Use of rtn3l as a target in the preparation of a product for promoting axonal regeneration

Abstract

The application belongs to the technical field of biological medicine, and relates to application of Rtn3L as a target in preparation of a product for promoting axon regeneration, in particular to application of Rtn3L as a target in preparation of a product for promoting proliferation of neurons, axon elongation and / or promoting axon regeneration and / or treating spinal cord injury and / or assisting in ultrasonic treatment of spinal cord injury and / or detecting spinal cord injury. The application research finds that in a spinal cord injury mouse model, overexpression of Rtn3L can enhance GAP-43 up-regulation in a basic state and LIPUS induction, and accelerate sensory-motor recovery, thereby providing a new effective gene therapy method for treatment of the patients, and having a good application prospect in improving prevention and recovery of the spinal cord injury patients.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to the application of Rtn3L as a target in the preparation of products that promote axon regeneration. Specifically, it relates to the application of Rtn3L as a target in the preparation of products that promote neuronal proliferation and axon elongation, promote axon regeneration, treat spinal cord injury, and / or assist in ultrasound treatment of spinal cord injury. Background Technology

[0002] Spinal cord injury (SCI) is a devastating central nervous system disease, with a higher incidence in young and middle-aged individuals, often resulting in permanent motor, sensory, and autonomic dysfunction. In addition to the primary mechanical injury, secondary pathological cascades within the injured spinal cord (including vascular destruction, excitotoxicity and inflammatory signals, oxidative damage, demyelination, and glial scarring) continuously damage longitudinal axonal tracts, blocking descending input from higher centers to the spinal cord circuits. Once axons are severed, Wallerian degeneration occurs distally, while proximal stumps retract and form malnourished terminal bulbs instead of growth cones. The loss of permissive growth matrix and nutritional support, coupled with the accumulation of inhibitory cues, ultimately establishes a strong regenerative inhibitory niche, severely limiting the intrinsic growth capacity of central neurons and leading to a poor functional prognosis in SCI.

[0003] To overcome this unfavorable microenvironment and restore axonal continuity, researchers have explored various strategies. Transplantation of neural stem cells, embryonic stem cells, or induced pluripotent stem cells aims to replace missing cells and establish permissive cell bridges; epigenetic and RNA-related strategies (including microRNA regulation) attempt to reactivate intrinsic growth programs and modulate inflammation and glial responses. Biomaterial scaffolds, gene therapy, and drug interventions have also shown potential in promoting axonal regeneration and functional recovery in various preclinical models.

[0004] However, cell transplantation often suffers from low survival rates, uncertain differentiation, tumorigenic risks, and a narrow therapeutic window; scaffold implantation may induce immune responses or insufficient integration; and high-dose glucocorticoids (such as methylprednisolone) remain controversial due to unstable efficacy and the potential for increased adverse events. These limitations suggest the need for a controllable, minimally invasive alternative regulatory approach with spatiotemporal precision.

[0005] Physical stimulation is gaining attention as a novel intervention paradigm, with low-intensity pulsed ultrasound (LIPUS) showing promise as a mechanical therapy method. LIPUS utilizes low-energy sound waves (1–100 mW·cm²). -2LIPUS can penetrate deep tissues and focus on specific targets, providing a clinically compatible, non-invasive tool to modulate neural circuits and the injury microenvironment. Previous experimental studies have shown that LIPUS can activate the spinal cord network, upregulate the neuronal K-Cl cotransporter KCC2, improve motor performance, and reduce spasticity after spinal cord injury (SCI). In other central nervous system injury models, LIPUS can increase the expression of brain-derived neurotrophic factor (BDNF) and inhibit pro-inflammatory mediators such as cyclooxygenase-1 / 2 (COX1 / 2) and inducible nitric oxide synthase (iNOS), thereby promoting tissue repair and analgesia. This evidence suggests that the mechanical energy delivered by ultrasound can be converted into biochemical signals that promote neuroprotection and regeneration. However, in the field of SCI, the application of LIPUS is still largely empirical, and the molecular effectors that transduce ultrasound mechanical stimulation into axonal regeneration responses lack a clear definition.

[0006] In recent years, advancements in proteomics, single-cell transcriptomics, and viral vector gene manipulation have made it possible to systematically analyze various mechanotransduction pathways in vivo. Currently, there is no research on molecular effector factors that transduce axonal regeneration responses through ultrasound-mechanical stimulation. Summary of the Invention

[0007] The purpose of this invention is to provide the application of Rtn3L as a target in the preparation of products that promote axon regeneration, and to explain the molecular effector of ultrasound mechanical stimulation transduction into axon regeneration response.

[0008] To achieve the above objectives, the present invention is implemented using the following technical solution:

[0009] In a first aspect, the present invention provides the application of Rtn3L as a target in the preparation of products that promote neuronal proliferation and axonal elongation and / or promote axonal regeneration and / or treat spinal cord injury and / or assist ultrasound treatment of spinal cord injury and / or detect spinal cord injury.

[0010] Furthermore, the promotion of neuronal proliferation and axonal elongation and / or axonal regeneration includes promoting neuronal proliferation and axonal elongation and / or axonal regeneration in in vitro models and / or spinal cord injury models and / or spinal cord injury subjects.

[0011] Furthermore, the product promotes neuronal proliferation and axonal elongation and / or axonal regeneration by promoting Rtn3L expression and / or function, and / or treats spinal cord injury and / or assists in ultrasound treatment of spinal cord injury.

[0012] Furthermore, the promoters and methods for promoting Rtn3L expression and / or function include: Rtn3L gene expression vectors, mRNA delivery formulations encoding Rtn3L, CRISPR / dCas9-mediated Rtn3L transcriptional activation systems, Rtn3L gene small molecule compounds, Rtn3L gene-targeting nucleic acid drugs, Rtn3L gene epigenetic regulators, synthetic nanodelivery systems loaded with the Rtn3L gene, exosome delivery systems loaded with the Rtn3L gene, and 1~100mW·cm -2 One or a combination of low-intensity pulsed ultrasound stimulation.

[0013] Optionally, the ultrasonic intensity range of the low-intensity pulsed ultrasound stimulation is 1~100 mW·cm. -2 40~50mW·cm is preferred. -2 More preferably 42~48 mW·cm -2 .

[0014] Furthermore, the detection of spinal cord injury uses Rtn3L as a diagnostic marker, and spinal cord injury is detected by detecting the expression level of Rtn3L in the sample to be tested.

[0015] Furthermore, the product includes a vector that expresses the Rtn3L gene or its coding sequence in vivo and / or in vitro.

[0016] Furthermore, the vector includes one or a combination of several of the following: adeno-associated virus (AAV) vector, adenovirus vector, retrovirus vector, herpes simplex virus vector, plasmid vector, liposome vector, lipid nanoparticle vector, polymer nanoparticle vector, exosome vector, and virus-like particle vector.

[0017] Optionally, the AAV carrier is an AAV9 carrier.

[0018] Secondly, the present invention provides a product that uses Rtn3L as a target to promote neuronal proliferation and axonal elongation and / or promote axonal regeneration and / or treat spinal cord injury and / or assist ultrasound treatment of spinal cord injury and / or detect spinal cord injury, wherein the product contains substances that promote Rtn3L expression and / or function and / or substances that detect the Rtn3L expression level in the sample to be tested.

[0019] Furthermore, products that target Rtn3L to promote neuronal proliferation and axonal elongation and / or promote axonal regeneration and / or treat spinal cord injury and / or assist ultrasound treatment of spinal cord injury and / or detect spinal cord injury include drugs, kits and biological reagents.

[0020] Optionally, the kit includes a detection reagent for detecting Rtn3L protein or its gene or mRNA, the detection reagent including an Rtn3L-specific antibody or Rtn3L-specific primers.

[0021] Optionally, the detection chip in the kit includes a nucleic acid chip and a protein chip.

[0022] Optionally, the nucleic acid chip includes a substrate and specific oligonucleotide probes of SCI-related genes spotted on the substrate, wherein the specific oligonucleotide probes of SCI-related genes include probes that specifically bind to the Rtn3L gene or mRNA.

[0023] Optionally, the protein chip includes a substrate and specific antibodies against SCI-related proteins spotted on the substrate, wherein the specific antibodies against SCI-related proteins include specific antibodies against Rtn3L protein.

[0024] Optionally, the Rtn3L protein includes fusion proteins and non-fusion proteins.

[0025] Optionally, the test samples for the kit may include human cerebrospinal fluid samples or blood samples.

[0026] Thirdly, this invention provides the use of Rtn3L expression promoters in the preparation of products that promote neuronal proliferation and axonal elongation and / or promote axonal regeneration and / or treat spinal cord injury and / or assist in ultrasound treatment of spinal cord injury.

[0027] Fourthly, the present invention provides a method for promoting neuronal proliferation and axonal elongation and / or promoting axonal regeneration, comprising adding an Rtn3L expression promoter to a neuronal cell culture system, thereby promoting neuronal proliferation and axonal elongation and / or promoting axonal regeneration.

[0028] Optionally, the neuron is selected from one of the following: excitatory neurons of the central nervous system, motor neurons, sensory neurons, spinal cord-derived neurons, primary neurons, and neurons derived from induced pluripotent stem cells, preferably excitatory neurons of the central nervous system.

[0029] Fifthly, the present invention provides a method for screening candidate compounds for treating SCI, the method comprising the following steps:

[0030] The culture group was divided into a test group and a control group. The test compound was added to the culture system of the test group cells, and the expression level and / or activity of Rtn3L in the cells of the test group were observed. The control group cells were cultured in the same culture system without the test compound, and the expression level and / or activity of Rtn3L in the cells of the control group were observed.

[0031] Compounds in which the expression level and / or activity of Rtn3L in the test group was greater than that in the control group were selected as candidate compounds for treating SCI that promote the expression and / or activity of Rtn3L.

[0032] Optionally, the cells include one or a combination of glial cells, excitatory neurons of the central nervous system, motor neurons, sensory neurons, spinal cord-derived neurons, primary neurons, induced pluripotent stem cell-derived neurons, neuron-like cells, PC12 cells, neural stem / progenitor cells, astrocytes, oligodendrocytes, oligodendrocyte precursor cells, microglia, and Schwann cells.

[0033] Optionally, the method further includes: detecting the promoting effect of test compounds with higher Rtn3L expression levels and / or activity than the control group on neuronal proliferation, axonal elongation, and / or axonal regeneration. Specifically, the culture group is divided into a test group and a control group. The test compound is added to the culture system of the test group cells, and the number and / or growth of neurons in the test group are observed. The control group is cultured in the same cell culture system without the addition of the test compound, and the number and / or growth of neurons in the control group are observed. Test compounds with a higher number of neurons or a higher growth rate in the test group than in the control group are selected as candidate compounds for treating SCI that promote neuronal proliferation, axonal elongation, and / or axonal regeneration.

[0034] In a sixth aspect, the present invention provides a method for inhibiting or treating SCI, comprising: administering Rtn3L protein, a gene therapy drug targeting Rtn3L, or an Rtn3L gene expression promoter to a subject to be treated, wherein the gene therapy drug is an Rtn3L gene expression vector.

[0035] Optionally, the object may be a human or a non-human mammal, including rats or mice.

[0036] Optionally, the Rtn3L gene expression vector is selected from one or more of the following groups: AAV vectors, lentiviral vectors, adenovirus vectors, retroviral vectors, herpes simplex virus vectors, plasmid vectors, liposome vectors, lipid nanoparticle vectors, polymer nanoparticle vectors, exosome vectors, and virus-like particle vectors.

[0037] Beneficial effects

[0038] The embodiments of the present invention show that Rtn3L is stably elevated during SCI repair. Rtn3L can be used as a biomarker for SCI detection, for assessing the risk of SCI, assisting in detection, or providing early risk warning. The results of Rtn3L gene overexpression intervention in SCI mice show that, at the level of function-related molecules, Rtn3L overexpression can enhance basal state and LIPUS-induced upregulation of GAP-43 (growth-associated protein-43), while Rtn3L silencing completely blocks these responses. Changes in Basso Mouse Scale (BMS) scores, horizontal ladder test, Von Frey (mechanical pain threshold), and Hargreaves (thermal pain response time) in mice under different treatment groups indicated that the molecular dependence of Rtn3L was also reflected at the behavioral level. Rtn3L overexpression accelerated sensorimotor recovery, achieving performance comparable to LIPUS alone; while Rtn3L knockdown eliminated the effects of LIPUS, resulting in persistent motor and sensory deficits. Electrophysiological recordings verified the same dependence at the systemic level. LIPUS could restore descending conduction by increasing the amplitude of motor evoked potentials (MEPs) and shortening the latency. This rescue effect disappeared after Rtn3L silencing, while Rtn3L overexpression alone could partially restore conduction. This suggests that Rtn3L determines the transmissibility of the lower circuit signal under ultrasound stimulation.

[0039] This study establishes an integrated framework of physical stimulation and molecular control, proposing an engineerable and mechanistically explainable spinal cord repair strategy. Within a discrete treatment window, LIPUS reconstructs the structural substrate connecting axons and myelin sheaths, transforming the injured spinal cord into a state that allows conduction. In this framework, Rtn3L, as a key mechanotransduction node, is activated through ER-membrane remodeling and growth-related procedures such as GAP-43, coupling acoustic input to regenerative execution. Rtn3L simultaneously meets the sufficiency and necessity criteria, providing a molecular anchor for non-invasive ultrasound-assisted ordered axonal regeneration. Nucleic acid inhibitors or drug compositions targeting Rtn3L show potential application prospects in the prevention and treatment of thoracic and spinal cord injuries. Attached Figure Description

[0040] To more clearly illustrate the technical solutions in the embodiments of this disclosure or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0041] Figures 1-3 Figure 1 shows the experimental results of low-intensity pulsed ultrasound (LIPUS) promoting the recovery of sensorimotor function after spinal cord injury; among them, Figure 1A represents the experimental procedures for establishing a spinal cord hemisection injury model, the LIPUS intervention timeline, and behavioral, electrophysiological, imaging, histological, and molecular testing. Figure 1 Chinese B, C, D and Figure 2 In the middle A, the changes in BMS score, horizontal ladder test, mechanical pain threshold (Von Frey), and thermal pain response time (Hargreaves) of mice after treatment with different ultrasound intensities are shown respectively. Figure 2 Chinese B, C, D and Figure 3 The values ​​of A and B are 45 mW·cm. -2 Changes in BMS scores, horizontal ladder test, mechanical pain threshold (Von Frey), and thermal pain response time (Hargreaves) in mice in the S, S+LIPUS, SCI, and SCI+LIPUS groups after LIPUS treatment; Figure 3 B, C, and D are 45 mW·cm -2 Representative waveforms (recorded by clinical electrophysiological system), amplitude, and latency of motor evoked potentials (MEPs) in mice in the S, S+LIPUS, SCI, and SCI+LIPUS groups after LIPUS treatment.

[0042] Figures 4-5 Figure 1 shows the experimental results of LIPUS in improving tissue structural integrity and axonal microstructure after spinal cord injury; among them, Figure 4 In the middle A, the results of T2-weighted magnetic resonance imaging and diffusion tensor imaging of the spinal cord in the injury area of ​​mice in each group are shown. Figure 4 Image B shows the results of DAPI and NF-200 immunofluorescence staining, used to show the distribution, continuity and arrangement of axons in the damaged area; Figure 4 In the middle C, the results of transmission electron microscopy observations of spinal cord tissues in each group are used to show changes in axons, myelin sheaths and ultrastructure. Figure 5 A, B, and C represent the quantitative analysis results of average axonal diameter, number of myelinated axons, and G-ratio, respectively. (Statistical notes: n=4 for each proteomics group; n=3 for each group of Western blotting, RT-qPCR, and in vitro cell experiments; n=10 or 5 for animal behavior, electrophysiology, histopathology, and ultrastructure groups; 4 for histopathology; 5 for ultrastructure).

[0043] Figures 6-7 The figure shows the results of proteomics analysis of spinal cord tissues from the SCI group and the SCI+LIPUS group; among them... Figure 6 Results of GO enrichment analysis of differentially expressed proteins; Figure 7 Clustering heatmap of differentially expressed proteins in spinal cord tissue of the SCI+LIPUS group.

[0044] Figures 8-12Figure 1 shows the experimental results of single-cell transcriptomics analysis and the dynamic changes of Rtn3L after SCI and the changes in expression after LIPUS intervention; among them, Figure 8 The overall expression distribution of Rtn3L in single-cell transcriptome data; Figure 9 UMAP clustering results for different cell populations in spinal cord tissue; Figure 10 The expression differences of Rtn3L in different cell types between the S group and the SCI group; Figure 11 Immunofluorescence staining results of DAPI, NF-200 and Rtn3L for the S, S+LIPUS, SCI and SCI+LIPUS groups; Figure 12 In the middle section, A and B show the expression (results of Western blot analysis) and quantification of Rtn3L protein in spinal cord tissue of group S and at 1, 3, 7, 14 and 28 days after SCI, respectively. Figure 12 In the figures, C and D, E show the protein expression of Rtn3L and GAP-43 and the quantitative results of Rtn3L and GAP-43 in the S, S+LIPUS, SCI and SCI+LIPUS groups, respectively.

[0045] Figures 13-15 The figure shows the experimental results of LIPUS promoting Rtn3L expression and axonal elongation in damaged neuron-like cells in vitro; among them, Figure 13 The experimental procedure for nerve growth factor (NGF) induced differentiation, establishment of scratch injury model, LIPUS intervention every 4 hours and subsequent detection; Figure 14 In Figure A, cell viability test results are shown after treatment with different ultrasound intensities. Figure 14 Figures B and C show the expression and quantification of Rtn3L protein at different time points after scratch injury, respectively. Figure 14 In the middle D and E, F are the results of Rtn3L and GAP-43 protein expression, Rtn3L quantification and GAP-43 quantification in the Ctl, LIPUS, I and I+LIPUS groups, respectively. Figure 15 and Figure 14 G represents the results of DAPI and NF-200 immunofluorescence staining and quantitative analysis of average axon length for the four groups mentioned above.

[0046] Figures 16-20 The figure shows the experimental results of regulating Rtn3L expression in vivo to verify its mediating LIPUS-mediated repair effect; among them, Figure 16 The experimental procedure for virus injection, SCI model establishment, LIPUS intervention and subsequent detection; Figure 18 In Figure A, the expression results of Rtn3L and GAP-43 proteins in the AAV-NC, Rtn3L-OE, and SCI+LIPUS groups are shown. Figure 17In the table, A, B, and C represent the relative mRNA expression of Rtn3L, and the quantitative results of Rtn3L and GAP-43 proteins in the AAV-NC, Rtn3L-OE, and SCI+LIPUS groups, respectively. Figure 18 Figure B shows the expression results of Rtn3L and GAP-43 proteins in the AAV-NC, Rtn3L-KD+LIPUS, and SCI+LIPUS groups. Figure 17 D, E, and F in the middle represent the relative mRNA expression of Rtn3L, and the quantitative results of Rtn3L and GAP-43 proteins in the AAV-NC, Rtn3L-KD+LIPUS, and SCI+LIPUS groups, respectively. Figure 19 In the middle, A, B, C and D represent the changes in BMS score, horizontal ladder test, mechanical pain threshold (Von Frey) and thermal pain response time (Hargreaves) of mice in the AAV-NC, Rtn3L-OE, Rtn3L-KD+LIPUS and SCI+LIPUS groups, respectively. Figure 20 In the table, A, B, and C represent the quantitative results of the representative waveforms, amplitudes, and latency periods of the MEP in the four groups mentioned above.

[0047] Figures 21-22 Figure 1 shows the experimental results of spinal cord structural repair and axonal ultrastructural changes after in vivo regulation of Rtn3L expression; among them, Figure 21 In the middle A, the magnetic resonance imaging and diffusion tensor imaging results of the spinal cord in the injury area of ​​the AAV-NC, Rtn3L-OE, Rtn3L-KD+LIPUS and SCI+LIPUS groups are shown. Figure 21 In Figure B, the results of DAPI and NF-200 immunofluorescence staining in the above four groups are shown. Figure 21 C represents the transmission electron microscopy observation results of the above four groups of spinal cord tissues; Figure 22 In the figures, A, B, and C represent the quantitative analysis results of average axonal diameter, number of myelinated axons, and G-ratio, respectively.

[0048] Figures 23-26 The figure shows the experimental results of in vitro regulation of Rtn3L expression to verify its mediating effect of LIPUS on axonal elongation; among them, Figure 24 China A and Figure 23 In the table, A, B, and C represent the results of Western blot analysis of proteins and the quantitative results of relative mRNA expression of Rtn3L, and protein expression of Rtn3L and GAP-43 in the LV-NC, Rtn3L-OE, and I+LIPUS groups, respectively. Figure 24 China B and Figure 23 D, E and F in the middle are the results of Western blot analysis of proteins and the quantitative results of relative mRNA expression of Rtn3L, Rtn3L-KD+LIPUS and I+LIPUS groups, respectively; Figure 25 China A and Figure 26In the middle A, the results of DAPI and NF-200 immunofluorescence staining and quantification of average axon length were obtained for the LV-NC, Rtn3L-OE and I+LIPUS groups, respectively. Figure 25 China B and Figure 26 In the figure, B represents the results of DAPI and NF-200 immunofluorescence staining and quantification of average axon length in the shRNA-NC, Rtn3L-KD+LIPUS, and I+LIPUS groups, respectively. LV-NC is the lentivirus negative control group, shRNA-NC is the shRNA negative control group, and I+LIPUS is the scratch injury combined with LIPUS group.

[0049] Figure 27 This is a schematic diagram illustrating the mechanism by which LIPUS promotes axonal regeneration after spinal cord injury by upregulating Rtn3L; the figure shows a spinal cord injury model receiving 45 mW·cm -2 After 30 minutes of low-intensity pulsed ultrasound, Rtn3L expression increased, accompanied by enhanced GAP-43-related axonal regeneration program and cell proliferation.

[0050] Explanation of abbreviations in the attached figures: SCI stands for spinal cord injury, S stands for sham surgery (Sham group), LIPUS stands for low-intensity pulsed ultrasound, LV stands for lentivirus, AAV stands for adeno-associated virus, NC stands for negative control, OE stands for overexpression, KD stands for knockdown, I stands for scratch injury (Injury group), Ctl (Control) is the control group for I, without injury treatment; DAPI, NF-200, GAP-43, MRI, DTI, TEM, BMS, and MEP are common names or abbreviations used in the experiment. Detailed Implementation

[0051] The above content is further illustrated below with specific embodiments, but it should not be construed as limiting the scope of the invention to the following embodiments. All technologies implemented based on the above content of this invention fall within the scope of this invention.

[0052] It should be understood that experimental methods in the following examples, unless otherwise specified, are generally performed under conventional conditions as described in *Molecular Cloning: A Laboratory Manual* (translated by Huang Peitang et al., Beijing: Science Press, 2002), or as recommended by the manufacturer (e.g., product instructions). Percentages and parts are by weight unless otherwise stated. Unless otherwise specified, the experimental materials and reagents used in the following examples are commercially available or can be prepared according to literature methods. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. As used herein, when referring to specifically enumerated numerical values, the term "about" means that the value can vary from the enumerated value by no more than 1%.

[0053] Spinal cord injury (SCI): SCI can induce endoplasmic reticulum (ER) stress, neuroinflammation, and axonal degeneration, forming a pathological niche that inhibits repair, thereby limiting functional recovery. Spinal cord injury can be classified according to etiology into traumatic spinal cord injury and non-traumatic spinal cord injury; according to injury mechanism into primary injury and secondary injury; according to pathological and functional status into complete injury and incomplete injury; and according to disease stage into acute phase, subacute phase, and chronic phase. Currently, the comprehensive treatment strategy for spinal cord injury mainly includes (1) acute phase intervention; (2) promoting regeneration and repair; and (3) symptom management. The Rtn3L protein, gene therapy drugs targeting Rtn3L, or Rtn3L gene expression upregulators of this invention can be applied to treat spinal cord injury, targeting the acute, subacute, and / or chronic repair phases, preferably from the subacute to the chronic repair phase. The affected cell types include neurons, oligodendrocytes, oligodendrocyte precursor cells, astrocytes, microglia, and neural stem / progenitor cells. Improved functional dimensions include motor function, sensory function, electrophysiological conduction, axonal structure, myelin state, and spinal cord tissue structural integrity. In embodiments of this invention, low-intensity pulsed ultrasound was observed to improve the above indicators by regulating Rtn3L expression.

[0054] This invention, for the first time, combines an optimized LIPUS stimulation protocol, quantitative proteomics, and single-cell RNA sequencing to depict the molecular atlas of spinal cord injury under ultrasound intervention conditions, and identifies the ER-associated protein Rtn3L as a key node in LIPUS responsiveness, undergoing remodeling in specific neuronal and glial cell populations. Furthermore, through in vivo AAV-mediated gene gain / loss manipulation and an in vitro scratch injury model, it examines whether LIPUS promotes axonal regeneration after spinal cord injury (SCI) in neurons and supporting cells via a Rtn3L-dependent mechanism. This study not only establishes LIPUS as an active driver of axonal regeneration after SCI, but also defines Rtn3L as an operable and interpretable mechanotransduction molecule, providing a basis for ultrasound neuromodulation strategies with optimizable parameters and traceable mechanisms in SCI repair.

[0055] Specifically, this study established a strategy based on low-intensity pulsed ultrasound (LIPUS) to actively drive axonal structural repair after spontaneous intracranial infarction (SCI) and identified Rtn3L as a key effector molecule in ultrasound mechanotransduction. In a mouse SCI model, 45 mW·cm -2LIPUS (30 min every 4 days) constitutes an effective stimulation window, improving sensorimotor function and enhancing motor evoked potentials (MEPs). At this intensity, LIPUS increases the density of neurofilament 200 (NF-200) positive axons, preserves myelinated fibers, and reduces lesion volume. Quantitative proteomics identified Rtn3L as a core molecule for LIPUS responsiveness: it decreases after SCI and recovers synchronously with the axonal regeneration marker GAP-43 under LIPUS influence. Single-cell RNA sequencing showed that Rtn3L is widely expressed in neuronal and glial cell populations and undergoes remodeling after SCI, upregulated in repair-related neurons, glial cells, and progenitor-like cell clusters. In vivo, AAV-mediated Rtn3L overexpression mimics some of the benefits of LIPUS, while Rtn3L knockdown attenuates these effects. In vitro, 45 mW·cm -2 LIPUS promotes axonal elongation of scratch-damaged neuron-like cells in a Rtn3L-dependent manner. In summary, this study clarifies Rtn3L as a mechanotransduction junction for LIPUS-promoted axonal structural repair and supports ultrasound neuromodulation targeting Rtn3L as a potential strategy for SCI treatment. Specific research details are as follows.

[0056] Example 1

[0057] 1. Materials and Methods

[0058] Animals: Adult female C57BL / 6 mice, aged 6-8 weeks and weighing 16-20 g, were purchased from Shanghai Chengxi Biotechnology Co., Ltd. All mice were housed in a specific pathogen-free (SPF) barrier environment and acclimatized for one week prior to the formal experiments. This experimental protocol was reviewed and approved by the Animal Ethics Committee of Soochow University, approval number SUDA20250304A08. After acclimatization, the mice were randomly divided into several experimental groups; blinding was used for subsequent behavioral assessments and imaging data collection. The exclusion criteria for mice were perioperative death or severe postoperative infection.

[0059] Sample Collection and Sampling: In vivo behavioral, MRI / DTI, and MEP assays were performed using live animals; proteomics, RT-qPCR, and Western blot assays were performed using spinal cord tissue from the injury center and adjacent areas, with fresh tissue used for proteomics and molecular assays; tissue immunofluorescence was performed using perfused and fixed frozen sections of the spinal cord; transmission electron microscopy was performed using ultrathin sections prepared from the injured area of ​​the spinal cord. In vitro experiments used NGF-induced differentiated PC12 cells and cell samples from scratch injuries.

[0060] Sample size and replicates: Four spinal cord tissue samples were used per group for proteomics; three independent biological replicates were used per group for Western blotting, RT-qPCR, and in vitro cell experiments. The number of animals per group for animal behavior, MRI / DTI, MEP, tissue immunofluorescence, and transmission electron microscopy were n = 10 or 5; 1; 4; 5; 3, respectively. Unless otherwise stated, error bars in the figures represent mean ± standard deviation.

[0061] Spinal cord hemisection model: C57BL / 6 mice were injected intraperitoneally with 100 mg / kg -1 ketamine with 10 mg·kg -1 Mice were anesthetized with xylazine; the laminectomy corresponding to the T9-T10 vertebrae was performed to expose the spinal cord, and a right hemisection was performed under a microscope, completely severing the ipsilateral hemimellar cord while preserving the contralateral side. Postoperatively, 0.05 mg / kg was injected subcutaneously. -1 Buprenorphine was used for analgesia, and the bladder was manually squeezed if necessary, depending on the mice's urination patterns.

[0062] Grouping: SCI mice used for parameter screening were subjected to 30, 45, and 60 mW·cm⁻¹, respectively. -2 LIPUS; efficacy assessment was divided into sham surgery group (S), sham surgery + low-intensity ultrasound pulse group (S+LIPUS), spinal cord injury group (SCI), and spinal cord injury + 45mW·cm -2 Low-intensity ultrasonic pulse group (SCI+LIPUS), with a low-intensity ultrasonic pulse intensity of 45 mW·cm -2 Gene regulation experiments were designed to be either an AAV negative control group (AAV-NC), an Rtn3L overexpression group (Rtn3L-OE), or an Rtn3L knockdown group (Rtn3L-KD), with or without the use of LIPUS. In in vitro experiments, LV-NC represents the lentivirus negative control group, Rtn3L-OE represents the lentivirus-mediated Rtn3L overexpression group, shRNA-NC represents the shRNA negative control group, and Rtn3L-KD+LIPUS represents the Rtn3L knockdown combined with LIPUS group; I represents the scratch injury group, and I+LIPUS represents the scratch injury combined with LIPUS group.

[0063] Rtn3L sequence information: The mouse Rtn3L referred to in this embodiment is the long isoform 1 of Reticulon-3, corresponding to UniProt Q9ES97-1, with RefSeq protein sequence number NP_001003934.1 and the reference sequence number of the encoding transcript being NM_001003934.2. The mouse Rtn3L coding sequence in the actual overexpression vector was designed with this publicly available sequence as a reference and confirmed by Sanger sequencing. The RNAi target sequence GGCCCTCAAACTCATTATTCG is listed in Table 1 and marked as SEQ ID NO.1.

[0064] In vivo LIPUS: In vivo LIPUS was performed on day 4 after SCI in mice, with treatment every 4 days until day 28 post-injury, each session lasting 30 minutes. A focused ultrasound system (model: Ito Ultrashortwave) was used for treatment. This system was purchased from Ito Ultrashortwave Co., Ltd., Japan, and employed a 1.5MHz transducer pulse mode with a pulse repetition frequency (PRF) of 1000Hz and a duty cycle of 20%. The spatial peak time mean acoustic intensity (Ispta) of the focused ultrasound system was set to 30, 45, or 60 mW·cm. -2 The effective radiation area of ​​the transducer's probe is approximately 3.9 cm². 2 The sound intensity was calibrated by the manufacturer and verified by a hydroacoustic needle. During treatment, mice were given mild inhalation anesthesia with isoflurane at a volume concentration of 1.0% to 1.5%, and the transducer probe was placed vertically on the skin surface corresponding to the T9 to T10 segments of the mice under the guidance of ultrasound coupling gel.

[0065] Intramedullary adeno-associated virus (AAV) injection: Recombinant adeno-associated virus (AAV9) serotype 9 was used as the gene delivery vector. Seven days prior to spinal cord injury modeling, AAV9 was injected into the mouse spinal cord parenchyma to ensure stable expression levels before injury. The specific injection procedure was as follows: After laminectomy at the T9-T10 segment in mice, a microinfusion pump was used to inject bilaterally at four sites: 0.5 mm anterior and posterior to the center of the spinal cord injury, 0.3 mm from the midline, and 0.8 mm below the dorsal surface. A total of two injection sites were used on each side. 1 μL of AAV9 virus suspension was injected at each site at a flow rate of 0.1 μL / min. -1 After injection, the microinjection needle should be left in place for 5 minutes to prevent backflow of the viral suspension along the needle path. The AAV9 virus carries an RNA interference target sequence that targets the intended gene, as shown in SEQ ID NO.1. The titer of the AAV9 viral suspension is approximately 5 × 10⁻⁶. 12Information on the AAV vector used for in vivo gene regulation (vg / mL) is shown in Table 1. After injection, the infection distribution of AAV9, the mRNA transcription level of the target gene, and the expression level of the target protein were detected by fluorescence microscopy, real-time quantitative PCR, and Western blotting, respectively, to verify the in vivo transduction efficiency and regulatory effect of AAV9.

[0066] Table 1: Information on AAV vectors used for in vivo gene regulation

[0067]

[0068] 2. Optimized LIPUS promotes sensory-motor function recovery.

[0069] 2.1 Behavioral assessment: BMS was performed at 7, 14, 21, and 28 dpi (Days Post Injury); fine gait was assessed using the horizontal ladder task; mechanical thresholds were measured using the electronic von Frey test; thermal latency was measured using the Hargreaves test; and body weight was recorded every 4 days.

[0070] Experimental results of LIPUS promoting the recovery of sensorimotor function after spinal cord injury, such as Figures 1-3 As shown, where, Figure 1 A represents the experimental procedures for establishing a spinal cord hemisection injury model, the LIPUS intervention timeline, and behavioral, electrophysiological, imaging, histological, and molecular testing. Figure 1 Chinese B, C, D and Figure 2 Figure A shows the changes in BMS score, horizontal ladder test, mechanical pain threshold (Von Frey), and thermal pain response time (Hargreaves) in mice after treatment with different ultrasound intensities. Figure 1 Middle B~D and Figure 2 Longitudinal behavioral analysis of the A group showed that LIPUS had a significant intensity-dependent effect after SCI. Although all intensities resulted in functional improvement compared to untreated SCI, differentiation gradually occurred among the groups starting from 21 dpi, with the 45 mW·cm group showing the most significant improvement. -2 The group exhibited greater and more sustained recovery in motor, coordination, and sensory readout; focusing on this effective strength, the present invention further analyzes the time dynamics of its recovery. Figure 2 B, C, D and Figure 3 The values ​​of A and B are 45 mW·cm. -2Changes in BMS scores, horizontal ladder test, mechanical pain threshold (Von Frey), and thermal pain response time (Hargreaves) in mice of the S, S+LIPUS, SCI, and SCI+LIPUS groups after LIPUS treatment showed that the BMS score increased early from 7 dpi, significantly separated from the untreated SCI score from 14 dpi, and remained stable until 28 dpi. Figure 2 In the horizontal ladder task (B), the number of foot missteps decreased from 14 dpi, indicating improved fine motor coordination. Figure 2 In the middle C), sensory recovery showed modality specificity: the mechanical threshold improved from 14 dpi; the latency of thermal pain reflex recovered even earlier, from 7 dpi, and approached the sham surgery level at 21 dpi. Figure 2 D, Figure 3 (A) Figure 2 Chinese B, C, D and Figure 3 As can be seen from A, there were no significant differences between the S and S+LIPUS groups in all motor and sensory indices.

[0071] 2.2 Motor evoked potential (MEP) detection: Recorded under anesthesia at 28 dpi using a clinical electrophysiological system; percutaneous needle electrodes were placed on the sensorimotor cortex for stimulation, with quadriceps muscle recording; stimulation intensity was 100 V single pulse, pulse width was 0.5 ms, and interval was 30 s; filtering was 10~3000 Hz, sampling was 10 kHz, and averaged 5 times; amplitude and latency were analyzed offline.

[0072] To assess whether behavioral recovery reflects the reconstruction of downlink conduction, this invention records MEPs. Figure 3 B, C, and D are 45 mW·cm -2 Quantitative results of representative waveforms, amplitudes, and latencies of MEP in mice treated with LIPUS in the S, S+LIPUS, SCI, and SCI+LIPUS groups; the results showed that SCI significantly reduced MEP amplitude and prolonged latency; while 45 mW·cm -2 LIPUS produced a robust electrophysiological rescue effect, manifested as increased amplitude and shortened latency.

[0073] In summary, 45mW·cm -2 Established as a functionally validated effective sound intensity, it can simultaneously improve motor, sensory, and electrophysiological functions after SCI, providing a rigorous parameter basis for subsequent mechanistic studies.

[0074] 3. LIPUS protects axons and reconstructs spinal cord microstructure

[0075] 3.1 Magnetic Resonance Imaging (MRI) and Diffusion Tensor Imaging (DTI): Scans were performed at 28 dpi on a 7.0T small animal MRI scanner; DTI sequences were used in 30 directions, with b-values ​​set to 0 s·mm. -2 and 750s·mm -2 The fiber bundles were reconstructed offline using diffusion tensor imaging data processing software (Diffusion Toolkit), and the reconstruction results were visualized using fiber bundle tracing visualization software (Track Vis).

[0076] Given that sustained recovery after spinal cord injury (SCI) requires the reconstruction of a structural framework conducive to conduction, this invention further evaluates whether the optimized LIPUS protocol can reshape the damaged structure. Experimental results of LIPUS improving tissue structural integrity and axonal microstructure after spinal cord injury are shown in the figure below. Figures 4-5 As shown, where, Figure 4 Image A shows the T2-weighted magnetic resonance imaging (MRI) and diffusion tensor imaging (DTI) results of the spinal cord injury area in each group of mice. The results indicate that MRI showed large high-signal cavities in the spinal cord injury area (SCI), accompanied by segmental collapse and blurred lesion boundaries; while 45 mW·cm²... -2 LIPUS can reduce the extent of injury and preserve the continuity of the spinal cord outline. DTI further suggests that the longitudinal fiber tracts in the spinal cord remain continuous in S and S+LIPUS, while SCI causes significant interruption and disorder of the ipsilateral fibers. After LIPUS treatment, some continuous fiber tract signals can be seen in the spinal cord on the injured side.

[0077] 3.2 Immunofluorescence of tissues: The tissues were fixed by perfusion with physiological saline and 4% paraformaldehyde (PFA); 10-15 μm frozen sections of spinal cord were prepared; rabbit anti-neurofilament heavy chain protein polyclonal antibody (Anti-NF-200) was used as the primary antibody (NF-200 was purchased from Proteintech Co., Ltd., catalog number 18934-1-AP, diluted 1:500); Alexa Fluor 488 fluorescently labeled secondary antibody was purchased from Invitrogen (Shanghai) Trading Co., Ltd., catalog number A-11008; DAPI (4',6-diamidinyl-2-phenylindole) counterstaining was performed; images were acquired using the same exposure method; and quantification was performed blinded using ImageJ image analysis software.

[0078] Figure 4Image B shows the results of DAPI and NF-200 immunofluorescence staining, used to display the distribution, continuity, and arrangement of axons in the damaged area. The results indicate that, at the tissue level, NF-200 immunofluorescence supports the repair of the aforementioned macroscopic structures. In SCI animals, axons within and around the damaged area were sparse, broken, and disorganized. LIPUS treatment significantly increased the NF-200 signal density and enhanced longitudinal alignment, forming a continuous, directional, tissue-based axonal scaffold spanning the damaged area. There was no difference between the S and S+LIPUS groups, suggesting that this optimized acoustic intensity does not disrupt the axonal structure of the intact spinal cord.

[0079] 3.3 Transmission electron microscopy (TEM): Damaged areas were fixed with 2.5% glutaraldehyde, then post-fixed with 1% osmium tetroxide, dehydrated and embedded; ultrathin sections were prepared at 70 nm; uranium staining and lead staining were performed; observation was conducted at 80 kV; image analysis software (ImageJ) was used to quantify axial diameter, myelin fiber density and G-ratio.

[0080] Figure 4 The middle C represents the transmission electron microscopy observation results of spinal cord tissue in each group, used to show changes in axons, myelin sheath and ultrastructure. The results show that axons in SCI tissue mostly show degeneration, including reduced axon diameter, axoplasmic vacuolation, thinning or rupture of myelin sheath, and a significant reduction in myelin fibers. In contrast, after LIPUS treatment, the spinal cord showed increased axon diameter, denser myelin sheath lamellae, and increased myelin fiber density. Figure 5 A, B, and C represent the quantitative analysis results of average axonal diameter, number of myelinated axons, and G-ratio, respectively. Morphometric quantitative analysis further confirms that the increased axonal diameter and myelin fiber density, and the decreased G-ratio, are consistent with enhanced myelination and improved skip conduction ability.

[0081] The aforementioned ultrastructural evidence supports the view that LIPUS can drive the transformation of the injured spinal cord from a fragmented, low-conductivity pathological environment to a structurally integrated state that maintains axonal integrity and myelin sheath density, providing a morphological basis for the conduction recovery and sensory-motor function improvement observed in vivo.

[0082] 4. Bioinformatics Analysis

[0083] 4.1 Analytical Methods

[0084] 4.1.1 Cells and In Vitro Models: PC12 cells were cultured and used at a final concentration of 50 ng / mL. -1Nerve growth factor (NGF) induced differentiation for 5–7 days; scratch injury was used to establish an in vitro model; cell viability was assessed using a Cell Counting Kit-8 (CCK-8). In vitro overexpression was performed using lentiviral infection with a multiplicity of infection (MOI) of 100, followed by selection with puromycin; knockdown was achieved by transfection with shRNA carrying the target gene using Lipofectamine 3000 (a highly efficient cationic liposome transfection reagent); axon length was quantified using NF-200 immunofluorescence and image analysis software (NeuronJ).

[0085] 4.1.2 Proteomics: Tissue samples from the spinal cord injury site of mice were collected at 28 dpi for label-free quantitative proteomics. Proteins in the tissue samples were identified and relatively quantified using liquid chromatography-tandem mass spectrometry (LC-MS / MS). Protein identification was performed by searching the UniProt mouse database, with a false positive rate (FDR) of <1%; the differential protein threshold (FC) was >2 and the corrected P < 0.05; the differentially expressed proteins were screened and enriched by GO / KEGG and analyzed by STRING network.

[0086] 4.1.3 Public Single-Cell RNA Sequencing (scRNA-seq): Obtain the datasets GSE275570, GSE281205, GSE202627, and GSE275982 from the Gene Expression Comprehensive Database (GEO) and process and integrate them using standard procedures.

[0087] 4.1.4 Real-time quantitative PCR (qPCR) and Western blot (WB): RNA was extracted using the guanidinium isothiocyanate-phenol (TRIzol) method, reverse transcribed into complementary DNA (cDNA), and then qPCR was performed using the cDNA as a template. The results were analyzed using a 2... ⁻ΔΔCt The relative expression levels of the target genes were calculated; Western blot was performed using β-actin as an internal control to detect the expression levels of Rtn3 (Rtn3 and Rtn3L are the short and long subtypes of the same gene, respectively) and GAP-43.

[0088] 4.1.5 Statistical analysis: Data analysis was performed using statistical software (GraphPad Prism 9.0); two-tailed unpaired t-tests were used for comparisons between two groups; one-way ANOVA was used for comparisons between multiple groups, supplemented by Tukey post-hoc tests for pairwise comparisons; P < 0.05 was considered significant.

[0089] 4.2 Analysis Results

[0090] 4.2.1 Multi-omics integration identifies Rtn3L as a key node in mechanotransduction.

[0091] This invention, for the first time, combines an optimized LIPUS stimulation protocol, quantitative proteomics, and single-cell RNA sequencing to depict the molecular atlas of spinal cord injury under conditions of ultrasound intervention and without intervention, and identifies the ER-associated protein Rtn3L as a key node in LIPUS responsiveness, which undergoes remodeling in specific neuronal and glial cell populations. Figure 27 This is a schematic diagram illustrating the mechanism by which LIPUS promotes axonal regeneration after spinal cord injury by upregulating Rtn3L. The figure shows 45 mW·cm -2 After 30 min of LIPUS treatment, Rtn3L expression increased, accompanied by enhanced GAP-43-related axonal regeneration program and cell proliferation.

[0092] To elucidate the molecular basis of LIPUS-driven regeneration, the inventors performed quantitative proteomics analysis on spinal cord tissues from the SCI and SCI+LIPUS groups. The results are as follows: Figures 6-7 As shown. Figure 6 Results of GO enrichment analysis for differentially expressed proteins; Figure 7Clustering heatmaps of differentially expressed proteins in spinal cord tissue from the SCI+LIPUS group show altered protein expression patterns between the SCI and SCI+LIPUS groups. Association analysis of differentially expressed proteins with GO items related to axonal growth and regeneration revealed that these proteins are widely involved in biological processes such as axonal injury response, axonal germination, axonogenesis, axonal elongation, axonal regeneration, axonal guidance, and axonal transport. The upregulated proteins mainly include Rtn3, Mag, Map1a, Map2, Map6, Nefh, Nefl, Nefm, Cntnap1, Cntnap2, Kif1a, Limk1, Gpm6a, Ina, Cdk5, Bsn, Rab3a, Rab3c, Rap1gap, etc.; the downregulated proteins mainly include Sik3, Snap91, Tuba1b, Tuba4a, Ap3b1, Apoa1, Apod, Apoe, Creb1, Hexa, Hexb, Hspb1, Itgb2, Ncstn, Palld, Rbp1, Stxbp2, and Vim, etc. The enriched axon-related GO biological processes mainly include: response to axon injury, germination of damaged axons, formation of growth cones in damaged axons, collateral germination, axonogenesis, axon regeneration, axon extension, axon guidance, motor neuron axon guidance, axon targeting recognition, axon fasciculation, axon transport, mitochondrial axon transport, anterograde and retrograde axon transport, axon myelination, and axon development. The enrichment results show that Rtn3 is located in the upregulated differentially expressed protein region and is associated with multiple axon growth and repair-related GO entries in the string diagram, with a relatively prominent connection range. Unlike proteins that are solely involved in a single axonal structural process, Rtn3 simultaneously falls into a functional network consisting of "axon injury response—axon germination / extension—axon regeneration," indicating that Rtn3 may be an important candidate molecule connecting differentially expressed protein changes with axonal remodeling phenotypes. Therefore, based on subsequent experimental verification, Rtn3 can be further studied as a key candidate target for mechanism research.

[0093] Evidence from proteomics, pathway enrichment, and single-cell transcriptomics consistently points to Rtn3L as a key mechanotransduction node in the injured spinal cord that is highly responsive to LIPUS. LIPUS reactivation and redistribution of Rtn3L reshapes the ER-membrane-cytoskeleton interface, establishing molecular connections between mechanical stimulation and regenerative processes. In summary, this study establishes Rtn3L as the molecular entry point for ultrasound neuromodulation in SCI repair.

[0094] 4.2.2 Rtn3L undergoes LIPUS-induced activation and spatial reorganization in vivo and in vitro.

[0095] Given Rtn3L's key candidate status, this invention further analyzes its dynamic changes at different stages after injury. Single-cell transcriptomics analysis and experimental results showing the dynamic changes of Rtn3L after SCI and expression changes after LIPUS intervention are shown in the figure below. Figures 8-12 As shown. Figure 8 The overall expression distribution of Rtn3L in single-cell transcriptome data. Figure 9 The results of UMAP clustering of different cell populations in spinal cord tissue. Figure 10 Comparison of Rtn3L expression in different cell types between the S group and the SCI group showed that Rtn3L underwent cell type-specific remodeling after SCI. Figure 12 In Figures A and B, the expression and quantification results of Rtn3L protein in Group S and at 1, 3, 7, 14, and 28 days after SCI are shown, respectively. The results indicate that Rtn3L increases in the early stage after SCI and then gradually decreases. Figure 12 C, D, and E represent the expression and quantification results of Rtn3L and GAP-43 proteins in the S, S+LIPUS, SCI, and SCI+LIPUS groups, respectively, showing that the expression of Rtn3L and GAP-43 is increased in the SCI+LIPUS group. Figure 11 The results of DAPI, NF-200 and Rtn3L immunofluorescence staining in the above four groups were used to show the spatial distribution of Rtn3L in the injured spinal cord and its relationship with axonal structures.

[0096] To determine whether this regulatory logic remains consistent in simplified cell systems, this invention uses NGF-induced differentiated PC12 cells to establish an in vitro injury model. Figures 13-15 The figure shows the experimental results of LIPUS promoting Rtn3L expression and axonal elongation in damaged neuron-like cells in vitro; among them, Figure 14 In Figure A, cell viability was measured after treatment with different ultrasound intensities. CCK-8 cell viability assessment revealed an effective acoustic window: 45 mW·cm⁻¹. -2 The protection of cell viability is most significant, and 60mW·cm -2 A decrease in cell viability was observed; accordingly, the present invention applies LIPUS at 4-hour intervals after scratch injury and tracks the dynamics of Rtn3L within a 0-24 hour window. Figure 13 The in vitro experimental procedure for NGF-induced differentiation, scratch injury model establishment, LIPUS intervention every 4 hours and subsequent detection; Figure 14 Figures B and C show the changes in Rtn3L protein expression and their quantitative analysis results at different time points after scratch injury, respectively. Figure 14D, E and F in the middle are the changes in Rtn3L and GAP-43 protein expression, the quantitative analysis results of Rtn3L and GAP-43 respectively in the Ctl, LIPUS, I and I+LIPUS groups. The results show that GAP-43 also showed a consistent trend. Figure 15 and Figure 14 In the figure, G represents the results of DAPI and NF-200 immunofluorescence staining and the quantitative analysis of average axon length, respectively. The results showed that the cell processes in the LIPUS treatment group were significantly elongated. In this article, I represents the scratch injury group, I+LIPUS represents the scratch injury combined with LIPUS group, and the Ctl group did not receive scratch treatment.

[0097] In summary, both in vivo and in vitro evidence support the view that injury induces a temporally inhibited and spatially disordered state in Rtn3L, which LIPUS can selectively reverse. By reactivating Rtn3L and restoring its alignment with the axonal structure interface, LIPUS shifts the post-injury environment from a degenerative-dominated state to one that allows axonal extension, thereby achieving cross-scale transduction from mechanical input to regenerative output.

[0098] 4.2.3 Rtn3L is an essential factor for LIPUS-induced axonal regeneration in vivo.

[0099] To directly examine the causal role of Rtn3L in LIPUS-mediated axonal repair, this invention incorporates bidirectional viral manipulation of Rtn3L into an optimized ultrasound protocol, thereby simultaneously assessing its adequacy and necessity. The experimental results demonstrating the in vivo regulation of Rtn3L expression to verify its LIPUS-mediated pro-repair effect are shown in the figure below. Figures 16-20 As shown. Among them, Figure 16 The experimental procedure for Rtn3L overexpression or knockdown viral injection, SCI model establishment, LIPUS intervention and related detection; Figure 18 In Figure A, the expression results of Rtn3L and GAP-43 proteins in the AAV-NC, Rtn3L-OE, and SCI+LIPUS groups are shown. Figure 17 In the figures, A, B, and C represent the relative mRNA expression of Rtn3L, and the quantitative results of Rtn3L and GAP-43 proteins in the AAV-NC, Rtn3L-OE, and SCI+LIPUS groups, respectively. These figures illustrate the changes in the mRNA and protein expression of Rtn3L and GAP-43 after Rtn3L overexpression. Figure 18 Figure B shows the expression results of Rtn3L and GAP-43 proteins in the AAV-NC, Rtn3L-KD+LIPUS, and SCI+LIPUS groups. Figure 17Figures D, E, and F show the relative mRNA expression of Rtn3L, and the protein quantification results of Rtn3L and GAP-43 in the AAV-NC, Rtn3L-KD+LIPUS, and SCI+LIPUS groups, respectively. These figures illustrate the changes in mRNA and protein expression of Rtn3L and GAP-43 after Rtn3L knockdown. The results indicate a consistent dependence on Rtn3L at multiple readout levels, including molecular, functional, and structural aspects. Firstly, RT-qPCR and Western blotting validated the effective overexpression and knockdown of Rtn3L in vivo. Figure 17 A, B, D, and E in the middle. Figure 18 In both A and B), at the level of function-related molecules, Rtn3L overexpression enhances basal state and LIPUS-induced upregulation of GAP-43, while Rtn3L silencing completely blocks these responses. Figure 17 B, C, E, F Figure 18 (A, B) This suggests that Rtn3L is located upstream of the LIPUS-activated regenerative switch, rather than being passively correlated; Figure 19 A, B, C, and D represent the changes in BMS scores, horizontal ladder test, mechanical pain threshold (Von Frey), and thermal pain response time (Hargreaves) in mice of different treatment groups, respectively. The results show that the molecular dependence of Rtn3L is also reflected at the behavioral level. Rtn3L overexpression can accelerate sensorimotor recovery, achieving performance comparable to LIPUS alone; while Rtn3L knockdown eliminates the effects of LIPUS, manifesting as persistent motor and sensory deficits. This indicates that Rtn3L is the functional gate that determines the behavioral efficacy of LIPUS after SCI. Figure 20 In the figures A, B, and C, the representative waveforms, amplitudes, and latencies of the MEP in mice from different treatment groups are quantitative results. Electrophysiological recordings at the systemic level confirmed the same dependence. LIPUS can restore descending conduction by increasing MEP amplitude and shortening latency. This rescue effect disappears after Rtn3L silencing, while Rtn3L overexpression alone can partially restore conduction. This suggests that Rtn3L determines the transmissibility of the circuit signal under ultrasound stimulation.

[0100] Multimodal structural analysis further revealed that Rtn3L deficiency blocks LIPUS's ability to reconstruct the microstructures required for long-range connectivity. The experimental results of spinal cord structural repair and axonal ultrastructural changes after in vivo regulation of Rtn3L expression are shown in the figure below. Figures 21-22 As shown; where, Figure 21In the middle section, A represents the magnetic resonance imaging and diffusion tensor imaging results of the spinal cord in the injury area of ​​the AAV-NC, Rtn3L-OE, Rtn3L-KD+LIPUS, and SCI+LIPUS groups. MRI and DTI showed that overexpression of LIPUS or Rtn3L could promote the restoration of fiber bundle continuity in the injury area; however, even with the same ultrasound stimulation, Rtn3L knockdown still prevented the reconstruction of directional fiber bundles. Figure 21 Image B shows the results of DAPI and NF-200 immunofluorescence staining, used to show the continuity and structural arrangement of axons in the damaged area. The NF-200 immunofluorescence at the tissue level also showed the same pattern as MRI and DTI: Rtn3L silencing eliminated LIPUS-induced axonal continuity and longitudinal alignment restoration. Figure 21 C shows the transmission electron microscopy observation results of each group of spinal cord tissues. Figure 22 In the figures A, B, and C, the quantitative analysis results of average axonal diameter, number of myelinated axons, and G-ratio are respectively. Figure 21 C, Figure 22 Histological and ultrastructural analyses of the A-C groups confirmed that Rtn3L knockdown eliminates LIPUS-mediated cytoskeleton tissue restoration, axonal diameter expansion, myelin densification, and G-ratio normalization.

[0101] In summary, this structural evidence suggests that Rtn3L is a structural gate necessary for LIPUS to drive axonal regeneration: LIPUS relies on Rtn3L to translate biophysical stimuli into the molecular and ultrastructural programs required for axonal reconstruction, myelin remodeling, and spinal cord conduction restoration.

[0102] 4.2.4 Rtn3L drives Lipus-mediated axonal elongation in vitro

[0103] LIPUS-induced axonal elongation is expected to depend primarily on the axon's intrinsic growth program rather than systemic factors. Therefore, the inventors evaluated the role of Rtn3L in an in vitro axonal injury model to directly verify its adequacy and necessity in inducing axonal growth through mechanical stimulation.

[0104] Figures 23-26 Figure showing experimental results demonstrating the in vitro regulation of Rtn3L expression and its mediating effect of LIPUS on axonal elongation; among which, Figure 24 China A and Figure 23 In the table, A, B, and C represent the results of Western blot analysis of proteins and the quantitative results of relative mRNA expression of Rtn3L, and protein expression of Rtn3L and GAP-43 in the LV-NC, Rtn3L-OE, and I+LIPUS groups, respectively. Figure 24 China B and Figure 23D, E and F in the middle are the results of Western blot analysis of proteins and the quantitative results of relative mRNA expression of Rtn3L, Rtn3L-KD+LIPUS and I+LIPUS groups, respectively; Figure 25 China A and Figure 26 In the middle A, the results of DAPI and NF-200 immunofluorescence staining and quantification of average axon length were obtained for the LV-NC, Rtn3L-OE and I+LIPUS groups, respectively. Figure 25 China B and Figure 26 In the figure, B represents the results of DAPI and NF-200 immunofluorescence staining and quantification of average axon length in the shRNA-NC, Rtn3L-KD+LIPUS, and I+LIPUS groups, respectively. In the figure, LV-NC represents the lentivirus negative control group, Rtn3L-OE represents the lentivirus-mediated Rtn3L overexpression group, shRNA-NC represents the shRNA negative control group, and Rtn3L-KD+LIPUS represents the Rtn3L knockdown combined with LIPUS group; I represents the scratch injury group, and I+LIPUS represents the scratch injury combined with LIPUS group.

[0105] These results indicate that Rtn3L is not merely associated with LIPUS-induced regeneration, but is mechanistically essential. Rtn3L enables axons to elongate in response to mechanostimulation; when overexpressed, it can, to some extent, substitute for LIPUS in activating intrinsic growth programs. Combined with in vivo results, Rtn3L is established as a core mechanotransduction mediator for axonal repair.

[0106] The results of this embodiment show that, under the experimental conditions, 45 mW·cm -2 LIPUS can improve sensory-motor behavior, electrophysiological signals, tissue structure in the damaged area, and axon / myelin-related indices in SCI mice, and can restore some expression of Rtn3L and GAP-43 after SCI. In vivo Rtn3L overexpression produces improvements consistent with LIPUS, while Rtn3L knockdown weakens the effects of LIPUS on tissue structure and function. In vitro experiments further show that Rtn3L overexpression promotes axon elongation in neuron-like cells, and Rtn3L knockdown weakens LIPUS-induced axon elongation. These results support Rtn3L as a regulatory node for LIPUS-promoted axonal structural repair after SCI.

[0107] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of Rtn3L as a target in the preparation of products that promote neuronal proliferation and axonal elongation and / or promote axonal regeneration and / or treat spinal cord injury and / or assist ultrasound treatment of spinal cord injury and / or detect spinal cord injury.

2. The application according to claim 1, characterized in that, The promotion of neuronal proliferation and axonal elongation and / or axonal regeneration includes promoting neuronal proliferation and axonal elongation and / or axonal regeneration in in vitro models and / or spinal cord injury models and / or subjects with spinal cord injury.

3. The application according to claim 1, characterized in that, The product promotes neuronal proliferation and axonal elongation and / or axonal regeneration by enhancing Rtn3L expression and / or function, and / or treats spinal cord injury and / or assists in ultrasound treatment of spinal cord injury.

4. The application according to claim 3, characterized in that, The promoters and methods for promoting Rtn3L expression and / or function include: Rtn3L gene expression vectors, mRNA delivery agents encoding Rtn3L, CRISPR / dCas9-mediated Rtn3L transcriptional activation systems, Rtn3L gene small molecule compounds, Rtn3L gene-targeting nucleic acid drugs, Rtn3L gene epigenetic regulators, synthetic nanodelivery systems loaded with the Rtn3L gene, exosome delivery systems loaded with the Rtn3L gene, and low-intensity pulsed ultrasound stimulation, or a combination of several of these.

5. The application according to claim 1, characterized in that, The detection of spinal cord injury uses Rtn3L as a diagnostic marker, and spinal cord injury is detected by detecting the expression level of Rtn3L in the sample to be tested.

6. The application according to claim 1, characterized in that, The product includes a vector that expresses the Rtn3L gene or its coding sequence in vivo and / or in vitro.

7. The application according to claim 6, characterized in that, The vector includes one or a combination of several of the following: AAV vector, adenovirus vector, retrovirus vector, herpes simplex virus vector, plasmid vector, liposome vector, lipid nanoparticle vector, polymer nanoparticle vector, exosome vector, and virus-like particle vector.

8. A product that uses Rtn3L as a target to promote neuronal proliferation and axonal elongation and / or promote axonal regeneration and / or treat spinal cord injury and / or assist in ultrasound treatment of spinal cord injury and / or detect spinal cord injury, characterized in that, The product contains substances that promote Rtn3L expression and / or function and / or substances that detect the Rtn3L expression level in the sample to be tested.

9. The product according to claim 8, characterized in that, The product is a drug, reagent kit, or biological reagent.

10. Application of Rtn3L expression promoter in the preparation of products that promote neuronal proliferation and axonal elongation and / or promote axonal regeneration and / or treat spinal cord injury and / or assist in ultrasound treatment of spinal cord injury.

Images