Polypeptide-nucleic acid conjugate probe, c-reactive protein detection kit and method for detecting c-reactive protein

Abstract

The application belongs to the technical field of biotechnology, and particularly relates to a polypeptide-nucleic acid coupling probe, a C-reactive protein detection kit and a method for detecting C-reactive protein. The application provides a polypeptide-nucleic acid coupling probe, which comprises a target recognition polypeptide, a signal nucleic acid fragment, a covalent coupling domain and a hydrophilic spacer arm, wherein the target recognition polypeptide and the signal nucleic acid fragment are covalently connected through a coupling structure. In the functional level, the target polypeptide in the probe can specifically bind to C-reactive protein (CRP), and the signal nucleic acid fragment can be assembled with a Cas protein and a CrRNA into a ternary complex, thereby starting a trans-cleavage reaction and outputting a detectable signal. Through the special design, the probe not only realizes high-affinity recognition of CRP, but also has a significantly higher binding free energy than a traditional monoclonal antibody, and has obvious advantages in the affinity level.

Description

Technical Field

[0001] This application belongs to the field of biotechnology, specifically relating to polypeptide-nucleic acid coupled probes, C-reactive protein detection kits, and methods for detecting C-reactive protein. Background Technology

[0002] C-reactive protein (CRP) is an acute-phase reactive protein synthesized by the liver. In pathological states such as inflammation, infection, tissue damage, and cardiovascular disease, its serum concentration can rapidly increase to several times or even hundreds of times the normal level. As a commonly used inflammatory marker in clinical practice, the sensitive and specific detection of CRP is of great significance for the early diagnosis, treatment monitoring, and prognostic assessment of infectious diseases (such as hand-foot-mouth disease), autoimmune diseases, and cardiovascular events.

[0003] Currently, the main products used for CRP detection employ monoclonal antibodies or peptide aptamers as recognition elements. However, traditional monoclonal antibodies for CRP detection generally suffer from insufficient activity and low affinity, and their preparation process relies on cell or bacterial expression systems, limiting production efficiency and performance. Furthermore, antibody screening is time-consuming, costly, and unstable, failing to meet the demands for rapid, low-cost, and highly sensitive clinical testing. Peptide aptamers, on the other hand, primarily rely on their three-dimensional conformation for CRP recognition, resulting in long screening cycles, and their affinity and specificity still do not meet detection requirements.

[0004] In summary, traditional monoclonal antibodies for CRP detection may suffer from insufficient activity and low affinity, limiting the improvement of detection sensitivity and accuracy. Furthermore, the preparation process of monoclonal antibodies relies on cell or bacterial expression systems, resulting in low production efficiency, high cost, and significant batch-to-batch variations, making standardized production difficult.

[0005] Therefore, it is necessary to further explore C-reactive protein detection products. Summary of the Invention

[0006] Based on this, one embodiment of this application provides a polypeptide-nucleic acid coupled probe, a C-reactive protein detection kit, and a method for detecting C-reactive protein.

[0007] This application provides a polypeptide-nucleic acid coupled probe, comprising: a target recognition polypeptide, a signal nucleic acid fragment, and a linker arm connecting the target recognition polypeptide and the signal nucleic acid fragment; the target recognition polypeptide is used to specifically recognize and bind to C-reactive protein; the signal nucleic acid fragment is used to assemble with Cas protein and CrRNA into a ternary complex and initiate trans-cleavage function.

[0008] In some embodiments, the linker arm of the signal nucleic acid fragment includes a covalently coupled domain and a hydrophilic spacer arm; the covalently coupled domain is used to link the target recognition peptide and the signal nucleic acid fragment; the hydrophilic spacer arm is located between the target recognition peptide and the signal nucleic acid fragment.

[0009] In some embodiments, the amino acid sequence of the targeted recognition peptide is shown in SEQ ID NO.1.

[0010] In some embodiments, the nucleotide sequence of the signal nucleic acid fragment is shown in SEQ ID NO.2.

[0011] In some embodiments, the covalently coupled structural domain includes an azide group and an alkynyl group, which are linked by a triazole ring group.

[0012] In some embodiments, the hydrophilic spacer arm is a polyethylene glycol chain.

[0013] In some embodiments, the azide group is an azide-modified lysine.

[0014] In some embodiments, the alkynyl group is a dibenzocyclooctynyl group.

[0015] In some embodiments, the polyethylene glycol chain is PEG4.

[0016] In some embodiments, the polypeptide-nucleic acid coupled probe has the following structure: N'-targeting recognition polypeptide-K(N3)-triazole ring-PEG4-signal nucleic acid fragment-3'.

[0017] Another aspect of this application provides a C-reactive protein detection kit, including the aforementioned polypeptide-nucleic acid coupled probe.

[0018] In some embodiments, one or more of buffer solutions, standards, and solid supports are also included.

[0019] This application also provides a method for detecting C-reactive protein, comprising: using the aforementioned polypeptide-nucleic acid coupled probe for detection.

[0020] In some embodiments, the method includes: contacting the sample to be tested with the peptide-nucleic acid coupled probe to allow the peptide-nucleic acid coupled probe to bind to C-reactive protein.

[0021] The addition of Cas protein, CrRNA, and a fluorescent probe forms a ternary complex and initiates trans-cleavage; the fluorescence signal is detected, and the concentration of C-reactive protein is determined based on the fluorescence signal intensity.

[0022] In some embodiments, the Cas protein includes the Cas12a protein.

[0023] In some embodiments, the fluorescent probe includes an 8C-FQ fluorescent probe.

[0024] In some embodiments, the concentration of the polypeptide-nucleic acid coupled probe is 8 nM-12 nM.

[0025] In some embodiments, the excitation wavelength for detecting fluorescence signals is 480nm-490nm, and the emission wavelength is 530nm-540nm.

[0026] This application provides a peptide-nucleic acid coupled probe, comprising a targeting peptide, a signal nucleic acid fragment, a covalently coupled domain, and a hydrophilic spacer arm, wherein the targeting peptide and the signal nucleic acid fragment are covalently linked through a coupling structure. Functionally, the targeting peptide in this probe specifically binds to C-reactive protein (CRP), while the signal nucleic acid fragment assembles with Cas protein and CrRNA into a ternary complex, thereby initiating a trans-cleavage reaction and outputting a detectable signal. Through this unique design, the probe not only achieves high affinity recognition of CRP, but its binding free energy is also significantly higher than that of traditional monoclonal antibodies, exhibiting a clear advantage in affinity. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of this application and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 This is a schematic diagram of the structure of a polypeptide-nucleic acid coupled probe provided in an embodiment of this application;

[0029] Figure 2 This is a schematic diagram of a synthetic route provided in an embodiment of this application;

[0030] Figure 3 This is a mass spectrometry molecular weight identification result provided in an embodiment of this application;

[0031] Figure 4 This is a liquid chromatography purity verification result provided in an embodiment of this application;

[0032] Figure 5 A stable binding conformation of the polypeptide-nucleic acid coupled probe and CRP protein obtained by a 100 ns molecular dynamics simulation according to one embodiment of this application;

[0033] Figure 6 The root mean square deviation (RMSD) curve of the peptide-nucleic acid coupled probe and CRP protein complex provided in an embodiment of this application during a 100 ns molecular dynamics simulation.

[0034] Figure 7 This application provides an embodiment of simulated trajectory energy decomposition analysis of peptide nucleic acids and CRP proteins.

[0035] Figure 8 This application provides a direct method for detecting CRP protein using a polypeptide-nucleic acid coupled probe, as described in one embodiment of the present application. Detailed Implementation

[0036] The present application will be further described in detail below with reference to the embodiments and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.

[0037] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0038] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0039] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").

[0040] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0041] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.

[0042] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.

[0043] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0044] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0045] In this application, the technical features described in an open-ended manner include both closed technical solutions composed of the listed features and open technical solutions composed of the listed features.

[0046] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0047] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.

[0048] In this application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass-volume percentage.

[0049] All references to documents mentioned in this application are incorporated herein by reference as if each document were individually incorporated herein by reference. Unless they conflict with the inventive purpose and / or technical solution of this application, all cited documents are incorporated herein by reference in their entirety and for all purposes. When citing documents in this application, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. When citing documents in this application, examples and preferred embodiments of the cited technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptably to the description in this application.

[0050] To address the common problems of insufficient activity and low affinity of traditional monoclonal antibodies for CRP detection, this application provides a peptide-nucleic acid coupled probe for CRP detection, its preparation method, and its application.

[0051] This application provides a polypeptide-nucleic acid coupled probe, comprising:

[0052] The targeted recognition peptide, the signal nucleic acid fragment, and the connecting arm connecting the targeted recognition peptide and the signal nucleic acid fragment;

[0053] The targeted recognition peptide is used to specifically recognize and bind to C-reactive protein;

[0054] The signal nucleic acid fragment is used to assemble with Cas protein and CrRNA into a ternary complex and initiate trans-cleavage.

[0055] In some embodiments, the linker arm of the signal nucleic acid fragment includes a covalently coupled domain and a hydrophilic spacer arm;

[0056] The covalently coupled domain is used to connect the target recognition peptide and the signal nucleic acid fragment;

[0057] The hydrophilic spacer arm is located between the target recognition peptide and the signal nucleic acid fragment.

[0058] This application provides a peptide-nucleic acid coupled probe for C-reactive protein (CRP) detection, comprising a targeting peptide, a signal nucleic acid fragment, a covalently coupled domain, and a hydrophilic spacer arm, wherein the targeting peptide and the signal nucleic acid fragment are covalently linked through the coupling structure. This peptide-nucleic acid coupled probe achieves high affinity recognition of CRP through the specific binding of the targeting peptide to the CRP protein, exhibiting a high binding free energy significantly superior to the affinity level of traditional monoclonal antibodies. Simultaneously, the signal nucleic acid fragment, acting as a signal amplification element, can assemble with Cas protein and CrRNA to form a ternary complex, initiating a trans-cleavage function to amplify the signal output, thereby significantly improving detection sensitivity.

[0059] This application utilizes an in vitro chemical synthesis method, simplifying the preparation process, reducing production costs, and exhibiting good stability and reproducibility. Functional peptides can be obtained through molecular docking virtual peptide library screening, and their amino acid sequences can be optimized based on CRP binding sites. Signal nucleic acid fragments can be designed according to the type of Cas protein and the sequence of CrRNA, ensuring effective assembly with Cas protein and CrRNA and initiation of trans-cleavage function. The coupling structure can be formed using click chemistry reactions, ensuring a stable connection between the peptide and nucleic acid.

[0060] In some embodiments, the amino acid sequence of the targeted recognition peptide is shown in SEQ ID NO.1.

[0061] SEQ ID NO.1: KWRWRFRLSR. This polypeptide sequence was obtained through virtual screening and kinetic simulation optimization. It specifically recognizes and binds to the binding pocket of CRP proteins, achieving high-affinity binding through hydrophobic stacking and spatial complementarity effects. The polypeptide sequence is of moderate length, easy to chemically synthesize, and exhibits good water solubility and stability.

[0062] In some embodiments, the nucleotide sequence of the signal nucleic acid fragment is shown in SEQ ID NO.2.

[0063] SEQ ID NO.2: ATCAACACCGCCGCTGTCAGTG. This signal nucleic acid fragment can effectively assemble with Cas12a protein and CrRNA, initiating the trans-cleavage function of Cas12a to achieve cleavage of the fluorescent probe and signal amplification. The sequence is of moderate length, easy to synthesize chemically, and exhibits good specificity.

[0064] In some embodiments, the covalently coupled domains include an azide group and an alkynyl group, which are linked by a click chemistry reaction to form a triazole ring. The copper-free click chemistry reaction avoids the toxicity and interference of copper ions on biomolecules, resulting in milder reaction conditions suitable for the coupling of sensitive biomolecules such as peptides and nucleic acids. The stable triazole ring structure effectively links peptides and nucleic acids, ensuring the structural integrity and functional stability of the probe.

[0065] In some embodiments, the hydrophilic spacer arm is a polyethylene glycol chain. Polyethylene glycol spacers possess excellent hydrophilicity and flexibility, which can reduce steric hindrance between peptides and nucleic acids, improve the probe's water solubility and biocompatibility, and facilitate the binding of functional peptides to CRP proteins and the assembly of signal nucleic acid fragments with Cas proteins.

[0066] In some of these embodiments, the azide group is an azide-modified lysine.

[0067] In some of these embodiments, the alkynyl group is a dibenzocyclooctynyl group.

[0068] In some embodiments, the C-terminus of the functional polypeptide includes an amino acid containing an azide group, and the 5' end of the signal nucleic acid fragment contains a cycloalkyne group. The azide group and the cycloalkyne group form a coupling structure through a click chemistry reaction. The azide group and the cycloalkyne group are a classic reaction pair in click chemistry, capable of reacting efficiently under mild conditions to form a stable triazole ring linkage. The amino acid containing the azide group can be lysine modified with an azide, and the cycloalkyne group can be dibenzocyclooctyne (DBCO).

[0069] In some embodiments, the polyethylene glycol chain is PEG4. The PEG4 spacer arm length is moderate, effectively reducing steric hindrance without significantly increasing the molecular weight of the probe, thus facilitating probe diffusion and binding. PEG4 also exhibits good hydrophilicity, improving the probe's solubility in aqueous solutions.

[0070] In some of these embodiments, the polypeptide-nucleic acid coupled probe has the following structure: N'-targeting recognition polypeptide-K(N3)-triazole ring-PEG4-signal nucleic acid fragment-3'.

[0071] Another aspect of this application provides a C-reactive protein detection kit, comprising a polypeptide-nucleic acid coupled probe.

[0072] In some embodiments, one or more of buffer solutions, standards, and solid supports are also included.

[0073] This application discloses a method for detecting C-reactive protein, comprising: using a polypeptide-nucleic acid coupled probe for detection.

[0074] In some of these embodiments, the method includes: contacting the sample to be tested with a peptide-nucleic acid coupled probe to allow the peptide-nucleic acid coupled probe to bind to C-reactive protein;

[0075] The addition of Cas protein, CrRNA, and a fluorescent probe forms a ternary complex and initiates trans-cleavage; the fluorescence signal is detected, and the concentration of C-reactive protein is determined based on the fluorescence signal intensity.

[0076] In some of these embodiments, the Cas protein includes the Cas12a protein.

[0077] In some embodiments, the fluorescent probe includes an 8C-FQ fluorescent probe.

[0078] In some embodiments, the concentration of the peptide-nucleic acid conjugate probe is 8 nM to 12 nM. For example, the concentration of the peptide-nucleic acid conjugate probe is 8 nM, 9 nM, 10 nM, 11 nM, or 12 nM, or any value in between.

[0079] In some embodiments, the excitation wavelength for detecting fluorescence signals is 480nm-490nm, and the emission wavelength is 530nm-540nm.

[0080] For example, the excitation wavelength can be 480 nm, 481 nm, 482 nm, 483 nm, 484 nm, 485 nm, 486 nm, 487 nm, 488 nm, 489 nm, or 490 nm, or any value in between.

[0081] For example, the emission wavelength can be 530 nm, 531 nm, 532 nm, 533 nm, 534 nm, 535 nm, 536 nm, 537 nm, 538 nm, 539 nm, or 540 nm, or any value in between.

[0082] It is understood that the methods for detecting C-reactive protein in this application include both disease diagnosis and treatment purposes and non-disease diagnosis and treatment purposes. Non-disease diagnosis and treatment scenarios include drug and vaccine development: in preclinical studies, CRP can serve as an inflammatory biomarker to assess the safety of candidate drugs or vaccines, and can be used for toxicity or safety studies in animals (such as rabbits and pigs). The implementation schemes of this application will be described in detail below with reference to examples.

[0083] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the field, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the field.

[0084] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0085] It should be understood that in the various embodiments of this application, the order of the above-mentioned processes does not imply the order of execution. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0086] Example 1

[0087] I. Virtual Screening of CRP-Targeting Peptides

[0088] A polypeptide-nucleic acid coupled probe targeting C-reactive protein (CRP) was designed and obtained through molecular docking screening. Its main molecular structure is as follows: Figure 1 As shown.

[0089] Molecular docking: (Reference Zhao X, Liu TG, Chen H, Chen 2025 Mar 21. PMID: 40139042.)

[0090] Peptide aptamers were modeled using Chem 3D modeling software, and energy minimization analysis was performed on the models to construct small molecule structure files for use as small molecule ligands. Blind docking was performed using Autodock Vina molecular docking software. Binding strength was evaluated using its mixed scoring function. Gradient-based optimization algorithms, combined with exhaustive search and energy range parameters, controlled sampling. Finally, a three-dimensional rectangular box was used to define the binding site. These three core components worked together to achieve efficient and relatively accurate molecular docking to obtain key amino acid information on the peptide aptamer molecule that binds to the antigen. The affinity between the peptide aptamer and the antigen protein was evaluated based on the molecular docking results. Studies showed that the binding energy during antigen-antibody binding ranges from -5 to -11 kcal / mol (the lower the binding energy, the tighter the binding). Twenty-one aptamers were screened, and peptide aptamers with binding energies less than -6.5 kcal / mol were selected. A full amino acid scan was performed on these aptamers to obtain their sequence: KWRWRFRLSR, which was used for peptide nucleic acid construction. The probe comprises a functional polypeptide that specifically recognizes CRP and a signaling nucleic acid fragment that serves as a signaling / capture element. Its overall structure is shown below:

[0091] N'-KWRWRFRLSR-K(N3)-(triazole ring)-PEG4-ATCAACACCGCCGCTGTCAGTG-3'.

[0092] In this study, KWRWRFRLSR represents the targeted peptide; K(N3) is an additional lysine residue with azido-modified hydroxyl group introduced at the C-terminus as a coupling site; this azido group forms a stable triazole ring with the dibenzocyclooctylene (DBCO) group at the 5' end of the nucleic acid via a copper-free catalytic click chemistry reaction (SPAAC), achieving covalent coupling; PEG4 is a flexible hydrophilic spacer arm used to reduce steric hindrance and improve water solubility. The synthetic route is as follows: Figure 2 As shown, it was constructed using a solid-phase synthesis method.

[0093] Characterization results:

[0094] like Figure 3 As shown, the molecular weight identification chromatogram by electrospray ionization mass spectrometry (ESI-MS) shows that the measured molecular weight is 9037.4 Da, which is in high agreement with the theoretical molecular weight of 9039.1 Da, with a deviation of -1.7 Da (relative deviation <0.05%), confirming that the target sequence was synthesized correctly.

[0095] like Figure 4 As shown, the ultra-high performance liquid chromatography (UPLC) purity analysis chromatogram shows that the retention time of the target main peak is 3.399 min, the purity by area normalization is 91.85%, and the remaining impurity peaks are synthetic byproducts, which meet the conventional release standards.

[0096] II. Dynamic Simulation Verification

[0097] Cromacs was used to perform a 100 ns kinetic simulation of peptide-nucleic acid and CRP, and gmx_MMPBSA was used to decompose the simulated trajectory to further analyze the effect of peptide-nucleic acid coupled probe on CRP response.

[0098] The results are as follows Figure 5 As shown: the stable binding conformation of the polypeptide-nucleic acid coupled probe and CRP protein obtained after 100 ns molecular dynamics simulation.

[0099] like Figure 6 As shown in the figure, the root mean square deviation (RMSD) curve of the peptide-nucleic acid coupled probe and CRP protein complex during a 100 ns molecular dynamics simulation is as follows: After 10 ns, the RMSD of the backbone atoms tends to converge with a small fluctuation, indicating that the conformation of the complex has basically reached equilibrium.

[0100] III. Affinity Verification

[0101] To quantitatively assess the binding affinity between the peptide-nucleic acid coupled probe and the CRP protein, this application employed the MM-GBSA (Molecular Mechanics / Generalized Born Surface Area) method to calculate the binding free energy and perform energy decomposition analysis on the complex system at the end of a 100 ns molecular dynamics simulation trajectory. The results are as follows: Figure 7 As shown, the total contribution of binding free energy (ΔTOTAL) is -35.53 kcal / mol, indicating that the probe has a strong binding affinity to the CRP protein.

[0102] From the perspective of energy contribution decomposition: the gas phase energy (ΔGGAS) is -68.94 kcal / mol, which is the main driving force for the binding process. Among them, van der Waals interactions (ΔVDWAALS) contribute -68.94 kcal / mol, indicating that the hydrophobic stacking and spatial complementarity between the probe and the CRP protein binding pocket play a dominant role in binding affinity. The solvation energy (ΔGSOLV) is +33.41 kcal / mol, which has a detrimental effect on binding, reflecting the energy cost of desolvation during probe binding. Specifically, the polar solvation energy (ΔEPB) is +22.27 kcal / mol, and the nonpolar solvation energy (ΔENPOLAR) is +11.14 kcal / mol. The total binding free energy (ΔTOTAL = ΔGGAS + ΔGSOLV) is -35.53 kcal / mol, and the net balance between van der Waals interactions and solvation determines the stable binding of the probe to the CRP protein. The results are as follows... Figure 7As shown, the simulated trajectory analysis of peptide nucleic acid and CRP protein shows a binding energy of -35.53 kCer / mol.

[0103] IV. Direct detection of CRP protein using peptide-nucleic acid coupled probes

[0104] Reagent sources: 10×HOLMES Buffer for Cas12a was purchased from Shanghai Tulugang Biotechnology Co., Ltd. (Cas: 32042); Cas12a protein was purchased from Shanghai Tulugang Biotechnology Co., Ltd. (Cas: 32110); 8C-FQ probe was synthesized by Guangzhou Aiji Co., Ltd. (synthesis information: FAM-CCCCCCCC-BHQ1); CrRNA was synthesized by Wuhan Heze Gene Technology Co., Ltd. (synthesis information: SEQ ID NO.3: AAUUUCUACUCUUGUAGAUACACUGACAGCGGCGGUGUUGAU); peptide nucleic acid was synthesized by Genscript Biotech Co., Ltd.

[0105] 1. Experimental steps for direct detection of CRP antigen:

[0106] 1) Coating: Dilute the CRP antigen protein with coating buffer (pH 9.6, carbonate buffer), add 100 μL to each well of the black ELISA plate, and incubate overnight at 4°C or for 2 hours at 37°C.

[0107] 2) Cleaning: Pour out the liquid in the microplate, blot dry on absorbent paper, add 200 μL PBST, shake at 400 rpm for 2 min, blot dry, and repeat three times.

[0108] 3) Sealing: Add 200 μL of 5% BSA to each well and seal at 37°C for 2 hours.

[0109] 4) Wash three times.

[0110] 5) Dilute the peptide-nucleic acid conjugate probe to 10 nM with PBST, add 100 μL to each well, and react at room temperature for 1 h.

[0111] 6) Wash five times.

[0112] 7) Prepare the Cas protein detection system by adding 50 μL to each well and reacting for 30 min. The specific components are shown in Table 1 below:

[0113] Table 1

[0114] CrRNA (250 nM) 2.5μL Cas12a (10 μM) 2.5μL 10*Buffer 5μL 10μM 8C-FQ probe 5μL <![CDATA[ddH2O]]> 35μL

[0115] 8) Read the results using a fluorescence microplate reader (Ex: 485nm; Em: 535nm).

[0116] To evaluate the quantitative detection capability of the peptide-nucleic acid coupled probe, this application used a direct method to detect CRP standards at different concentration gradients (0.15625 μg / mL, 0.3125 μg / mL, 0.625 μg / mL, 1.25 μg / mL, 2.5 μg / mL, 5 μg / mL, and 10 μg / mL), and recorded their fluorescence intensity at Ex / Em = 485 / 535 nm. A standard curve was plotted with CRP concentration on the x-axis and fluorescence response value on the y-axis. Figure 8 As shown, the results indicate that within the concentration range of 0.15625 μg / mL to 10 μg / mL, CRP concentration exhibits a good linear relationship with fluorescence signal (R0). 2 =0.9811). This standard curve can be used for the quantitative detection of CRP, indicating that the probe has high quantitative accuracy and reliability.

[0117] The blank and low-concentration samples were measured 20 times each, and the fluorescence signal readings were recorded. The limit of blank (LoB) and limit of detection (LoD) of the detection method were calculated to evaluate the sensitivity of the peptide nucleic acid to CRP protein samples. The calculation method is as follows: LoB = blank well + 1.645 (s 空白孔 LoD = LoB + 1.645(s) 低浓度孔 Experimental results showed that the nucleic acid LoD of this peptide was 0.136 μg / mL; LoB was 0.062 μg / mL.

[0118] The embodiments described above are merely illustrative of several implementation methods of this application, intended to facilitate a detailed understanding of the technical solutions of this application, but should not be construed as limiting the scope of protection of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the scope of protection of this application. Furthermore, it should be understood that after reading the above teachings of this application, those skilled in the art can make various alterations or modifications to this application, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided in this application through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this patent application should be determined by the content of the appended claims, and the specification can be used to interpret the content of the claims.

Claims

1. A polypeptide-nucleic acid coupled probe, characterized in that, include: The targeted recognition peptide, the signal nucleic acid fragment, and the connecting arm connecting the targeted recognition peptide and the signal nucleic acid fragment; The targeted recognition peptide is used to specifically recognize and bind to C-reactive protein; The signal nucleic acid fragment is used to assemble with Cas protein and CrRNA into a ternary complex and initiate trans-cleavage.

2. The polypeptide-nucleic acid coupled probe according to claim 1, characterized in that, The linker arm of the signal nucleic acid fragment includes a covalently coupled structural domain and a hydrophilic spacer arm; The covalently coupled domain is used to connect the target recognition peptide and the signal nucleic acid fragment; The hydrophilic spacer arm is located between the target recognition peptide and the signal nucleic acid fragment.

3. The polypeptide-nucleic acid coupled probe according to claim 2, characterized in that, It meets one or more of the following conditions: (1) The amino acid sequence of the targeted recognition peptide is shown in SEQ ID NO.1; (2) The nucleotide sequence of the signal nucleic acid fragment is shown in SEQ ID NO.2; (3) The covalently coupled structural domain includes an azide group and an alkynyl group, wherein the azide group and the alkynyl group are connected by a triazole ring group; and (4) The hydrophilic spacer arm is a polyethylene glycol chain.

4. The polypeptide-nucleic acid coupled probe according to claim 3, characterized in that, The azide group is an azide-modified lysine; and / or The alkynyl group is a dibenzocyclooctynyl group; and / or The polyethylene glycol chain is PEG4.

5. The polypeptide-nucleic acid coupled probe according to any one of claims 1 to 4, characterized in that, The polypeptide-nucleic acid coupled probe has the following structure: N'-targeting recognition polypeptide-K(N3)-triazole ring-PEG4-signal nucleic acid fragment-3'.

6. A C-reactive protein detection kit, characterized in that, The polypeptide-nucleic acid coupled probe includes any one of claims 1 to 5.

7. The C-reactive protein detection kit according to claim 6, characterized in that, It also includes one or more of buffer solutions, standards, and solid supports.

8. A method for detecting C-reactive protein for purposes other than disease diagnosis and treatment, characterized in that, include: The detection was performed using the polypeptide-nucleic acid coupled probe according to any one of claims 1 to 5.

9. The method for detecting C-reactive protein for non-disease diagnosis and treatment purposes according to claim 8, characterized in that, include: The sample to be tested is brought into contact with the polypeptide-nucleic acid coupled probe, so that the polypeptide-nucleic acid coupled probe binds to C-reactive protein; Adding Cas protein, CrRNA and fluorescent probe forms a ternary complex and initiates trans-cleavage function; as well as The concentration of C-reactive protein is determined by detecting the fluorescence signal intensity.

10. The method for detecting C-reactive protein for non-disease diagnosis and treatment purposes according to claim 9, characterized in that, It meets one or more of the following conditions: (1) The Cas protein includes the Cas12a protein; (2) The fluorescent probe includes the 8C-FQ fluorescent probe; (3) The concentration of the polypeptide-nucleic acid coupled probe is 8nM-12nM; as well as (4) The excitation wavelength for detecting fluorescence signals is 480nm-490nm, and the emission wavelength is 530nm-540nm.

Images