5 min each, then soak them in 90% ethanol for 5 min, 70% ethanol for 5 min, and 50% alcohol for 3-5 min in sequence, and wash them with ddH2O 3 times, each time for about 5 min.

[0077] (3) Antigen retrieval: Immerse the tissue section in diluted citric acid / citrate (about 700ml) antigen retrieval solution, cover the beaker with plastic film, poke a few small holes, heat on high until it just boils (about 10 minutes in a microwave oven), turn off the heat for 5 minutes, heat on high until it boils, turn off the heat for 5 minutes, heat on high until it boils, and let it cool naturally for 20-30 minutes after stopping heating.

[0078] (4) Blocking: Draw the outline of the tissue with an immunohistochemical pen, add 5% BSA solution, incubate at 37°C for 1 h, then remove the tissue slide, pour off the blocking solution, and do not wash.

[0079] (5) Incubation of primary antibody: After adding the primary antibody to the tissue, place it in a humidified box and incubate overnight at 4°C.

[0080] (6) Secondary antibody incubation: The next day, warm to 37°C for 30 min; after washing in PBST, add secondary antibody, and then incubate at 37°C for 60 min; after the incubation, wash with PBST. (7) DAPI counterstaining of cell nuclei.

[0081] (8) Sealing: Add anti-fluorescence quenching agent and seal with neutral resin.

[0082] (9) Acquire images.

[0083] 4. Immunohistochemistry (IHC) (1) Baking slices: 65℃, 2 h (2) Dewaxing and rehydration: Soak in xylene tanks No. 1-3 in sequence for 15 min each; soak in anhydrous ethanol tanks No. 1 and No. 2 for 5 min each, then soak in 90% ethanol for 5 min, 70% ethanol for 5 min, and 50% alcohol for 3-5 min in sequence, and wash with ddH2O 3 times, about 5 min each time.

[0084] (3) Antigen retrieval: Immerse the tissue sections in diluted citric acid / citrate (about 700ml) antigen retrieval solution, cover the beaker with plastic film, poke a few small holes, heat on high until it just boils (about 10 minutes in a microwave oven), turn off the heat for 5 minutes, heat on high until boiling, turn off the heat for 5 minutes, heat on high until boiling, and let it cool naturally for 20-30 minutes after stopping heating. After cooling, wash 3 times with PBST.

[0085] (4) Blocking: After wiping the section dry with a paper towel, draw the outline of the tissue with an immunohistochemistry pen and block at 37℃ for 30 min.

[0086] (5) Primary antibody incubation: Gently shake off the blocking solution, add a primary antibody that can cover the tissue, and incubate overnight at 4°C.

[0087] (6) Secondary antibody incubation: After warming at 37℃ for 30 min, discard the primary antibody, wash 3 times with PBS for 5 min each time; after adding the secondary antibody, incubate at 37℃ in the dark for 1 h, then wash 3 times with PBST for 5 min each time.

[0088] (7) DAB color development.

[0089] (8) Counterstaining: Counterstain the cell nuclei with hematoxylin.

[0090] (9) Mounting: Neutral resin for mounting.

[0091] 5. Real-time quantitative PCR 5.1 Extraction of RNA from Liver Tissue (1) Sample preparation: Grind the tissue into powder in a mortar with liquid nitrogen.

[0092] (2) TRIzol lysis: Add 1 ml of TRIzol and repeatedly blow and mix to obtain tissue homogenate.

[0093] (3) Chloroform extraction: Add 200 μl of chloroform to each sample tube, shake vigorously for 15 s, let stand at room temperature for 15 min, pre-cool the centrifuge at 4℃, and then centrifuge at 12000 rpm for 15 min.

[0094] (4) Isopropanol precipitation: Add an equal amount of isopropanol to each sample tube, mix thoroughly by inverting the tube, let stand at room temperature for 10 min to precipitate, and then centrifuge at 12000 rpm for 15 min in a centrifuge at 4℃.

[0095] (5) Washing the precipitate with 75% ethanol: After discarding the supernatant, add 500 μl of pre-cooled 75% ethanol to each tube, shake, pre-cool in a centrifuge at 4°C, and wash the precipitate at 7500 rpm for 10 min.

[0096] (6) Drying the precipitate: After centrifugation, discard the supernatant, invert the EP tube onto clean paper, add 20 μl of DEPC water after 15 min, and thoroughly dissolve by blowing and rinsing.

[0097] (7) RNA concentration: The concentration was measured by a nucleic acid analyzer. CD260 / 280: 1.8-2.2. <2.2 indicates protein contamination.

[0098] 5.2 Reverse Transcription RNA was converted to DNA according to the steps described in the reverse transcription kit (reagent purchased from Novizan, cat#R312).

[0099] 5.3 qPCR 5.3.1 Perform qPCR according to the steps described in the qPCR kit (reagent purchased from Novizan, cat#Q711-02) instructions.

[0100] 5.3.2 The primer sequences are as follows (5'-3'): Cyclin D1:GCAGAAGGAGATTGTGCCATCC;AGGAAGCGGTCCAGGTAGTTCA; Cyclin B1: AGAGGTGGAACTTGCTGAGCCT; GCACATCCAGATGTTTCCATCGG; Cyclin A2:TTGTAGGCACGGCTGCTATGCT;GGTGCTCCATTCTCAGAACCTG.

[0101] 5.3.3 Computer Lab and Data Analysis (1) Data preparation (Ct value acquisition): Export raw data from the qPCR instrument to obtain the Ct values ​​of the target gene and internal reference gene for each sample.

[0102] (2) Calculate the ΔCT value. ΔCT for the target gene: For each sample, calculate the difference between the Ct value of the target gene and the Ct value of the internal reference gene in that sample, ΔCT = Ct(target gene) - Ct(mean value of reference gene). ΔCT for the control group: Similarly, calculate the average difference between the Ct values ​​of the target gene and the internal reference gene in the control sample (usually an untreated sample or other set standard sample).

[0103] (3) Calculate the △△CT value △△CT: Calculate the difference between the △CT value of each test sample and the △CT value of the control group △△CT = △CT(target gene) - △CT(control mean).

[0104] (4) Calculation of relative expression level: using formula 2 -△△CTThe target gene expression level of each sample relative to the control group is calculated, and the results are usually expressed as a fold change relative to the control group.

[0105] (5) Data Analysis: Statistical analysis: Perform appropriate statistical tests (e.g., t-test or ANOVA) as needed to assess whether the differences in expression levels between different treatment groups are statistically significant. Graphical Presentation: Visualize the results, typically using bar charts or column charts to represent the relative expression levels and standards of each sample.

[0106] (6) Interpretation of results: According to 2 -△△CT The value is used to interpret the changes in target gene expression under different conditions. If the result is less than 1, it indicates that the expression of the target gene is lower than that of the control group; if the result is greater than 1, it indicates that the expression is higher than that of the control group.

[0107] 6. In situ perfusion of mouse liver (1) Incubate the perfusion fluid and digestion fluid at 37°C for 30 min, and sterilize the surgical instruments (the scissors and forceps used for liver resection and dissection should be used separately).

[0108] (2) Fix the anesthetized mouse and locate the blood vessels: Fix the animal’s limbs with a syringe needle and disinfect its abdomen and chest with 75% ethanol. Open the abdominal cavity to find the liver. Turn the liver upward and peel the left side of the intestine out of the abdominal cavity to the right side of the abdomen. At this time, the portal vein and inferior vena cava can be seen.

[0109] (3) Irrigation: Insert the needle into the lower end of the portal vein and start perfusion at a rate of 15 L / min. After the liver turns white, cut open the lower end of the inferior vena cava and continue perfusion until the liver turns white and no blood flows out.

[0110] (4) Digestion: Replace the digestive fluid and perfuse at a rate of 10 ml / min until small pits are formed when pressed and obvious cracks are visible on the surface, showing the morphology of the liver tissue being broken down. This is used as the basis for determining the endpoint.

[0111] (5) Collection of hepatocytes and non-hepatocytes: The perfused liver was removed from the animal and placed in a sterile culture dish. An appropriate amount of DMEM was added and the liver was gently shredded. The cell suspension was filtered through a 70 μm filter to remove undigested tissue and connective tissue. The mixture was centrifuged in a 50 ml centrifuge tube at 600 rpm, 4°C, for 5 min. The precipitate was almost entirely composed of hepatocytes. For a purer liver parenchyma, multiple centrifugations were performed. The supernatant was centrifuged again at 800 g for 5 min. The supernatant was discarded, and the precipitate contained Kupffer and other immune cells. Both precipitates were cultured in serum-containing DMEM for the next experimental step.

[0112] 7. Flow cytometry 7.1 Design of flow cytometry experiments Set up controls: There are at least 5 types of flow cytometry controls: biological control, blank control, isotype control, compensation control (also called single positive control) and FMO control. The main purpose is to avoid false positive or false negative results.

[0113] 7.2 Preparation of Cell Suspension Samples (1) Obtain liver immune cell precipitate by following the steps described above for separating liver parenchymal cells and non-parenchymal cells, and transfer the precipitate to a 1.5 ml EP tube.

[0114] (2) After resuspending the cells in an appropriate amount of PBS, centrifuge at 800 g, 4℃, for 2 min and discard the supernatant.

[0115] (3) Add 100 μl of PBS to resuspend the cells and adjust the cell count to 1 × 107 / ml.

[0116] (4) Add live cell antibody and incubate at room temperature for 20-30 min to distinguish between live cells and dead cells.

[0117] (5) Add 1 ml of 3% BSA, centrifuge at 800 g, 4℃ for 2 min to wash the cells, and discard the supernatant.

[0118] (6) After resuspending the cells in 100 μl of 3% BSA, add other flow cytometry antibodies according to the antibody instructions and incubate at room temperature in the dark for 15 min.

[0119] (7) Add 1 ml of 3% BSA, centrifuge at 800 g, 4℃ for 2 min to wash the cells, discard the supernatant, and resuspend the precipitate in an appropriate amount of 3% BSA.

[0120] 7.3 Computer Lab and Data Analysis (1) Perform flow cytometry analysis according to the standard settings of the CytoFLEX flow cytometer.

[0121] (2) Collect data.

[0122] (3) Analysis results.

[0123] Example 1: Upregulation of hepatic ANXA1 expression during acetaminophen-induced acute liver injury (AILI). 1. Constructing a wild-type mouse AILI model (1) Laboratory animals: All animal experiments were conducted in accordance with the protocol approved by the Laboratory Animal Ethics Committee (ethics number LLSC20220180). Necessary precautions were taken for the mice to minimize their suffering during the experiments. C57BL / 6 mice (6 weeks old, weighing 18-20g) were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. and were acclimatized for one week at the Laboratory Animal Center of Anhui Medical University before the relevant experiments were carried out.

[0124] (2) Drug preparation: Acetaminophen (APAP) purchased from MedChemExpress (MCE), Dissolve in sterile physiological saline, then heat in a 50°C water bath to aid dissolution and prepare a solution with a concentration of 20 mg / ml. Generally, it should be prepared and used immediately. The dosage for mice is 400 mg / kg.

[0125] (3) Model construction: After fasting for 12 h, APAP solution was injected intraperitoneally, and the animals' condition was closely observed after administration. Normal mice injected with sterile saline were set up as the control group.

[0126] (4) Success indicators: Serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels were detected to be much higher than those of normal mice or liver tissue H&E staining showed obvious pathological damage.

[0127] 2. Detection of ANXA1 expression in liver tissue using Western blotting and inductively coupled plasma (IF) assays. Mice were sacrificed at 0 h (i.e., normal mouse control group injected with sterile saline), 3 h, 6 h, 12 h, 24 h, 48 h, and 72 h after intraperitoneal injection of APAP, and liver tissue was collected. Western blotting was used to detect the ANXA1 protein level in mouse liver tissue at 0 h, 3 h, 6 h, 12 h, 24 h, 48 h, and 72 h after APAP injection; fluorescence infiltration (IF) was used to detect the ANXA1 fluorescence signal in paraffin sections of mouse liver tissue at 0 h, 12 h, and 24 h after APAP injection (antibody purchased from Proteintech, cat#21990-1-AP; WB dilution 1:1000; IF dilution 1:200).

[0128] The results are as follows Figure 1 As shown, ANXA1 expression in liver tissue is highest at 24 h and then gradually decreases.

[0129] Example 2: Neutrophil ANXA1-specific knockout aggravates liver injury in mice 1. Preparation of neutrophil ANXA1-specific knockout mice Ly6G creMice (purchased from Shanghai Southern Model Biotechnology Co., Ltd., Ly6g-Cre-2A-tdTomato mice, catalog number NM-KI-200219. Cre recombinase is driven by the promoter of the Ly6G gene. Ly6G is a neutrophil-specific marker, therefore Cre recombinase is actively expressed only in neutrophils and their precursor cells, and is inactive in other tissues or cells) and ANXA1 flox / flox Mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., C57BL / 6JGpt-) Anxa1 em1Cflox / Gpt mice, Strain NO.T016067, were bred in the SPF-grade animal room of the Experimental Animal Center of Anhui Medical University to produce neutrophil ANXA1-specific knockout mice (ANXA1). flox / flox Ly6G cre+ / - Neutrophil ANXA1-specific knockout mice (ANXA1) flox / flox Ly6G cre+ / - ,Right now Figure 2 and Figure 3 ANXA1 in the figure caption NKO ) and control mice (ANXA1) flox / flox ,Right now Figure 2 and Figure 3 The WT (as shown in the caption) was housed in the SPF-grade animal room of the Experimental Animal Center of Anhui Medical University.

[0130] 2. An AILI model was constructed using wild-type and neutrophil ANXA1-specific knockout mice. AILI models were constructed using two mouse genotypes as described in Example 1. Mice were anesthetized 24 h, 48 h, and 72 h after intraperitoneal injection of APAP, and their livers and blood were collected.

[0131] 3. H&E staining for detecting liver pathological damage Fresh liver tissue collected at 24h, 48h, and 72h after intraperitoneal injection of APAP was fixed with 4% paraformaldehyde and properly stored in a 4℃ refrigerator. Then, it was embedded in paraffin according to a prescribed procedure. During the experiment, the paraffin blocks were cut into approximately 5μm pieces and placed on detachable glass slides. Samples were prepared through steps including baking, dewaxing and rehydration, hematoxylin staining, differentiation, blue staining, eosin staining, dehydration, clearing, and mounting. The samples were then observed and images were acquired under a microscope.

[0132] The results are as follows Figure 2 As shown in Figure A, compared with the wild group (WT), the ANXA1 knockout group (ANXA1 NKO The area of ​​pathological damage to the liver is larger.

[0133] 4. Detect serum ALT and AST levels in mice. Blood samples were collected at 24h, 48h, and 72h after intraperitoneal injection of APAP. After standing at 4℃ for 2h, the samples were centrifuged at 3500rpm for 10min. The supernatant serum was aspirated. Serum ALT and AST levels in the two groups of AILI mice were measured according to the instructions of the ALT and AST assay kits (purchased from Nanjing Jiancheng Biotechnology Institute, cat#C009-2-1, cat#C010-2-1).

[0134] like Figure 2 As shown in B and C, compared with the wild group (WT), the ANXA1 knockout group (ANXA1 NKO The mice had higher serum ALT and AST levels, suggesting that ANXA1 has a liver-protective effect.

[0135] 5. Flow cytometry detection of neutrophils in the liver Hepatic immune cells were extracted from mice of two genotypes via in situ liver perfusion at 24 h, 48 h, and 72 h after intraperitoneal injection of APAP. Flow cytometry was used to detect the neutrophil surface molecule CD11b (PerCP-Cy). TM 5.5 Rat Anti-CD11b purchased from BD Pharmaceuticals TM (cat#550993), Ly6G (FITC Rat Anti-mouse Ly6G purchased from BDPharmingen) TM The expression for ,cat#551460).

[0136] like Figure 2 As shown in Figure D, compared with the wild group (WT), the ANXA1 knockout group (ANXA1 NKO Neutrophil infiltration was more pronounced in the liver of mice.

[0137] The above results indicate that neutrophil ANXA1-specific knockout exacerbates liver damage in mice.

[0138] Example 3: Neutrophil ANXA1-specific knockout delays liver repair 1. Preparation of neutrophil ANXA1-specific knockout mice Same as step 1 in Example 2.

[0139] 2. An AILI model was constructed using wild-type and neutrophil ANXA1-specific knockout mice. Same as step 2 in Example 2.

[0140] 3. Detection of Ly6C in the liver low The proportion of type II macrophages Hepatic immune cells were extracted from mice of two genotypes via in situ liver perfusion at different time points (24 h, 48 h, and 72 h) following intraperitoneal injection of APAP. Flow cytometry was used to detect the macrophage surface molecule CD45 (APC-Cy). TM 7 Rat Anti-mouse CD45 purchased from BD Pharmingen TM , cat#557659), CD11b(PerCP-Cy TM 5.5 Rat Anti-CD11b was purchased from BDPharmingen. TM (cat#550993), F4 / 80 (BV421 Rat Anti-mouse F4 / 80 purchased from BD Horizon) TM (cat#565411), Ly6C (APC Rat Anti-mouse Ly6C purchased from BD Pharmaceuticals) TM (cat#560595).

[0141] like Figure 3 As shown in Figure A, the ANXA1 gene knockout group (ANXA1 NKO Ly6C in mouse liver low The proportion of type II macrophages was significantly lower than that of wild-type (WT) mice.

[0142] 4. Western blot analysis to detect the expression of the proliferation-related protein PCNA Liver tissue was collected 24 hours after intraperitoneal injection of APAP into mice of both genotypes. The expression of the proliferation-associated protein PCNA (antibody purchased from Wanleibio, cat#WL03213) was detected by Western blotting.

[0143] like Figure 3 As shown in Figure B, compared with the wild-type group (WT), the ANXA1 knockout group (ANXA1) NKO PCNA protein expression was significantly reduced in mouse liver tissue.

[0144] 5. IHC detection of Ki67 expression Liver tissue was collected 48 hours after intraperitoneal injection of APAP into mice of both genotypes. Ki67 expression (antibody purchased from Boster, cat#A00254) was detected according to the instructions of the IHC kit (purchased from Zhongshan Jinqiao, cat#PV-9000).

[0145] like Figure 3 As shown in Figure C, compared with the wild-type group (WT), the ANXA1 knockout group (ANXA1) NKO Ki67 mice + Fewer cells.

[0146] 6. qPCR detection of proliferation-related gene expression Liver tissue was collected 48 hours after intraperitoneal injection of APAP into mice of two genotypes. The mRNA levels of proliferation-related genes Cycin B1, Cyclin D1, and Cyclin A2 were detected by qPCR.

[0147] like Figure 3 As shown in Figure D, compared with the wild-type group (WT), the ANXA1 knockout group (ANXA1) NKO The expression of Cycin B1 and Cyclin A2 was significantly reduced in mice. Although there was no statistically significant difference in Cyclin D1 mRNA levels between the two groups, the ANXA1 knockout group (ANXA1) showed significantly lower expression compared to the wild-type group (WT). NKO The expression of Cyclin D1 in mice was reduced.

[0148] The above results indicate that neutrophil ANXA1-specific knockout delays liver repair.

[0149] Example 4: Ac2-26 can reduce liver damage and promote liver repair. 1. Ac2-26 Pretreatment Wild-type mice were pretreated with 1 mg / kg Ac2-26 (Ac2-26 dissolved in PBS, 100 μl / mouse intraperitoneally) 1 h before establishing the AILI model (same as step 1 in Example 1). A control group was also set up, with an equal volume of PBS replacing Ac2-26 (i.e.,...). Figure 4 (Vehicle in the Chinese illustration). 3-6 mice per group.

[0150] 2. AILI Modeling Same as step 1 in Example 1.

[0151] 3. H&E staining for detecting liver pathological damage Fresh liver tissue collected at 24 and 48 hours after intraperitoneal injection of APAP was fixed with 4% paraformaldehyde and properly stored at 4°C. The tissue was then embedded in paraffin according to a prescribed procedure. For the experiment, the paraffin blocks were cut into approximately 5 μm pieces and placed on detachable glass slides. Samples were prepared through steps including baking, dewaxing and rehydration, hematoxylin staining, differentiation, blue staining, eosin staining, dehydration, clearing, and mounting. The samples were then observed and images were acquired under a microscope.

[0152] like Figure 4 As shown in Figure A, Ac2-26 treatment reduced the area of ​​liver damage in mice compared to the control group (Vehicle).

[0153] 4. Detect serum AST levels Mice were anesthetized 24 and 48 hours after intraperitoneal injection of APAP, and blood was collected. The collected blood was allowed to stand at 4°C for 2 hours, then centrifuged at 3500 rpm for 10 minutes. The supernatant serum was aspirated. Serum AST levels were measured according to the instructions of the AST kit (purchased from Nanjing Jiancheng Biotechnology Institute, cat#C010-2-1).

[0154] like Figure 4 As shown in Figure B, compared with the control group (Vehicle), Ac2-26 significantly reduced serum AST levels in mice, demonstrating that Ac2-26 can alleviate liver damage.

[0155] 5. IHC detection of Ki67 Mice were sacrificed 48 hours after intraperitoneal injection of APAP, and their livers were collected. Ki67 was detected according to the instructions of the IHC kit (purchased from Zhongshan Jinqiao, cat#PV-9000).

[0156] like Figure 4 As shown in Figure C, Ac2-26 treatment significantly increased Ki67 levels compared to the control group (Vehicle). + Cell count.

[0157] 6. Western blot detection of PCNA expression Mice were intraperitoneally injected with APAP, and sacrificed 24 hours later, with livers collected. Western blotting was used to detect the expression of PCNA protein in the liver tissue.

[0158] like Figure 4 As shown in Figure D, Ac2-26 treatment significantly upregulated PCNA protein expression compared to the control group (Vehicle).

[0159] 7. qPCR detection of proliferation-related gene expression Mice were sacrificed 48 hours after intraperitoneal injection of APAP, and livers were collected to extract RNA. The mRNA levels of proliferation-related genes Cyclin D1, Cyclin A2, and Cyclin B1 were detected by qPCR.

[0160] like Figure 4 As shown in Figure E, the mRNA levels of Cyclin D1, Cyclin A2, and Cyclin B1 were all higher than those in the control group. Although there was no statistically significant difference in the expression of Cyclin D1 and Cyclin A2 between the two groups, this was likely due to large individual differences within each group. Overall, Ac2-26 treatment can upregulate proliferation-related expression.

[0161] The above results demonstrate that Ac2-26 can alleviate drug-induced liver injury and promote liver repair.

[0162] Example 5: Ac2-26 inhibits NETs and promotes N2 polarization of neutrophils. 1. Ac2-26 Pretreatment Wild-type mice were pretreated with 1 mg / kg Ac2-26 (Ac2-26 dissolved in PBS, 100 μl / mouse intraperitoneally) 1 h before establishing the AILI model (same as step 1 in Example 1). A control group was also set up, with an equal volume of PBS replacing Ac2-26 (i.e.,...). Figure 4 (Vehicle in the Chinese illustration). 3-6 mice per group.

[0163] 2. AILI Modeling Same as step 1 in Example 1.

[0164] 3. Western blotting to detect the expression of Arg-1, YM1, TNFα, ICAM-1, MPO, and CitH3. Mice were sacrificed 24 hours after intraperitoneal injection of APAP, and their livers were collected and liver tissue proteins were extracted. Western blotting was used to detect the expression of Arg-1, YM1, TNFα, ICAM-1, MPO, and CitH3 in the liver tissue. Arg-1 and YM1 labeled N2 neutrophils, TNFα and ICAM-1 labeled N1 neutrophils, and MPO and CitH3 labeled neutrophil extracellular traps (NETs).

[0165] like Figure 5 As shown in Figure A, compared with the control group (Vehicle), Ac2-26 treatment significantly upregulated the expression of N2-type neutrophil-associated protein and significantly inhibited the expression of N1-type and NETs-associated proteins.

[0166] 4. IF detection of NETs markers MPO and CitH3 Mice were sacrificed 24 hours after intraperitoneal injection of APAP, and their livers were collected and prepared into paraffin sections. The NETs markers MPO and CitH3 were detected using IF assay.

[0167] like Figure 5 As shown in Figure B, compared with the control group (Vehicle), the Ac2-26 group showed low expression of NETs markers MPO and CitH3. This demonstrates that Ac2-26 can inhibit NETs.

[0168] 5. Flow cytometry detection of neutrophil surface molecules Ly6G and CD206 Mice were anesthetized 24 h after intraperitoneal injection of APAP, and liver immune cells were extracted via in situ liver perfusion. The surface molecule Ly6G (FITC Rat Anti-mouse Ly6G, purchased from BDPharmingen) on neutrophils was detected by flow cytometry. TMThe expression of CD206 (PE Rat Anti-mouse CD206 purchased from BioLegend, cat#551460) was investigated, and neutrophil marker Ly6G and N2 marker CD206 were used to label the expression of CD206.

[0169] like Figure 5 As shown in Figure C, the Ac2-26 group expressed higher levels of the N2-type marker CD206 than the control group (Vehicle). This demonstrates that Ac2-26 promotes N2 polarization in neutrophils.

[0170] The above results indicate that Ac2-2 can inhibit NETs and promote N2 polarization of neutrophils.

[0171] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The use of the N-terminal active peptide Ac2-26 of annexin A1 in the preparation of products for the prevention and / or treatment of drug-induced liver injury.

2. Application of the N-terminal active peptide Ac2-26 of annexin A1 in the preparation of products for relieving symptoms of drug-induced liver injury.

3. The application according to claim 1 or 2, characterized in that: The drug-induced liver injury was acetaminophen-induced liver injury.

4. Application of the N-terminal active peptide Ac2-26 of annexin A1 in the preparation of products with any of the following functions: (A1) Reduces drug-induced liver injury; (A2) Promotes liver repair in the body caused by drug-induced liver injury; (A3) Promotes N2 polarization of intrahepatic neutrophils in patients with drug-induced liver injury; (A4) Inhibits extracellular traps of intrahepatic neutrophils in the body caused by drug-induced liver injury.

5. The application according to claim 4, characterized in that: The drug-induced liver injury was acetaminophen-induced liver injury.

6. A complete product for screening drugs, comprising the following (1) and (2): (1) Ac2-26, the N-terminal active peptide of annexin A1, which served as a positive control drug; (2) Recipient animals and acetaminophen used to prepare animal models of drug-induced liver injury; The drug in question is used to prevent drug-induced liver injury.

7. The application of the complete product according to claim 6 in drug screening; wherein the drug is a drug for preventing drug-induced liver injury.

8. A method for preparing an animal model of liver injury, comprising the following steps: (B1) Reduces the expression of ANXA1 protein in neutrophils of recipient animals; (B2) Administer an effective dose of acetaminophen to animals treated with (B1).

9. Substances that can reduce the expression of ANXA1 protein in neutrophils of recipient animals and the application of acetaminophen in the preparation of animal models of liver injury.

10. The application or method of the complete set of products according to any one of claims 6-9, characterized in that: The animal in question is a mouse.

Images