Selenoadenosine and preparation method thereof and application thereof in m6a spatial transcriptome detection

Abstract

The application provides a seleno-bis-dioxynucleoside, a preparation method thereof and application thereof in m6A spatial transcriptome detection, and the structure of the seleno-bis-dioxynucleoside is shown in the following formula: The seleno-bis-dioxynucleoside provided by the application shows significant differential response to A and m6A on a template strand when used as a reverse transcription substrate, while maintaining good incorporation efficiency, ensuring the sensitivity and specificity of a detection signal, and being suitable for detection of a low-abundance m6A site. The application provides a preparation method of the seleno-bis-dioxynucleoside, and the preparation method is simple and easy to industrialize.

Description

Technical Field

[0001] This invention relates to the field of functional gene technology, and in particular to a selenodylhadexy nucleoside, its preparation method, and its application in m6A spatial transcriptome detection. Background Technology

[0002] In existing technologies, m6A detection primarily relies on high-throughput sequencing, and its development has gone through several stages. Initially, immunoprecipitation combined with sequencing based on m6A-specific antibodies (such as MeRIP-seq / m6A-seq) achieved m6A localization at the whole transcriptome level, but its resolution was only 100-200 nucleotides and heavily dependent on antibody quality. Subsequent cross-linked immunoprecipitation methods (such as miCLIP and PA-m6A-seq) improved the resolution to the single-base level, but these methods typically require complex RNA fragmentation, immunoprecipitation, and library construction steps, leading to the complete loss of the original spatial location information of the RNA.

[0003] In recent years, the rise of spatial transcriptomics technologies (such as 10x Visium and Slide-seq) has made it possible to preserve and interpret spatial information of gene expression in situ within tissues, greatly advancing our understanding of the tissue microenvironment and disease pathology. However, existing spatial transcriptomics technologies generally cannot detect the chemical modification status of RNA. Based on the process of reverse transcriptase converting RNA into cDNA, they cannot distinguish between modified (e.g., m6A) bases and unmodified bases. Therefore, mapping the spatial distribution of m6A remains a significant technological gap.

[0004] Therefore, there is an urgent need in this field to develop a method that can directly and in situ distinguish between A and m6A bases during reverse transcription elongation and is highly compatible with existing spatial transcriptome platforms. Summary of the Invention

[0005] To address the problems in existing technologies, an ideal solution is to design and develop precisely designed modified nucleoside triphosphate analogs. When used as substrates for reverse transcription, these molecules exhibit differentiated incorporation behavior in response to either A or m6A on the template strand. However, rationally designing and synthesizing customized nucleoside triphosphates that possess high discriminative power, high incorporation efficiency, and good compatibility with commercial reverse transcriptases and spatial transcriptomics workflows remains a key challenge spanning organic synthetic chemistry and molecular biology.

[0006] This invention aims to address the problems existing in the prior art and provides a selenodyl-2-deoxynucleoside, the structure of which is shown below: .

[0007] Preferably, the selenoside shown is prepared from dideoxythymidine.

[0008] Secondly, the present invention provides a method for preparing the above-mentioned selenoside-deoxynucleotide, wherein the reaction formula for preparing the selenoside-deoxynucleotide is shown below: .

[0009] Preferably, the preparation of selenosides includes the following steps: 1) Compound 1 reacts with benzoyl chloride to prepare compound 2; 2) The compound and 1,2,4-triazole react in the presence of phosphorus oxychloride to give compound 3; 3) Compound 3 reacts with di(2-cyanoethyl)diselenoether to give compound 5; 4) The 5'-OH and Se- protecting groups of compound 5 were removed to obtain compound 6; 5) Compound 6 was subjected to a triphosphorylation reaction with tributylammonium pyrophosphate to obtain the selenodideoxy nucleotide.

[0010] Thirdly, this invention provides an application of the above-mentioned selenodoxynucleotide or the selenodoxynucleotide prepared by the above-mentioned method in m6A spatial transcriptome detection. The schematic diagram of the application of the above-mentioned selenodoxynucleotide or the selenodoxynucleotide prepared by the above-mentioned method in m6A spatial transcriptome detection is shown below. Figure 1 As shown, specifically, selenodoxy-dideoxythymidine can pair with A during RNA reverse transcription elongation but cannot pair with m6A, thus distinguishing the A / m6A sites. When a circularized probe hybridizes with the target site, after selenodoxy-dideoxythymidine triphosphate elongation, the A site cannot form a loop, while the m6A site can still elongate and form a loop, amplifying the signal through rolling circle amplification.

[0011] Fourthly, the present invention provides a method for detecting m6A spatial transcriptomes, comprising the following steps: Step 1): Hybridize the circularized probe and extension probe in situ with RNA; Step 2): Add the above-mentioned selenodideoxynucleotide and the first elongation enzyme to carry out the first elongation reaction; Step 3): Add dTTP (deoxythymidine triphosphate) and the second elongation enzyme to carry out the second elongation reaction; Step 4): Ligase ligation.

[0012] Preferably, in step 1), the circularization probe recognizes RNA sequences 15 nt on each side of the m6A site and leaves a single nucleotide gap on the opposite side of the m6A site; the extension probe contains two functional regions, one region for hybridizing the downstream segment of the circularization probe target sequence, and the other region for serving as a primer for the rolling circle amplification reaction.

[0013] Preferably, in step 2), the concentration of selenodidenucleotide is controlled at 150-250 μM, the first extension enzyme is Bst2.0 DNA polymerase, the temperature of the first extension reaction is controlled at 30-50℃, and the time is controlled at 0.5-2h.

[0014] Preferably, in step 3), the concentration of dTTP is controlled at 0.5-1.5 mM, the second extension enzyme is Bst2.0 DNA polymerase, the temperature of the second extension reaction is controlled at 30-50℃, and the time is controlled at 0.5-2 h.

[0015] Preferably, in step 4), the ligase is Splint R ligase, and the ligation temperature is controlled at 30-45℃ and the ligation time is controlled at 0.5-2h.

[0016] Preferably, the m6A spatial transcriptome detection method, after step 4), further includes: Step 5): Rolling circle amplification; Step 6): DAPI staining, fluorescent probe hybridization, and confocal imaging.

[0017] Preferably, step 5) includes: adding rolling ring amplification reaction solution and reacting at 25-35℃ for 1-2 hours.

[0018] Preferably, the rolling circle amplification reaction solution includes: 1×phi29 DNA polymerase buffer and 1 U / μL phi29 DNA polymerase.

[0019] The beneficial effects of this invention are as follows: 1. This invention provides a selenodylide that exhibits a significant differential response to A and m6A on the template strand when used as a reverse transcription substrate, while maintaining good incorporation efficiency, ensuring the sensitivity and specificity of the detection signal, and is suitable for the detection of low-abundance m6A sites.

[0020] 2. The present invention provides a method for preparing the above-mentioned seleno-dideoxynucleosides, which is simple and easy to industrialize.

[0021] 3. This invention provides an application of the above-mentioned selenodideoxynucleoside or the selenodideoxynucleoside prepared by the above-mentioned method in m6A spatial transcriptome detection. It can be directly embedded into the existing spatial transcriptome sequencing library construction process without large-scale modification of equipment or reagent systems, and has good technical compatibility and economy.

[0022] 4. This invention provides a spatial transcriptome detection method for m6A based on the aforementioned selenized dideoxynucleotides. This method can directly distinguish between A and m6A bases on the template strand during reverse transcription, achieving single-base resolution detection and completely avoiding the dependence on m6A-specific antibodies in traditional methods. This method does not require chemical or enzymatic reactions with the RNA in the cell, preserving sequence complexity; it has high specificity and can detect m6A modification signals more efficiently. Compared with antibody-dependent methods, it provides higher signal intensity, lower false-positive signals, and less background interference. Attached Figure Description

[0023] Figure 1 This is a schematic diagram of the present invention; Figure 2 The NMR spectrum of compound 2 is shown in the figure. Figure 3 The carbon NMR spectrum of compound 2; Figure 4 The NMR spectrum of compound 3 is shown in the figure. Figure 5 The carbon NMR spectrum of compound 3; Figure 6 The NMR spectrum of compound 5 is shown in the figure. Figure 7 The carbon NMR spectrum of compound 5; Figure 8 The NMR spectrum of compound 6 is shown in the figure. Figure 9 The carbon NMR spectrum of compound 6; Figure 10 Here is the high-resolution mass spectrum of compound 4SeddTTP; Figure 11 Gel electrophoresis image of the selective extension of compound 4SeddTTP to A / m6A; Figure 12 Confocal imaging of the MALAT1_2515_m6A modification site; Figure 13 Confocal imaging of the two sites MALAT1_2515_m6A and ACTB_m6A. Detailed Implementation

[0024] The present invention will be further described below with reference to specific embodiments. However, the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified, specific conditions in the following embodiments are performed under conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, the methods used are conventional methods known in the art, and the consumables and reagents used are commercially available. Unless otherwise stated, the technical and scientific terms used herein have the same meaning as those familiar with the art. Furthermore, any methods or materials similar to or equivalent to those described herein may also be applied to the present invention.

[0025] This document provides, solely to further demonstrate that the invention achieves its objectives, synthetic data and m6A imaging results of the synthesized 4SeddTTP compound, including pattern strand elongation and imaging of intracellular RNA sites. It should be understood that the specific embodiments described herein are for illustrative purposes only and are not intended to limit the scope of the invention.

[0026] Example 1 Chemical Synthesis of 4SeddTTP Raw materials and reagents: All raw materials and reagents were purchased from commercial suppliers such as Sigma-Aldrich and Bitmain, unless otherwise stated.

[0027] Main raw material: dideoxythymidine (starting material).

[0028] Key reagents: benzoyl chloride, 1,2,4-triazole, phosphorus oxychloride, selenium powder, 3-bromopropionitrile, tributylammonium pyrophosphate, 2-chloro-4H-1,3,2-benzodioxanone heterocyclic 4-one.

[0029] Commonly used reagents and solvents: anhydrous pyridine, anhydrous triethylamine, sodium borohydride, sodium hydroxide, anhydrous acetonitrile, anhydrous tetrahydrofuran, dioxane, ethanol, N,N-dimethylformamide, ethyl acetate, dichloromethane, methanol, petroleum ether, dilute hydrochloric acid, saturated sodium bicarbonate solution, saturated sodium chloride solution, 10% acetic acid, iodine, pyridine, anhydrous magnesium sulfate.

[0030] Analysis and purification: silica gel (column chromatography), high performance liquid chromatography (HPLC) system, rapid protein liquid chromatography (FPLC) system.

[0031] The synthetic route of compound 4SeddTTP (compound 7) involved in this invention is as follows:

[0032] The specific reaction steps are as follows: using dideoxythymidine (compound 1) as the starting material, the target product 4SeddTTP (compound 7) is synthesized through a series of reactions including 5'-OH protection, 4-position carbonyl activation, 4-position selenization, deprotection and triphosphorylation.

[0033] (1) 5'OH protection: Compound 1 reacts with benzoyl chloride in pyridine solution to prepare compound 2. The specific method is as follows: Compound 1 (1.36 g, 6 mmol) was dissolved in 30 mL of anhydrous pyridine, and benzoyl chloride (1.02 g) was added. The mixture was stirred at 55 °C for 24 h. After the reaction was complete, the mixture was poured into 100 mL of water, neutralized with 30 mL of hydrochloric acid, and then extracted with ethyl acetate (100 mL × 3). The combined organic phases were washed successively with dilute hydrochloric acid (2 M, 200 mL), saturated sodium bicarbonate solution (100 mL), and saturated sodium chloride solution (100 mL). The organic phases were dried over anhydrous magnesium sulfate and concentrated under reduced pressure to remove the solvent. The crude product was purified by silica gel column chromatography to give 1.6 g of white solid, which was compound 2, with a yield of 80%. The 1H NMR spectrum of compound 2 is shown below. Figure 2 As shown, the carbon NMR spectrum of compound 2 is as follows: Figure 3 As shown.

[0034] (2) Activation of the carbonyl group at the 4-position: Compound 2 was activated by phosphorus oxychloride and imidazole to synthesize compound 3.

[0035] The specific method is as follows: Under argon protection, 1,2,4-triazole (2.77 g, 40 mmol) was placed in a Kolle flask, and phosphorus oxychloride (0.92 mL, 10 mmol) and anhydrous acetonitrile (32 mL) were added sequentially. After stirring at room temperature for 45 minutes, anhydrous triethylamine (11.2 mL, 79 mmol) was added, and stirring was continued for another 45 minutes. The resulting suspension was transferred through a syringe with a cotton filter to a round-bottom flask containing compound 2 (1.1 g, 3.35 mmol), and stirred at room temperature for 1 hour under an argon atmosphere. After the reaction was complete, the mixture was poured into 150 mL of water and extracted with ethyl acetate (80 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution (100 mL), and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the mixture was purified by silica gel column chromatography to obtain 0.889 g of white solid, which was compound 3, with a yield of 70%. The 1H NMR spectrum of compound 3 is shown below. Figure 4 As shown, the carbon NMR spectrum of compound 3 is as follows: Figure 5 As shown.

[0036] (3) 4-Selenization reaction: Under argon protection, selenium powder (0.79 g, 10 mmol) and sodium borohydride (0.27 g) were placed in a flask, and a dioxane-ethanol (4:1, v / v) mixed solvent was added. After stirring at room temperature for 1 hour, the mixture was cooled in an ice bath, and 3-bromopropionitrile (1.24 mL, 15 mmol) was added dropwise. Stirring was continued for another hour, and the solution turned orange-yellow. After the reaction was complete, the mixture was poured into 40 mL of water, the pH was adjusted to 7.0 with acetic acid, and the mixture was extracted with ethyl acetate (20 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution (50 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The crude product was purified by silica gel column chromatography to give 0.89 g of a yellow liquid, which was di(2-cyanoethyl)diselenoether (compound 4), in 66% yield.

[0037] The di(2-cyanoethyl)diselenoether (0.81 g, 3 mmol) obtained above was dissolved in 8 mL of ethanol under argon protection. Sodium borohydride (250 mg) was dissolved in 5 mL of ethanol and injected into the above solution. The reaction was carried out in an ice bath for 15 minutes, during which the solution changed from yellow to colorless. The ice bath was removed, and an anhydrous tetrahydrofuran (4 mL) solution of compound 3 (1.2 g) was added to the system. The mixture was stirred at room temperature for 15 minutes. After the reaction was complete, 100 mL of water was added, and the pH was adjusted to 7–8 with 10% acetic acid. The mixture was extracted with ethyl acetate (100 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution (100 mL), and dried over anhydrous magnesium sulfate for 30 minutes. After concentration under reduced pressure, the mixture was purified by silica gel column chromatography to give 0.76 g of white solid, which was compound 5, with a yield of 48%. The 1H NMR spectrum of compound 5 is shown below. Figure 6 As shown, the carbon NMR spectrum of compound 5 is as follows: Figure 7 As shown.

[0038] (4) Removal of 5'-OH and Se-protecting groups: The specific steps are as follows: Sodium hydroxide (44.6 mg, 1.12 mmol) was dissolved in 18 mL of ethanol, and compound 5 (200 mg, 0.352 mmol) was added. The mixture was stirred at room temperature for 30 minutes. After the reaction was complete, the pH was adjusted to 7 with 10% acetic acid, and the solvent was removed by concentration under reduced pressure. The crude product was purified by silica gel column chromatography to give 86 mg of orange-red solid, which was compound 6, with a yield of 80%. The 1H NMR spectrum of compound 6 is shown below. Figure 8 As shown, the carbon NMR spectrum of compound 6 is as follows: Figure 9 As shown.

[0039] (5) Triphosphorylation reaction: The specific steps are as follows: Compound 6 (61 mg, 0.2 mmol), tributylammonium pyrophosphate (220 mg, 0.4 mmol), and 2-chloro-4H-1,3,2-benzodioxophosphorus heterocyclic-4-one (81 mg, 0.4 mmol) were placed in three dry round-bottom flasks and dried under high vacuum for 2 hours.

[0040] Add DMF (0.25 mL) and triethylamine (0.74 mL) to a flask containing pyrophosphate, dissolve, and transfer to a flask containing a phosphorus heterocyclic compound (2-chloro-4H-1,3,2-benzodioxaphosphazenecyclohexane-4-one, dissolved in 1 mL DMF), and stir for 30 minutes. Then, add this mixture to the flask containing compound 6, and continue stirring for 1.5 hours. After the reaction is complete, add 3% iodine solution diluted with pyridine / water (9:1, v / v) until the solution turns a persistent brown color (indicating complete oxidation). Continue stirring for 15 minutes, then add 5 mL of water and stir for another 1.5 hours. Transfer the reaction mixture to two 50 mL centrifuge tubes, add 0.6 mL of 3 M sodium chloride solution and 19 mL of ethanol, respectively, and freeze at -80 °C for 1 hour. Centrifuge at 4 °C and 3200 rpm for 20 minutes, and collect the precipitated crude triphosphate product. The precipitate was redissolved in ultrapure water and purified sequentially by HPLC and FPLC to obtain the target product, selenodideoxynucleotide (4SeddTTP, compound 7).

[0041] Nuclear magnetic resonance (NMR) spectroscopy and high-resolution mass spectrometry (HMS) confirmed its structure and purity. To further demonstrate the synthesis of the compounds of this invention, NMR and HMS data of the products synthesized in each step are provided below. 4SeddTTP is a novel compound, and its HMS spectrum is shown below. Figure 10 As shown.

[0042] Compound 2: White solid.

[0043] 1 H NMR (400 MHz, DMSO- d 6) δ 11.29 (s, 1H), 8.01 – 7.96 (m, 2H), 7.71 –7.66 (m, 1H), 7.54 (t, J = 7.7 Hz, 2H), 7.40 (d, J = 1.4 Hz, 1H), 6.04 (dd, J =7.2, 3.8 Hz, 1H), 4.56 (dd, J= 12.0, 3.0 Hz, 1H), 4.44 (dd, J = 12.0, 5.4 Hz,1H), 4.35 – 4.29 (m, , 1H), 2.37 – 2.28 (m, 1H), 2.13 – 1.98 (m, 3H), 1.60(d, J = 1.2 Hz, 3H). 13 C NMR (101 MHz, DMSO) δ 165.7, 163.7, 150.4, 135.7, 133.6, 129.5,129.2, 128.9, 109.5, 84.7, 77.5, 65.6, 30.6, 25.8, 12.0.HRMS(ESI + )m / z[M+Na] + C 17 H 18 N2NaO5 + Calculated value: 353.1108; Detected value: 353.1085.

[0044] Compound 3: white solid 1 H NMR (400 MHz, DMSO- d 6) δ 9.30 (s, 1H), 8.35 (s, 1H), 8.21 (d, J = 1.0Hz, 1H), 7.99 – 7.95 (m, 2H), 7.68 – 7.63 (m, 1H), 7.54 – 7.48 (m, 2H), 6.00(dd, J = 6.9, 2.9 Hz, 1H), 4.66 (dd, J = 12.2, 2.8 Hz, 1H), 4.59 (dd, J = 12.2, 5.3Hz, 1H), 4.55 – 4.48 (m, 1H), 2.59 – 2.53 (m, 1H), 2.22 – 2.15 (m, 1H), 2.14– 2.03 (m, 4H), 2.00 – 1.90 (m, 1H). 13C NMR (101 MHz, DMSO) δ 165.7, 157.8,153.4, 153.1, 147.2, 145.3, 133.6, 129.4, 129.2, 128.9, 104.3, 88.1, 79.8,65.3, 32.3, 24.8, 15.9.HRMS(ESI + )m / z[M+Na] + C 19 H 19 N5NaO4 + Calculated value: 404.1329; Detected value: 404.1332.

[0045] Compound 5: White solid 1 H NMR (400 MHz, DMSO- d 6) δ 7.97 (dd, J = 8.3, 1.4 Hz, 2H), 7.73 – 7.63(m, 2H), 7.57 – 7.49 (m, 2H), 5.93 (dd, J = 7.0, 2.9 Hz, 1H), 4.63 (dd, J = 12.1, 2.9 Hz, 1H), 4.53 (dd, J = 12.2, 5.3 Hz, 1H), 4.48 – 4.41 (m, 1H), 3.32 (t, J =6.9 Hz, 2H), 3.02 (t, J = 6.9 Hz, 2H), 2.48 – 2.44 (m, 1H), 2.10 – 2.03 (m,2H), 1.94 – 1.90 (m, 1H), 1.78 (d, J = 0.9 Hz, 3H). 13 C NMR (101 MHz, DMSO) δ176.0, 165.7, 152.1, 138.1, 133.6, 129.4, 129.2, 128.9, 119.8, 112.5, 87.3,79.2, 65.3, 32.1, 25.0, 20.1, 17.8, 14.1.HRMS(ESI+)m / z[M+Na] + C 20 H 21 N3NaO4Se +Calculated value: 470.0589; Detected value: 470.0595.

[0046] Compound 6: Orange-red solid 1 H NMR (400 MHz, DMSO- d 6) δ 13.24 (s, 1H), 8.24 (d, J = 1.1 Hz, 1H), 5.84 (dd, J = 6.8, 2.7 Hz, 1H), 5.19 (s, 1H), 4.06 (ddd, J = 8.6, 6.6, 3.3 Hz,1H), 3.76 (dd, J = 12.2, 3.0 Hz, 1H), 3.56 (dd, J = 12.2, 3.0 Hz, 1H), 2.36 –2.24 (m, 1H), 2.08-2.02 (m, 4H), 1.89 – 1.80 (m, 2H). 13 C NMR (101 MHz, DMSO) δ191.9, 147.6, 133.2, 120.6, 86.2, 82.6, 61.3, 32.1, 24.0, 19.2.HRMS(ESI + )m / z[M+Na] + C 10 H 14 N2NaO3Se + Calculated value: 313.0062; Detected value: 313.0064.

[0047] Compound 7 (4SeddTTP): Orange-red solid HRMS (ESI) - )m / z [MH] - C 10 H 16 N2O 12 P3Se - Calculated value: 528.9087; Detected value: 528.9111.

[0048] Example 2: Selectivity test of 4SeddTTP on pattern strand RNA for A / m6A.

[0049] The RNA used in the following examples was purchased from Takara, the primer DNA from Sangon Biotech, and the Bst2.0 DNA polymerase from NEB. The nucleic acid sequences used are as follows.

[0050] m6A_RNA: GGm6ACUGCACAUGCUGCACAGUGC A_RNA: GGACUGCACAUGCUGCACAGUGC Primer: FAM-GCACTGTGCAGCATGTGCAG Experimental procedure: (1) Annealing: 10 nM m6A RNA and 10 nM primers, and 10 nM A RNA and 10 nM primers were mixed in annealing buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 1 mM EDTA). The mixture was heated at 95°C for 5 minutes, and then slowly cooled to 25°C at 0.1°C / second to fully anneal the primers and RNA template.

[0051] (2) Extension: Extension reaction mixtures of different concentrations (50, 100, 150, 200 μM) of 4SedTTP were prepared: 1×Bst2.0 DNA polymerase reaction buffer, different concentrations (50, 100, 150, 200 μM) of 4SedTTP, 0.4 U / μL Bst2.0 DNA polymerase, and an appropriate amount of RNase inhibitor. The hybridized and annealed m6A_RNA (10 nM) and primers (10 nM), and A_RNA (10 nM) and primers (10 nM) were added to the extension reaction mixture for extension, and the reaction was carried out at 37℃ for 30 minutes.

[0052] (3) Gel electrophoresis: The length of the extended primers was evaluated using modified polyacrylamide gel electrophoresis.

[0053] The results are as follows Figure 11 As shown in the results, different concentrations of 4SeddTTP can effectively distinguish A / m6A, with the most significant effect at 200μM, where A is almost completely extended.

[0054] Example 3: Imaging test of m6A on MALAT1 RNA.

[0055] The primer DNA used in the following examples was purchased from Sangon Biotech (Shanghai) Co., Ltd., the enzymes used were purchased from NEB, and the nucleic acid sequences used are as follows.

[0056] MALAT1_2515 lock probe: CCTTCACATTTTTCATCAGGTCATACACTAGAATCAACCCGCCATCGTAGACGAGCTTCCGTTACGAAAG (Sequence as shown in SEQ ID No: 1) MALAT1_2515 extension primer: TAATTACTCTTGATCTTGAAGCGGTCTACGATG (sequence shown in SEQ ID No: 2) MALAT1_A Locking Probe: AACCAACTTCCCCTTATTCCAATAGTCCGTAAGATAACCCGCCATCGTAGACTAGTTTTGATGTGATTTT (Sequence as shown in SEQ ID No: 3) MALAT1_A extension primers: TTACACCAGTCCTTTTAGTATAGGTCTACGATG (sequence shown in SEQ ID No: 4) MALAT1_2515 Fluorescent Probe: Alexa488-TCAGGTCATACACTAGAATC MALAT1_A fluorescent probe: Alexa647-ATTCCAATAGTCCGTAAGAT Cell line: HeLa cells.

[0057] Experimental procedure: (1) Cell fixation: Cell morphology was fixed using paraformaldehyde and methanol. HeLa cells were cultured in culture dishes, the culture medium was aspirated, and the cells were gently washed twice with pre-cooled 1×PBS (pH 7.4). 4% paraformaldehyde solution (prepared with PBS) was added, and the cells were fixed at room temperature for 15 minutes. The fixative was aspirated, and the cells were washed three times with PBS for 5 minutes each time. Subsequently, the cells were permeabilized on ice with pre-cooled -20℃ methanol for 10 minutes, and finally washed three times with PBST (PBS containing 0.1% Tween-20) for 5 minutes each time. The HeLa cells were then fixed in the culture dishes.

[0058] (2) Primer hybridization: 100 μL of the mixture of MALAT1_2515 lock probe and MALAT1_2515 extension primer, and 100 μL of the mixture of MALAT1_A lock probe and MALAT1_A extension primer were added to the culture dish of fixed HeLa cells. The components of the mixture of MALAT1_2515 lock probe and MALAT1_2515 extension primer included: 2xSSC, 10% formamide, 20 mM Ribonucleoside vanadyl complex, 0.1 mg / mL Yeast RNA, 1 U / μL RNA inhibitor, 10 nM MALAT1_2515 lock probe, and 10 nM MALAT1_2515 extension probe. The mixture of MALAT1_A lock probe and MALAT1_A extension primers consists of: 2x SSC, 10% formamide, 20mM Ribonucleosidevanadyl complex, 0.1mg / mL Yeast RNA, 1U / μL RNA inhibitor, 10nM MALAT1_A lock probe, and 10nM MALAT1_A extension probe. Mix continuously overnight. Targeting the MALAT1_2515 m6A modification site, the 5′ and 3′ sequences of the lock probe are complementary to adjacent sequences across the modification site on the target RNA, containing a unique sequence region for subsequent rolling circle amplification. The extension primers hybridize with the lock probe to initiate rolling circle amplification. After hybridization, the hybridization solution is aspirated, and cells are washed twice with 1×Bst2.0 DNA polymerase reaction buffer at 37°C for 10 minutes each time to remove non-specifically bound primers.

[0059] (3) 4SeddTTP extension: The extension reaction was carried out using 4SeddTTP and Bst2.0 DNA polymerase.

[0060] Prepare the 4SedTTP extension reaction mixture: 1×Bst2.0 DNA polymerase reaction buffer, 200 μM 4SedTTP, 0.4 U / μL Bst2.0 DNA polymerase, and an appropriate amount of RNase inhibitor. Add 100 μL of this mixture to each of the primer-hybridized HeLa cell culture dishes and incubate at 37°C for 30 minutes. Discard the 4SedTTP extension reaction mixture and wash twice with 1×PBS. In this step, the extension primers extend using MALAT1 RNA as a template under the action of Bst2.0 DNA polymerase. When encountering an unmodified A-modified site, 4SedTTP is preferentially incorporated, thereby introducing a subsequently recognizable modified nucleotide at that position.

[0061] (4) dTTP extension and ligation: After extension reaction using dTTP and Bst2.0 DNA polymerase, the lock probe was ligated using SplintR ligase. 100 μL of dTTP extension-ligation mixture was added to each HeLa cell culture dish after 4S edTTP extension. The dTTP extension-ligation mixture consisted of: 1×Bst2.0 DNA polymerase reaction buffer, 1 mM dTTP, 0.4 U / μL Bst2.0 DNA polymerase, 1×SplintR ligase buffer, and 10 U / μL SplintR ligase. The reaction was carried out at 37°C for 60 minutes. The dTTP extension-ligation mixture was discarded, and the cells were washed three times with PBS. In this stage, the polymerase used native dTTP to further extend the extension primer to the 5′ end of the lock probe. After reaching the 5′ phosphate end of the lock probe, SplintR ligase immediately ligated the extension product to the 5′ phosphate group of the lock probe, forming a closed circular DNA template. The modified 2515 site can be successfully linked into a ring, while the A site, incorporating dideoxythymidine, cannot be linked into a ring.

[0062] (5) Rolling circle amplification: Enzymatic rolling circle amplification was performed using phi29 polymerase. The rolling circle amplification reaction solution was prepared as follows: 1×phi29 DNA polymerase buffer and 1 U / μL phi29 DNA polymerase. 100 μL of this reaction solution was added to dTTP-extended and ligated HeLa cell culture dishes, and the reaction was carried out at 30°C for 90 minutes. The phi29 polymerase performed rolling circle amplification using circularized DNA as a template, producing a large number of amplicon products. These products remained in situ, corresponding to the subcellular location of the target RNA.

[0063] (6) DAPI staining, fluorescent probe hybridization, and confocal imaging: The effectiveness of 4SeddTTP for imaging the m6A site was evaluated. After rolling circle amplification, cells were washed with PBS. PBS solution containing DAPI was added, and cell nuclei were stained at room temperature for 5 minutes to label the nuclei. After PBS washing, 100 μL of hybridization buffer was added to each of the corresponding fluorescently labeled probes (MALAT1_2515 fluorescent probe and MALAT1_A fluorescent probe). After hybridization, imaging observation was performed using a confocal laser scanning microscope.

[0064] The results are as follows Figure 12 As shown in the results, the MALAT1_2515_m6A site has a significant fluorescence signal, while the adjacent MALAT1_A site has no fluorescence signal, demonstrating the effectiveness of the present invention in imaging the m6A site.

[0065] Example 4: Multi-site m6A imaging test.

[0066] The primer DNA used in the following examples was purchased from Sangon Biotech, the enzymes used were purchased from NEB, and the nucleic acid sequences used are as follows.

[0067] MALAT1_2515 lock probe: CCTTCACATTTTTCATCAGGTCATACACTAGAATCAACCCGCCATCGTAGACGAGCTTCCGTTACGAAAG (Sequence as shown in SEQ ID No: 1) MALAT1_2515 extension primer: TAATTACTCTTGATCTTGAAGCGGTCTACGATG (sequence shown in SEQ ID No: 2) ACTB lock probe: CCGCCTAGAAGCATTATTCCAATAGTCCGTAAGATAACCCGCCATCGTAGACGTGGCAACTAAGTCATAG (Sequence shown in SEQ ID No: 5) ACTB extension primers: GTTTTGTCAAGAAAGGGTGTGTGGTCTACGATG (sequence shown in SEQ ID No: 6) MALAT1_2515 Fluorescent Probe: Alexa488-TCAGGTCATACACTAGAATC ACTB fluorescent probe: Alexa647-ATTCCAATAGTCCGTAAGAT Cell line: HeLa cells.

[0068] Experimental procedure: (1) Cell fixation: Cell morphology was fixed using paraformaldehyde and methanol. HeLa cells were cultured in culture dishes, the culture medium was aspirated, and the cells were gently washed twice with pre-cooled 1×PBS (pH 7.4). 4% paraformaldehyde solution (prepared with PBS) was added, and the cells were fixed at room temperature for 15 minutes. The fixative was aspirated, and the cells were washed three times with PBS for 5 minutes each time. Subsequently, the cells were permeabilized on ice with pre-cooled -20℃ methanol for 10 minutes, and finally washed three times with PBST (PBS containing 0.1% Tween-20) for 5 minutes each time. The HeLa cells were then fixed in the culture dishes.

[0069] (2) Primer hybridization: 100 μL of the mixture of MALAT1_2515 lock probe and MALAT1_2515 extension primer, and 100 μL of the mixture of ACTB lock probe and ACTB extension primer were added to the culture dish of fixed HeLa cells. The components of the mixture of MALAT1_2515 lock probe and MALAT1_2515 extension primer included: 2xSSC, 10% formamide, 20 mM Ribonucleoside vanadyl complex, 0.1 mg / mL Yeast RNA, 1 U / μL RNA inhibitor, 10 nM MALAT1_2515 lock probe, and 10 nM MALAT1_2515 extension probe. The mixture of ACTB lock probe and ACTB extension primers consisted of: 2x SSC, 10% formamide, 20mM Ribonucleoside vanadyl complex, 0.1mg / mL Yeast RNA, 1U / μL RNA inhibitor, 10nM ACTB lock probe, and 10nM ACTB extension probe. Mix continuously overnight. After hybridization, aspirate the hybridization solution and wash cells twice with 1×Bst2.0 DNA polymerase reaction buffer at 37°C for 10 minutes each time. Lock probes and extension primers were designed for different known m6A sites on the MALAT1 and ACTB genes. Each primer set carried a different sequence to distinguish different sites.

[0070] (3) 4SedTTP extension: Extension reaction was performed using 4SedTTP and Bst2.0 DNA polymerase. The 4SedTTP extension reaction mixture was prepared as follows: 1×Bst2.0 DNA polymerase reaction buffer, 200 μM 4SedTTP, 0.4 U / μL Bst2.0 DNA polymerase, and an appropriate amount of RNase inhibitor. 100 μL of this mixture was added to each of the primer-hybridized HeLa cell culture dishes and incubated at 37°C for 30 minutes. The 4SedTTP extension reaction mixture was then discarded, and the cells were washed twice with 1×PBS. In this multi-site extension, all unmethylated adenosine sites at the target sites were labeled with 4SedTTP.

[0071] (4) dTTP extension and ligation: After extension reaction using dTTP and Bst2.0 DNA polymerase, the lock-lock probes were ligated using SplintR ligase. 100 μL of dTTP extension-ligation mixture was added to each HeLa cell culture dish after 4S edTTP extension. The dTTP extension-ligation mixture consisted of: 1×Bst2.0 DNA polymerase reaction buffer, 1 mM dTTP, 0.4 U / μL Bst2.0 DNA polymerase, 1×SplintR ligase buffer, and 10 U / μL SplintR ligase. The reaction was carried out at 37°C for 60 minutes. The dTTP extension-ligation mixture was discarded, and the cells were washed three times with PBS. This completed the closure of the circular DNA templates on each target.

[0072] (5) Rolling circle amplification: Enzymatic rolling circle amplification was performed using phi29 polymerase. The rolling circle amplification reaction solution was prepared as follows: 1×phi29 DNA polymerase buffer and 1 U / μL phi29 DNA polymerase. 100 μL of this reaction solution was added to dTTP extension and ligated HeLa cell culture dishes, and the reaction was carried out at 30°C for 90 minutes. This resulted in the in situ generation of a large number of RCP products with different sequences.

[0073] (6) DAPI staining, fluorescent probe hybridization, and confocal imaging: The feasibility of the method for imaging multiple m6A sites was evaluated. Detection probes coupled with different fluorescent dyes were synthesized based on each sequence group. After rolling circle amplification, cells were washed with PBS. A PBS solution containing DAPI was added, and the cells were stained at room temperature for 5 minutes to label the nuclei. After PBS washing, 100 μL of hybridization buffer was added to each of the corresponding fluorescently labeled probes (MALAT1_2515 fluorescent probe and ACTB fluorescent probe). After hybridization, imaging was performed using a confocal laser scanning microscope. The number and spatial distribution of fluorescent spots in each channel were counted to evaluate the feasibility of the method for imaging multiple m6A sites.

[0074] The results are as follows Figure 13 As shown in the results, m6A on MALAT1 and ACTB was successfully imaged, with m6A on MALAT1 imaged on the nucleus and m6A on ACTB imaged on the cytoplasm. Their spatial distribution is consistent with known literature reports.

[0075] The above embodiments demonstrate the effectiveness of the present invention in the detection of m6A multi-site spatial transcriptomes.

[0076] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the invention.

Claims

1. A selenoside, characterized in that, The structure of the seleno-dideoxynucleoside is shown below: 。 2. The selenoside according to claim 1, characterized in that, The selenoside shown is prepared from dideoxythymidine.

3. A method for preparing selenodideoxynucleoside according to claim 1 or 2, characterized in that, The reaction formula for preparing seleno-dideoxynucleosides is shown below: 。 4. The method for preparing selenoside according to claim 3, characterized in that, The preparation of seleno-dideoxynucleosides includes the following steps: 1) Compound 1 reacts with benzoyl chloride to prepare compound 2; 2) The compound and 1,2,4-triazole react in the presence of phosphorus oxychloride to give compound 3; 3) Compound 3 reacts with di(2-cyanoethyl)diselenoether to give compound 5; 4) The 5'-OH and Se- protecting groups of compound 5 were removed to obtain compound 6; 5) Compound 6 was subjected to a triphosphorylation reaction with tributylammonium pyrophosphate to obtain the selenodideoxy nucleotide.

5. The application of a selenodidenucleotide as described in claim 1 or 2, or a selenodidenucleotide prepared by the preparation method described in claim 3 or 4, in m6A spatial transcriptome detection.

6. A method for detecting m6A spatial transcriptome, characterized in that, Includes the following steps: Step 1): Hybridize the circularized probe and extension probe in situ with RNA; Step 2): Add the selenodideoxynucleotide as described in claim 1 or 2 and the first elongation enzyme to carry out the first elongation reaction; Step 3): Add dTTP and the second extension enzyme to carry out the second extension reaction; Step 4): Ligase ligation.

7. The m6A spatial transcriptome detection method according to claim 6, characterized in that, In step 1), the circular probe recognizes RNA sequences 15 nt on each side of the m6A site and leaves a single nucleotide gap on the opposite side of the m6A site; the extension probe contains two functional regions, one region for hybridizing the downstream segment of the circular probe target sequence, and the other region for serving as a primer for the rolling circle amplification reaction.

8. The m6A spatial transcriptome detection method according to claim 6, characterized in that, In step 2), the concentration of selenodidenucleotide is controlled at 150-250 μM, the first extension enzyme is Bst2.0 DNA polymerase, the temperature of the first extension reaction is controlled at 30-50℃, and the time is controlled at 0.5-2h.

9. The m6A spatial transcriptome detection method according to claim 6, characterized in that, In step 3), the concentration of dTTP is controlled at 0.5-1.5 mM, the second extension enzyme is Bst2.0 DNA polymerase, the temperature of the second extension reaction is controlled at 30-50℃, and the time is controlled at 0.5-2 h.

10. The m6A spatial transcriptome detection method according to claim 6, characterized in that, In step 4), the ligase is Splint R ligase, and the ligation temperature is controlled at 30-45℃, and the ligation time is controlled at 0.5-2h.

Images